CN113151488A

CN113151488A - Molecular marker related to sheep feed conversion rate and application thereof

Info

Publication number: CN113151488A
Application number: CN202110206129.8A
Authority: CN
Inventors: 汪晓娟; 张德印; 王维民; 李发弟; 张小雪; 李冲; 袁律峰; 赵源; 徐丹
Original assignee: Gansu Agricultural University
Current assignee: Gansu Agricultural University
Priority date: 2021-02-24
Filing date: 2021-02-24
Publication date: 2021-07-23

Abstract

The invention discloses a molecular marker related to sheep feed conversion rate and application thereof. According to the invention, PCR amplification and sequence analysis are carried out on the sheep CA 1gene, a C/T polymorphic site is found to exist at 199 th site of an amplified fragment, a KASPar primer pair is further used for detecting the corresponding polymorphic site and establishing a least square model, and correlation analysis is carried out on the genotype and the feed conversion rate of 508 Hu sheep, so that the existence of a molecular marker related to the feed conversion rate of sheep in the amplified CA 1gene fragment is determined. In breeding practice, the sheep with CC homozygote can be selected to enter a core group, and the feed conversion rate is improved, so that the feed consumption and the breeding cost are reduced.

Description

Molecular marker related to sheep feed conversion rate and application thereof

Technical Field

The invention relates to molecular marker-assisted selection of a new mutton sheep variety, in particular to Single Nucleotide Polymorphism (SNP) locus typing detection of a CA 1gene and application of the SNP locus typing detection as a molecular marker influencing sheep feed conversion rate.

Background

The breeding accounts for the highest proportion in the scientific and technological contribution of livestock breeding, and the proportion is more than 40 percent. And the performance measurement is the basis of breeding. In the production practice of mutton sheep, the cost of forage accounts for 65-70% of the total cost, so that the improvement of the feed efficiency has important significance for economy and environmental protection. Feed Conversion Rate (FCR) has been used as an important index for measuring the efficiency of Feed utilization for a long time, and research has shown that Feed conversion rate is a medium heritability (0.26-0.41), is genetically controlled, and can be improved by selection (Saint ilan R, Serlier P, Billon Y, Gilbert H. genetic correlations between varieties, varieties and frameworks for residual Feed, yield conversion rate, growth and varieties in Large White grains. J animal bred Gene 2012; 129-. Finding out the variation site of gene and the relation between gene and character through correlation analysis with character is one important means of researching gene function and is also the basis for marker assisted selection. However, there are few reports of candidate genes related to the conversion rate of sheep feed, for example, chinese patent CN109694916A, etc.

Carbonic Anhydrase 1(Carbonic Anhydrase 1, CA1) is a member of the Carbonic Anhydrase family and encodes CA1, which has two promoters that are very active in the colonic epithelium and erythrocytes. It is closely linked to the genes CA2 and CA3, and can participate in a plurality of biological processes such as respiration, acid-base equilibrium, saliva and gastric acid formation. Researchers have found that carbonic anhydrase is important for the absorption of NaCl, alkalization of intestinal contents and absorption of short chain fatty acids in the gastrointestinal tract (Drummond F, Sowden J, Morrison K, et al. the calcium-type homeobox protein Cdx-2 binding to the colon promoter of the carbonic acid anhydride 1gene [ J ]. European Journal of Biochemistry,1996,236(2): 670.). The acid-base balance of the gastrointestinal tract and the formation of gastric acid can affect the digestion and absorption of food by the body and thus its metabolism. The feed conversion rate belongs to medium heritability, and is influenced by factors such as basal metabolism, nutrient digestion and metabolism, energy output, body activity, body temperature regulation and the like (Zhang X, Wang W, Mo F, La Y, Li C, Li F. Association of residual feed intake with growing and sleeping performance, blood metabolism, and body composition in growing lambs. Sci Rep. 2017; 7(1):12681.Published2017Oct 4.doi:10.1038/s41598-017 13042-7).

KASP is an abbreviation for competitive Allele Specific PCR (Kompetitive Allle Specific PCR), and the KASP detection technique does not require the synthesis of a Specific fluorescent probe for each SNP site, but rather allows all site detections to be eventually amplified using universal fluorescent primers based on the ARM PCR principle.

