CN112813177A - Pig offspring hair color prediction method based on haplotype MC1R x 31 gene - Google Patents
Pig offspring hair color prediction method based on haplotype MC1R x 31 gene Download PDFInfo
- Publication number
- CN112813177A CN112813177A CN202110373349.XA CN202110373349A CN112813177A CN 112813177 A CN112813177 A CN 112813177A CN 202110373349 A CN202110373349 A CN 202110373349A CN 112813177 A CN112813177 A CN 112813177A
- Authority
- CN
- China
- Prior art keywords
- mc1r
- haplotype
- hair color
- pig
- offspring
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 230000037308 hair color Effects 0.000 title claims abstract description 78
- 101001134060 Homo sapiens Melanocyte-stimulating hormone receptor Proteins 0.000 title claims abstract description 31
- 102100034216 Melanocyte-stimulating hormone receptor Human genes 0.000 title claims abstract description 31
- 238000000034 method Methods 0.000 title claims abstract description 31
- 102000054766 genetic haplotypes Human genes 0.000 title claims abstract description 29
- 101150070234 31 gene Proteins 0.000 title claims abstract description 19
- 241000282898 Sus scrofa Species 0.000 claims abstract description 121
- 238000005516 engineering process Methods 0.000 claims abstract description 5
- 241000282887 Suidae Species 0.000 claims description 42
- 238000001514 detection method Methods 0.000 claims description 19
- 108700028369 Alleles Proteins 0.000 claims description 9
- 108090000623 proteins and genes Proteins 0.000 claims description 9
- 230000008774 maternal effect Effects 0.000 claims description 6
- 230000008775 paternal effect Effects 0.000 claims description 6
- 238000009395 breeding Methods 0.000 abstract description 46
- 230000001488 breeding effect Effects 0.000 abstract description 44
- 241000894007 species Species 0.000 abstract description 12
- 238000000926 separation method Methods 0.000 description 18
- 230000008569 process Effects 0.000 description 11
- 235000015277 pork Nutrition 0.000 description 10
- 238000009396 hybridization Methods 0.000 description 9
- 238000005204 segregation Methods 0.000 description 9
- 239000003795 chemical substances by application Substances 0.000 description 8
- 230000035772 mutation Effects 0.000 description 8
- 238000002474 experimental method Methods 0.000 description 7
- 108020004414 DNA Proteins 0.000 description 5
- 239000003153 chemical reaction reagent Substances 0.000 description 5
- 230000001364 causal effect Effects 0.000 description 4
- 239000000796 flavoring agent Substances 0.000 description 4
- 235000019634 flavors Nutrition 0.000 description 4
- 108090000790 Enzymes Proteins 0.000 description 3
- 102000004190 Enzymes Human genes 0.000 description 3
- 101150015860 MC1R gene Proteins 0.000 description 3
- 238000012937 correction Methods 0.000 description 3
- 230000006872 improvement Effects 0.000 description 3
- 235000013372 meat Nutrition 0.000 description 3
- 238000012986 modification Methods 0.000 description 3
- 230000004048 modification Effects 0.000 description 3
- 238000002360 preparation method Methods 0.000 description 3
- 230000003595 spectral effect Effects 0.000 description 3
- 230000003321 amplification Effects 0.000 description 2
- 238000005251 capillar electrophoresis Methods 0.000 description 2
- 238000006243 chemical reaction Methods 0.000 description 2
- 238000009402 cross-breeding Methods 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 2
- 239000010931 gold Substances 0.000 description 2
- 229910052737 gold Inorganic materials 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 238000002156 mixing Methods 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 238000000746 purification Methods 0.000 description 2
- 101150084750 1 gene Proteins 0.000 description 1
- 108091092584 GDNA Proteins 0.000 description 1
- 241000277334 Oncorhynchus Species 0.000 description 1
- 238000010521 absorption reaction Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 238000001816 cooling Methods 0.000 description 1
- 230000001351 cycling effect Effects 0.000 description 1
- 238000007405 data analysis Methods 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 230000002349 favourable effect Effects 0.000 description 1
- 230000004907 flux Effects 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000010438 heat treatment Methods 0.000 description 1
- 235000020997 lean meat Nutrition 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 230000002093 peripheral effect Effects 0.000 description 1
- 108020003175 receptors Proteins 0.000 description 1
- 102000005962 receptors Human genes 0.000 description 1
- 238000007480 sanger sequencing Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000001228 spectrum Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a swine progeny hair color prediction method based on haplotype MC1R x 31 gene, which is characterized in that at least one of 661bp site, 721bp site and 781bp site of haplotype MC1R x 31 gene of male parent and/or female parent swine is detected, and based on a plurality of sites of MC1R x 31 gene, the hair color of special strains and new species (matched lines) progeny can be accurately predicted, the bred swine progeny are all black hair color, compared with the traditional breeding technology, the breeding period can be rapidly shortened, the breeding cost of the swine is reduced, and the hair color consistency and the economic value of the progeny swine or commercial swine are improved.
Description
The invention is a divisional application which is proposed by the applicant according to another invention patent of the prior application, and the application numbers of the invention patent application are as follows: 201911066191.0, filing date: 11, month and 4 in 2019, the invention name is: a breeding method of pure black and hairy pig breeds.
Technical Field
The invention relates to a method for predicting the hair color of a breeding pig offspring, in particular to a method for predicting the hair color of a breeding pig offspring based on a haplotype MC1R x 31 gene.
Background
In the past decades, genetic improvement of pigs mainly focuses on improving carcass performances such as growth speed and lean meat percentage, and neglects improvement of pork quality, so that the pork carcass performance is greatly improved, the pork quality is sharply reduced, and the mouthfeel is poor. Along with the development of social economy, the improvement of the living standard of people and the transformation of consumption concept, the consumer groups and the market structure of pork are also obviously changed, and the demand of high-quality pork products with good meat quality and good flavor is increased day by day.
The local pig breeds in China have the advantages of good meat quality, good flavor, strong stress resistance and the like, are good materials for making high-quality fine pork and are more advantageous resources for developing the best-quality pork. In addition, the fur of most local pigs in China is black, and consumers in China enjoy the black pork in a natural way, because the high-quality black pigs in the current market are usually hybrid pigs containing blood sources of local pig breeds in China, compared with the imported foreign pigs, the high-quality black pigs have better meat quality and mouthfeel, the selling price is higher than that of the foreign pigs, and even in the international market, the price of the black pork in Japan and Taiwan in China is obviously higher than that of the foreign pork. The market demand determines the breeding target, so that the breeding of the special strain with high quality, high efficiency and different market demands and the matched production of the black high-quality flavor pig by utilizing two types of gene resources at home and abroad become the main attack target in the pig breeding field.
However, in the breeding process of many black specialized strains and the breeding process of new varieties (matched lines), obvious hair color separation occurs in offspring, for example, commercial pigs of the matched line of Sichuan-Tibet black pigs have black and yellow hair color separation in a certain proportion, the first impression of consumers is sense, and the hair color separation can cause psychological rejection of consumers, thereby affecting the economic value of products. The hair color separation of the offspring boars or the commercial boars becomes a key technical problem of the neck clamp in the breeding process of the black specialized strain and the breeding process of the new variety (the matched strain).
The breeding of the hair color of the pig by the conventional breeding is to gradually eliminate individuals with separated hair color in the later generations through continuous generation breeding after the cross-breeding is fixed, so that the black color is gradually fixed. However, the traditional breeding technology is long in period, the expected hair color of the offspring of the breeding material can be fixed usually only after 6-8 generations or even longer, the predictability is poor, the offspring can be selected according to the hair color phenotype only after the offspring is born, the hair color separation condition of the offspring cannot be accurately predicted, the efficiency is low, the cost is high, and the process of specialized strain breeding and new variety (matched line) breeding is seriously influenced and limited.
Disclosure of Invention
One of the purposes of the present invention is to provide a swine offspring hair color prediction method based on haplotype MC1R × 31 gene aiming at the above disadvantages, so as to hopefully solve the technical problems that the breeding method of the same kind of swine in the prior art cannot accurately predict the offspring hair color separation condition, so that the efficiency is low, and the breeding process of the specialized strain breeding and new variety (matched line) is affected, etc.
In order to solve the technical problems, the invention adopts the following technical scheme:
the invention provides a swine offspring hair color prediction method based on haplotype MC1R × 31 gene, which is used for detecting at least one of 661bp site, 721bp site and 781bp site of haplotype MC1R × 31 gene of male parent and/or female parent swine, wherein:
(1) when 661bp locus of haplotype MC1R x 31 is AA genotype, allele A determines that the progeny is hair black, and A is dominant to G;
(2) when 721bp locus of haplotype MC1R × 31 is GG genotype, allele G determines that the progeny is black, and G is dominant to A;
(3) when 781bp locus of haplotype MC1R × 31 is CC genotype, allele C determines that the progeny is black, and C is dominant to T;
when the paternal and/or maternal swine haplotype MC1R x 31 gene satisfies any one of the above (1) to (3), it is predicted that the progeny will have a full black hair color.