Considering that the FCR is used for representing the feed utilization efficiency, the accuracy of the FCR is not enough, and therefore, more molecular markers which are positioned on the sheep genome are required to be used. At present, reports for analyzing and sequencing the CA 1gene and discussing the correlation between different genotypes of the CA 1gene and the sheep feed conversion rate are not found.

Disclosure of Invention

The invention aims to provide a molecular marker related to sheep feed conversion rate and application thereof. The DNA sequence of the sheep CA 1gene is amplified and sequenced, the polymorphic site of the CA 1gene is searched, and the relevance of different genotypes of the DNA sequence and the conversion rate of sheep feed is discussed, so that the detection method of the molecular marker related to the conversion rate of the sheep feed can be established.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention provides a molecular marker related to sheep feed conversion rate, wherein the molecular marker is positioned on the 7 th exon (specifically 10060bp) of a sheep CA 1gene (GenBank accession number of reference sequence: NC-040260.1), and can be obtained by amplifying a sheep CA 1gene, and specifically, the molecular marker is positioned on the 199 th position of a sheep CA 1gene fragment with a nucleotide sequence shown as SEQ ID. NO.1, wherein Y represents C or T, namely, the sequence has a C/T mutation at the 199 th base, so that the C/T polymorphism of the sheep CA 1gene at the corresponding position is caused.

In a second aspect, the present invention provides a primer for detecting a molecular marker associated with sheep feed conversion ratio, any primer (e.g., PCR primer pair) capable of specifically amplifying the above sheep CA 1gene fragment or other homologous fragment containing the polymorphic site (i.e., position 199 of seq. id No.1) contained in the fragment is suitable for detecting the molecular marker.

Preferably, the nucleotide sequence of the PCR primer pair of the sheep CA 1gene fragment is:

the upstream primer C-F: 5 '-ATCAAGCAGAACTACCGACCA-3' (SEQ. ID. NO. 2);

the downstream primer C-R: 5 '-ATTTGTCTTCAAGCGTAAGCA-3' (SEQ. ID. NO. 3).

Preferably, the nucleotide sequence of the KASPar primer pair is:

forward primer F1 for detection of allele C:

5＇-GAAGGTGACCAAGTTCATGCTGTTCAACATAAAGAAGAAAAAGATTTTGC G-3＇(SEQ.ID.NO.4)；

forward primer F2 for detection of allele T:

5＇-GAAGGTCGGAGTCAACGGATTGAGTTCAACATAAAGAAGAAAAAGATTTT GCA-3＇(SEQ.ID.NO.5)；

a universal reverse primer R: 5 '-GCAAGACAGCCTGCTTGCGAATTTA-3' (SEQ. ID. NO. 6).

In a third aspect, the invention provides a kit for detecting a molecular marker related to sheep feed conversion rate, which comprises the above-mentioned primers for detecting a molecular marker related to sheep feed conversion rate, such as a PCR primer pair and a KASPar primer pair.

In a fourth aspect, the present invention provides a method for detecting a molecular marker associated with feed conversion ratio in sheep, comprising the steps of:

1) amplifying a CA 1gene fragment containing the polymorphic site by using sheep genomic DNA as a template;

2) typing and identifying the corresponding polymorphic sites of the amplification products obtained in the step 1).

Any method for SNP typing can be used for typing, including but not limited to direct sequencing, probe method, gene chip method, high resolution melting curve method, and other methods (for example, KASP detection technology) capable of detecting the polymorphic sites where known molecular markers are located.

Preferably, the detection method of the molecular marker related to the sheep feed conversion rate specifically comprises the following steps:

1.1) extracting genome DNA (deoxyribonucleic acid) as a template by taking sheep individual blood as a sample, and amplifying by using PCR (polymerase chain reaction) primer pairs shown in SEQ.ID.NO.2 and SEQ.ID.NO. 3;

1.2) sequencing and sequence analyzing the amplified product, thereby determining the genotype of the sheep individual through analyzing the obtained base type of the polymorphic site.