Preferably, the further technical scheme is as follows: the method adopts the Snapshot technology to detect the loci of the haplotype MC1R x 31 genes of the male parent and/or female parent boars.
The further technical scheme is as follows: the method is used for predicting the hair color of the offspring of the Duroc pigs, the Bake summer pigs, the Taihu pigs and the Tibetan pigs.
The further technical scheme is as follows: in the detection of the paternal and/or maternal swine haplotype MC1R x 31 gene, the outside primer and the effective sequence at least comprise one of the following:
| AGGGAAGACTTGGTGGGGAG | F |
| CCGTGTGGTGGTAGTAGGCG | R |
the further technical scheme is as follows: in the detection of the paternal and/or maternal swine haplotype MC1R x 31 gene, the kit further comprises an inner primer, and the effective sequence of the inner primer at least comprises one of the following sequences:
| GCGCCCGCCTCCAGCAGC | R |
| CTGGCTTCCCTCAGCTCCGC | F |
| TGCTGGTGAGCGTGAGCAAC | F |
| GTGGTGCAGCAGCTGGACAA | F |
compared with the prior art, the invention has the following beneficial effects: based on a plurality of loci of MC1R × 31 genes, the fur color of offspring of specialized strains and new species (matched strains) can be accurately predicted, the bred offspring of the breeding pigs are all black, compared with the traditional breeding technology, the breeding period can be rapidly shortened, the breeding cost of the breeding pigs is reduced, and the consistency and the economic value of the fur color of the offspring of the breeding pigs or commercial pigs are improved. The method fills the blank in the field of quickly, directionally and flux screening the hair color of the offspring of the pig variety in China, promotes the independent innovation of the high-quality flavor black pig breeding industry, and realizes the leap of the pig hair color breeding in China from traditional breeding to directional and efficient accurate breeding.
Detailed Description
The invention is further illustrated with reference to specific embodiments below.
The following description is only exemplary of the present invention and is not intended to limit the scope of the present invention, which is defined by the claims and their equivalents, as well as any equivalents thereof, which may be directly or indirectly applied to other related arts.
157 pig ear tissue samples of 5 varieties are sampled and tested for genotypes of offspring of different combinations according to the hair color phenotype, 10 samples are extracted for each matched combination or hair color separation phenotype, and the total number of the samples is 100, and DNA is extracted from the ear tissue samples and used for subsequent Snapshot mutation site detection and typing.
The tests carried out by the present invention are as follows:
peripheral amplification of DNA specimens
1.1 primer sequences
Primer name primer sequence length
| Outside primer | Size and breadth | |
| MC1R-F | AGGGAAGACTTGGTGGGGAG | 757 |
| MC1R-R | CCGTGTGGTGGTAGTAGGCG |
1.2 Main instruments
2720thermal cycler (Applied Biosystems), plate centrifuge (5810R Eppendorf)
1.3 Primary reagents
Gold medal green enzyme Mix (Beijing Optimus department new biotechnology Co., Ltd.)
1.4 Experimental procedures
And (3) PCR reaction: amplification using the enzyme Oncorhynchus jinpaiensis Green:
gold medal green enzyme Mix 45 mul
F Primer(10P) 2μl
R Primer(10P) 2μl
gDNA 1μl
The reaction conditions are as follows:
98℃ 2min
98℃ 10s
60℃ 20s 35cycs
72℃ 10s
72℃ 1min
4℃ hold
2. template DNA preparation and primer design
2.1 SnaPshot PCR primer design
The effective sequences in the primers in the above table are as follows:
| MC1R-3-P | GCGCCCGGCTCCAGCAGC | 18 | R |
| MC1R-1-P | CTGGCTTCCCTCAGCTCCGC | 20 | F |
| MC1R-2-P | TGCTGGTGAGCGTGAGCAAC | 20 | F |
| MC1R-4-P | GTGGTGCAGCACCTGGACAA | 20 | F |
2.2 Main Instrument
2720thermal cycler (Applied Biosystems), plate centrifuge (5810R Eppendorf)
2.3 Primary reagents
SAP(New England Biolabs)，Exo I(New England Biolabs)
2.4 Experimental procedures
Adding 5U SAP and 2U Exo I into 15 μ L PCR product, shaking, mixing, and keeping the temperature at 37 deg.C
SnaPshot PCR preparation and purification
3.1 Main Instrument
2720thermal cycler (Applied Biosystems), plate centrifuge (5810R Eppendorf)
3.2 Primary reagents
SNaPshot Multiplex Kit(Applied Biosystems)
3.3 Experimental procedures
(1) Mixing the templates: if the PCR product is used as a template for the SNaPshot PCR, 3. mu.L of each was taken and mixed after purification.