2.1) taking sheep individual blood as a sample to extract genome DNA as a template, and carrying out high-flux water bath PCR amplification by using a KASPar primer pair shown in SEQ. ID. NO. 4-6;

2.2) after the amplification is finished, detecting a fluorescence signal and checking the genotyping result of the sheep individual at the polymorphic site.

In a fifth aspect, the invention provides an application of the detection primer pair, the kit or the detection method of the molecular marker in sheep feed conversion rate detection, wherein the level of the sheep feed conversion rate can be determined by amplifying and detecting the CA 1gene of a sheep to be detected and analyzing the genotype of the polymorphic site, and then a sheep with high feed conversion rate (for example, a sheep individual with CC genotype at the polymorphic site) can be screened out.

In a sixth aspect, the invention provides an application of the detection primer pair, the kit or the detection method of the molecular marker in sheep breeding, wherein the CA 1gene is amplified and detected to determine the genotype of a sheep to be detected at a corresponding polymorphic site, so that a sheep population with a high feed conversion rate can be bred (for example, a sheep homozygous for CC is selected to enter a core population, and the improvement of the sheep feed conversion rate helps to reduce the feed consumption and the breeding cost), so as to accelerate the breeding process of sheep varieties.

Preferably, the breeding is the breeding of grain-saving sheep varieties.

The invention has the beneficial effects that:

experiments show that a C/T polymorphic site (discovered by PCR amplification and sequencing) existing at the 199 th site of a sheep CA 1gene fragment has a molecular marker related to the sheep feed conversion rate (discovered by detecting the polymorphism of 508 Hu sheep and establishing a least square model), and the molecular marker provides more genetic engineering means for genetic improvement of the sheep feed efficiency, promotes the breeding of grain-saving sheep and the breeding of new varieties of grain-saving high-quality mutton sheep, and has great practical application value.

Furthermore, the invention designs the KASPar primer pair to carry out molecular marker detection, thereby obviously reducing the cost of the reagent and simultaneously keeping the accuracy of the gold standard of the Taqman probe, thereby providing a simple, convenient, accurate and low-cost operation method for the detection of the molecular marker.

Drawings

FIG. 1 is a gel electrophoresis diagram of a PCR product of a sheep CA 1gene fragment containing a molecular marker in an example of the present invention; wherein, lane M: DL 2000Marker, lanes 1-10: CA 1gene amplification result.

FIG. 2 shows the sequencing result of the sheep CA 1gene mutation site g.199C > T in the example of the present invention.

FIG. 3 shows the result of KASPar SNP typing of the mutation site (g.199C > T) of the sheep CA 1gene in the example of the present invention; where the red dots near the left represent the TT genotype, the green dots near the middle represent the TC genotype, and the blue dots near the right represent the CC genotype.

Detailed Description

The invention is described in further detail below with reference to the figures and examples, which are provided for illustration only and are not intended to limit the scope of the invention as claimed.

(first) amplification of CA 1Gene

(1) Primer design

A pair of primers C-F and C-R were designed using Oligo7.0 software with reference to the sheep CA 1gene DNA (GenBank accession No.: NC-040260.1), and the primer sequences were as follows:

C-F：5＇-ATCAAGCAGAACTACCGACCA-3＇(SEQ.ID.NO.2)

C-R：5＇-ATTTGTCTTCAAGCGTAAGCA-3＇(SEQ.ID.NO.3)

(2) amplification and sequencing of the CA 1Gene

The total volume of the PCR reaction system is 25 mu L: genomic DNA template 1. mu.L, 2 XPCR Master Mix 12.4. mu.L, forward primer C-F0.8. mu.L (10. mu.M), reverse primer C-R0.8. mu.L (10. mu.M), and ddH₂O 10μL。

PCR amplification procedure: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 54.5 ℃ for 30s, extension at 72 ℃ for 30s, and circulation for 35 times; finally, extension is carried out for 10min at 72 ℃.

The PCR reaction product was detected by 1.5% agarose gel electrophoresis, and the result showed that 576 bp-specific amplified fragment was obtained (FIG. 1). The amplified product fragment is sequenced, and the sequencing result shows that 576bp DNA fragment can be amplified from sheep CA 1gene by using the primer, the sequence information can refer to the nucleotide sequence (SEQ. ID. NO.1) shown in the specification, and a polymorphic site exists in the fragment (namely, C/T polymorphism exists at 199bp site in the amplified CA 1gene fragment; figure 2).