(2)SNaPshot PCR：
The PCR cycling conditions were:
96℃ 10s
50℃ 5s 25cycs
60℃ 30s
4℃ hold
4. electrophoretic sample preparation
4.1 Main Instrument
2720thermal cycler (Applied Biosystems), plate centrifuge (5810R Eppendorf)
4.2 Primary reagents
Hi-Di(Applied Biosystems)，GeneScan-120 LIZ(Applied Biosystems)
4.3 Experimental procedures
The SNaPshot product was first diluted 20-fold:
denaturation at 95 ℃ for 5min → quick ice-cooling for 4 min.
5. Spectral correction
5.1 Main Instrument
2720thermal cycler (Applied Biosystems), polarized Zeeman atomic absorption spectrometer
ZA3700 (Hitachi)
5.2 Primary reagents
Hi-Di(Applied Biosystems)
5.3 Experimental procedures
Spectrum correction (Spectral Calibration)
(1)DS-02(E5)：dR110，dR6G，dTAMRA，dROX，LIZ。
(2)3700 spectral correction
6. Capillary electrophoresis detection and data analysis
6.1 Main instruments and software
3730xL DNA Analyzer(Applied Biosystems)，GeneMapper v4.0(Applied Biosystems)；
6.2 Experimental procedures
(1) The prepared samples were subjected to capillary electrophoresis using a 3730XL DNA Analyzer and the signals were collected.
Detecting an environmental condition:
laboratory temperature: 18-25 deg.C
Capillary length: 50cm
Temperature of the heating furnace: 60 deg.C
Operating voltage: 15KV
(2) The results of the experiment were analyzed using GeneMapper V4.0 and the results were corrected using Sanger sequencing.
The genes and detection sites are as follows:
Sus scrofa haplotype MC1R*31melanocortin receptor 1gene(GenBank:GQ900673.1)
421 ggacgatgcc tgtgcttggc ccggagagga ggctgctggc ttccctcagc tccgcA/G (site 1) cccc
481 cagccgcccc ccgcctcggg ctggccgcca accagaccaa ccagacgggc ccccagtgcc
541 tggaggtgtc cattcccgac gggctcttcc tcagcctggg gctggtgagc ctcgtggaga
601 acgtgctggt ggtggccgcc atcgccaaga accgcaacct gcactcgccc atgtactact
661tcgtctgctg cctggccgtg tcggacctgc tggtgagcgt gagcaacA/G (position 2) tgctggagacgg
721 ccgtgctgcC/T (position 3) gctgctggag gcgggcgccc tggccgccca ggccgccgtggtgcagcagc
781 tggacaaC/T (position 4) gt catggacgtg ctcatctgcg gctccatggt gtccagcctctgcttcctgg
841 gcgccatcgc cgtggaccgc tacgtgtcca tcttctacgc gctgcgctac
Note: in the above gene, "A/G" indicates that the base at the site may be either A or G. "C/T" is as above.
Among the 4 sites detected, site 1 does not accord with the separation rule of the coat color phenotype, and site 2, site 3 and site 4 show that the coat color phenotype has a causal relationship, and the specific results are as follows.
Detection of MC1R Gene site 2(A/G)
Table 15 variety site 2 gross color detection results
For site 2, the Duroc pig and the Backxia pig, which are the exogenesis pigs, are GG genotypes, the Taihu lake pig and the Tibetan pig, which are the local breeding pigs, are AA genotypes, and the black male parent new species S06 genotypes, which are bred by the exogenesis pig and the local breeding pig through cross-breeding fixation and continuous generation breeding, are AA and AG. SNP mutations at position 2 have a causal relationship with coat color, where allele A determines black coat color and A is dominant over G.