5＇-ATCAAGCAGAACTACCGACCACCCCAGCCTCTGAAGGGCAGGACAGTGAA AGCTTCATTCTGACGGGCCCAAGAGGAAGCTCACCTTCCCTCAAGAAGCACAGCTCTGCTTCTGGCATAATCCAACAAAACTAGCTTTAAGAAACACATTTATTTCAATACTAGCAAGACAGCCTGCTTGCGAATTTACTCTGCAGAAYGCAAAATCTTTTTCTTCTTTATGTTGAACTCAAACAGTAATCTGTAAGTTCACTAAACTTGTGCTTAAATTCAATCTGTTGCATTGACTTTCTTATCATTGCAGTTAAGGCATACTTGATTTCTTCAAGGCTTTATCCCTTCCCATTTTATTCAGTTTAATTGGACGAAAAATAATTTTATCCCTTTCTTCTTGTCTATTACGTACTATACGTTTAAATGGCATTAGGTGCTACTCCATTTACATTCAAGAATCTTAAATGCTTTCATTTGCAACATTATTCTGATGCGATATCAGGTCTATTACTCAAATATAATGACCTAAGAGCAGCTTGAGATGAAATGTTAAGAATTCATTTGCTTACGCTTGAAGACAAAT-3＇

DNA sequence homology search identification:

the DNA sequence obtained after sequencing (SEQ. ID. NO.1) was compared with the sequence of a gene published in the GenBank database by BLAST (basic Local Alignment Search tool) software of the website of the National Center for Biotechnology Information (NCBI, National Center for Biotechnology Information, http:// www.ncbi.nlm.nih.gov) and showed 99% sequence homology to a portion of the DNA of the sheep CA 1gene (GenBank accession No. NC-040260.1).

(II) establishment of genotyping detection method

(1) Primer sequence design

Designing a KASPar primer pair against the C/T polymorphic site of the amplified fragment of (A) for specific detection of said polymorphic site, said KASPar primer pair having the nucleotide sequence:

forward primer F1 for detecting allee C:

5＇-GAAGGTGACCAAGTTCATGCTGTTCAACATAAAGAAGAAAAAGATTTTGC G(SEQ.ID.NO.4)-3＇

forward primer F2 for detecting allee T:

5＇-GAAGGTCGGAGTCAACGGATTGAGTTCAACATAAAGAAGAAAAAGATTTT GCA-3＇(SEQ.ID.NO.5)

a universal reverse primer R: 5 '-GCAAGACAGCCTGCTTGCGAATTTA-3' (SEQ. ID. NO.6)

The primers are synthesized by Beijing Biotechnology Co., Ltd, and each primer in the KASPar primer pair is diluted to 10 μmol/L and mixed uniformly according to the volume ratio of 12:12:30 (primer F1: primer F2: primer R) for later use.

(2) DNA quality control

The quality of the extracted genome DNA is detected by 1% agarose electrophoresis and Nanodrop2100 respectively, and the qualified DNA requirements are as follows: agarose electrophoresis showed that the DNA band was single and not dispersed significantly; the Nanodrop2100 detects A260/280 between 1.8 and 2.0 (DNA sample is not polluted by protein); a260/230 is between 1.8 and 2.0 (the concentration of salt ions in the DNA sample is low); no significant light absorption at 270nm (DNA samples without phenol contamination) was observed. According to KASP detection technology and genome size of LGC company in England, the amount of genome DNA is converted into 10-20 ng/sample, and the diluted DNA concentration is 10-20 ng/mu L, which is used as a DNA template for standby.

(3) Genotyping

Firstly, 1.5 muL of diluted DNA template (10-20 ng/muL) to be detected and blank control (NTC, namely water control) are respectively added into a 384-hole reaction plate by using a K-pette liquid separation workstation, and the DNA is dried for 30min at 60 ℃ (a drying box, LGC company) to become dry powder for later use. Then under a Kraken operating system, 1 xMaster Mix (1536 micro plate with the product number of Part No. KBS-1016-. The specific procedure for carrying out the PCR reaction in the Hydrocycler high-throughput water bath system was:

1) pre-denaturation at 94 ℃ for 15 min;

2) amplification in touch down sequence for 10 cycles of 94 ℃ at 20 seconds (denaturation) -61 ℃ to 55 ℃ for 1 minute (renaturation & extension), 0.6 ℃ reduction per cycle;

3) amplification was continued for 26 cycles at 94 ℃ for 20 seconds (denaturation) to 55 ℃ for 60 seconds.

After amplification is finished, detecting a fluorescence signal by using a BMG PHERAStar instrument and checking the typing condition, wherein the specific result is shown in figure 3, each dot in figure 3 represents a sample to be detected, and a red dot close to the left side represents that the site is a homozygous genotype TT (T: T); the blue dots near the right indicate that the locus is homozygous genotype "CC" (C: C); the green dots near the middle indicate that the locus is a heterozygous genotype "TC" or "CT" (T: C); the black dots represent NTCs (not shown in fig. 3).

(III) analysis of association between mutation site CA1 g.199C > T and sheep feed conversion rate

The test detects the polymorphism of 508 Hu sheep (the test sheep are raised in Defu agriculture science and technology Co., Ltd. in 2019 from 5 months to 12 months, blood samples are collected after 180 days of raising test), the genotype is determined, a least square model is established as described below, and the correlation analysis of the genotype and the feed conversion rate is carried out.

Y_ijkl＝μ+Genotype_i+P_j+F_k+M_l+ε_ijkl

Wherein, Y_ijlkMu is the overall mean, Genotype, observed for feed conversion_iFor genotype effects, P_jFor batch effect, F_kFor the paternal effect, M_lIs a maternal effect,. epsilon_ijklFor random errors, assume ε_ijklIndependently of each other, obey an N (0, σ 2) distribution.

In the present invention, the model related to the calculation of the feed conversion ratio is as follows:

ADG＝(BW₁₈₀-BW₈₀₎/N,FCR＝AFI/ADG

wherein ADG is the average daily gain, BW₈₀For testing initial body weight, BW₁₈₀For end stage body weight test, N is the days of feeding and AFI is the average daily food intake.

According to the genotype test results, there were 61 TT genotypes, 415 TC genotypes and 32 CC genotypes among 508 individuals. The results of the genotype-trait association analysis are shown in table 1, and the results show that the mutation site CA1 g.199c > T is significantly related to the feed conversion rate of the hu sheep as the determination period is prolonged. Wherein the feed conversion rate of CC genotype individuals is obviously higher than that of TT genotype individuals (P < 0.05). The feed conversion rate of TC genotype individuals is lower than that of CC genotype individuals and higher than that of TT genotype individuals, but the difference is not significant (P > 0.05).

TABLE 1 Association analysis of sheep CA 1gene polymorphism and feed conversion ratio

Note: the data in the same row with different corner symbols represent significant difference (P <0.05), and the data with the same letter represents insignificant difference

The results show that as the T allele factor increases, the feed conversion rate of the corresponding individual decreases, and thus the C allele is known to be the dominant allele. The CC genotype of the mutation site CA1 g.199C > T can be used as a potential molecular marker influencing the feed conversion rate of sheep (such as Hu sheep).

In a word, the invention finds a polymorphic site (specifically, mutation site g.199C > T) on the CA 1gene by amplifying and sequencing the DNA sequence of the sheep CA 1gene, and can be further applied to the cultivation of new varieties of grain-saving high-quality mutton sheep by detecting molecular markers related to the conversion rate of sheep feed.

<110> university of agriculture in Gansu province

<120> molecular marker related to sheep feed conversion rate and application thereof

<160> 6

<210> 1

<211> 576

<212> DNA

<213> Ovis aries

<400> 1

atcaagcaga actaccgacc accccagcct ctgaagggca ggacagtgaa agcttcattc 60

tgacgggccc aagaggaagc tcaccttccc tcaagaagca cagctctgct tctggcataa 120

tccaacaaaa ctagctttaa gaaacacatt tatttcaata ctagcaagac agcctgcttg 180

cgaatttact ctgcagaayg caaaatcttt ttcttcttta tgttgaactc aaacagtaat 240

ctgtaagttc actaaacttg tgcttaaatt caatctgttg cattgacttt cttatcattg 300

cagttaaggc atacttgatt tcttcaaggc tttatccctt cccattttat tcagtttaat 360

tggacgaaaa ataattttat ccctttcttc ttgtctatta cgtactatac gtttaaatgg 420

cattaggtgc tactccattt acattcaaga atcttaaatg ctttcatttg caacattatt 480

ctgatgcgat atcaggtcta ttactcaaat ataatgacct aagagcagct tgagatgaaa 540

tgttaagaat tcatttgctt acgcttgaag acaaat 576

<210> 2

<211> 21

<212> DNA

<213> C-F

<400> 2

atcaagcaga actaccgacc a 21

<210> 3

<211> 21

<212> DNA

<213> C-R

<400> 3

atttgtcttc aagcgtaagc a 21

<210> 4

<211> 51

<212> DNA

<213> F1

<400> 4

gaaggtgacc aagttcatgc tgttcaacat aaagaagaaa aagattttgc g 51

<210> 5

<211> 53

<212> DNA

<213> F2

<400> 5

gaaggtcgga gtcaacggat tgagttcaac ataaagaaga aaaagatttt gca 53

<210> 6

<211> 25

<212> DNA

<213> R

<400> 6

gcaagacagc ctgcttgcga attta 25

Claims

1. A PCR primer pair for detecting molecular markers is characterized in that: the fragment amplified by the PCR primer pair comprises a molecular marker site related to the sheep feed conversion rate, and the molecular marker is positioned at the C/T mutation site of the sheep CA 1gene.

2. The PCR primer set for detecting molecular markers according to claim 1, wherein: in the PCR primer pair, the nucleotide sequence of the upstream primer is shown as SEQ.ID.NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ.ID.NO. 3.

3. A KASPar primer pair for detecting molecular markers is characterized in that: the fragment amplified by the KASPar primer pair comprises a molecular marker site related to the sheep feed conversion rate, and the molecular marker is positioned at the C/T mutation site of the sheep CA 1gene.

4. The KASPar primer pair for detecting molecular markers of claim 3, wherein: in the KASPar primer pair, the nucleotide sequence of the forward primer for detecting the allele C is shown as SEQ.ID.NO.4, the nucleotide sequence of the forward primer for detecting the allele T is shown as SEQ.ID.NO.5, and the nucleotide sequence of the universal reverse primer is shown as SEQ.ID.NO. 6.

5. A kit for detecting a molecular marker, comprising: the kit comprises the primer pair of claim 1 or 3, or any one of a primer which can specifically amplify a sheep CA 1gene fragment with a nucleotide sequence shown in SEQ ID No.1 and a primer which can specifically amplify other fragments which are homologous with the sheep CA 1gene fragment and contain C/T mutation sites contained in the sheep CA 1gene fragment.

6. A method of detecting a molecular marker, comprising: the method comprises the following steps:

1) amplifying a CA 1gene segment by taking sheep genome DNA as a template;

2) typing and identifying the molecular marker sites of the amplification products obtained in the step 1), wherein the molecular markers are positioned at the C/T mutation sites of the sheep CA 1gene.

7. The method of claim 6, wherein the step of detecting the molecular marker comprises: the method specifically comprises the following steps: the PCR primer pair of claim 1 is used for amplification, and sequencing and sequence analysis are carried out on an amplification product to obtain the base type of the mutation site.

8. The method of claim 6, wherein the step of detecting the molecular marker comprises: the method specifically comprises the following steps: the KASPar primer pair of claim 3 is used for PCR amplification, and the typing result of the mutation site is determined by a fluorescent signal after the amplification is finished.

9. The application of a molecular marker related to sheep feed conversion rate in sheep feed conversion rate detection or sheep breeding is characterized in that: the molecular marker is positioned at the C/T mutation site of the sheep CA 1gene.

10. Use of a primer pair according to any one of claims 1 to 4 or a kit according to claim 5 or a method according to any one of claims 6 to 8 for the detection of feed conversion in sheep or for breeding sheep.