TABLE 2 results of the detection of the hair color of the filial generation sites 2 of different varieties
The results of the observation of the hair color phenotype of the filial generations of different varieties and the detection of the locus 2 genotype show that:
(1) the offspring of the hybridization of the external breeding pigs and local breeding pigs (Duroc X Taihu pigs and Duroc X Tibetan pigs) are all black, and the genotypes of the external breeding pigs and the local breeding pigs are all heterozygotic AG, which shows that the black is dominant to the yellow of Duroc and the six-point white of pacha;
(2) the hair color of the filial generation of the local pig breed Tibetan pig X Taihu pig is black, and the genotypes of the filial generation are homozygous AA;
(3) the hybridization offspring of the local pig (Tibetan pig X Taihu pig) is taken as a female parent and is hybridized with the foreign pig Duroc and the Backxia pig which are taken as male parents, the hair color of the offspring is black, and the genotype is heterozygous AG;
(4) the new black male parent species S06 is currently undergoing fur color fixing breeding, the fur color is black when the new black male parent species S06 is hybridized with the Tibetan pig XTaihu sow, wherein the offspring genotypes of the individual with the genotype of AA and the Tibetan pig XTaihu sow are AA when the individual with the genotype of AA is hybridized, and the offspring genotypes of the individual with the genotype of AG and the Tibetan pig XTaihu sow when the individual with the genotype of AG is hybridized are AA and AG;
(5) the hair color of the offspring is black when the S06 individual with the genotype of AA is hybridized with the Duroc (Tibetan pig) sow in Taihu lake, the genotypes of AA and AG are respectively, the hair color of the offspring is obviously separated when the S06 individual with the genotype of AG is hybridized with the Duroc (Tibetan pig) sow in Taihu lake, and the genotypes of individuals with hair color separation are GG; the separation rule of the hair color of the filial generation of the S06 individual and the sow of the Baker Xiaxu (Tibetan pig X Taihu lake pig) species is the same as the separation rule of the hair color of the filial generation of the S06 individual and the sow of the Duroc (Tibetan pig X Taihu lake pig) species.
Therefore, for the locus 2, the gene segregation rules are met on all detected varieties and individual hair color segregation phenotypes, and the black homozygous genotype AA individual is selected to quickly fix the hair color of offspring in the processes of specialized strain breeding and new variety (matched line) cultivation, or one of the selected parents is a homozygous black pig individual to carry out hybridization to produce black offspring commercial pigs without hair color segregation.
(II) detection of MC1R Gene site 3(A/G)
Table 35 variety/strain site 3 coat color detection results
For position 3, not the C/T mutation but the A/G mutation in the sequence was actually detected. The site (A/G mutation) as a SNP site affecting the hair color of the offspring may be the result of preferential directional selection of the hair color of the offspring in the long-term generation breeding process of the population, and the phenomenon generally does not exist in the obtained sample individuals of the sequence mutation in the NCBI library. The Duroc pig and the Backxia pig as the external pig are AA genotype, the Taihu lake pig and the Tibetan pig as the local pig are GG genotype, and the new variety S06 as the black male parent is GG and GA genotype. The SNP mutation at position 3 has a causal relationship with hair color, wherein allele G determines black hair color and G is dominant to A.
TABLE 4 detection results of the hair color of the filial generation sites 3 of different varieties
The results of the observation of the hair color phenotype of the filial generations of different varieties and the detection of the locus 3 genotype show that:
(1) the offspring of the hybridization of the foreign pig and the local pig (Duroc X Taihu pigs, Duroc X Tibetan pigs) are all black, and the genotypes of the offspring are all heterozygotic GA;
(2) the hair color of the filial generation of the local pig breed Tibetan pig X Taihu pig is black, and the genotypes of the filial generation are homozygous GG;
(3) the hybridization progeny of the local pig (Tibetan pig X Taihu pig) is used as a female parent and is hybridized with the foreign pig Duroc and the Backxia pig which are used as male parents, the hair color of the progeny is black, and the genotype is heterozygotic GA;
(4) the hair color of the new black male parent variety S06 is black when the new black male parent variety is hybridized with the female pig of the Tibetan pig XTaihu lake pig variety, wherein the genotype of the offspring of the S06 individual with the genotype of GG when the individual with the genotype of GG is hybridized with the female pig of the Tibetan pig XTaihu lake pig variety is GG, and the genotype of the offspring of the individual with the genotype of GA when the individual with the genotype of GA is hybridized with the female pig of the Tibetan pig XTaihu lake pig variety is GG and GA;
(5) the hair color of the offspring is black when the S06 individual with the genotype of GG is hybridized with the Duroc (Tibetan pig) sow in Taihu lake, the genotypes of GG and GA are respectively, the hair color of the offspring is obviously separated when the S06 individual with the genotype of GA is hybridized with the Duroc (Tibetan pig) sow in Taihu lake, and the genotypes of individuals with hair color separation are AA; the separation rule of the hair color of the filial generation of the S06 individual and the sow of the Baker Xiaxu (Tibetan pig X Taihu lake pig) species is the same as the separation rule of the hair color of the filial generation of the S06 individual and the sow of the Duroc (Tibetan pig X Taihu lake pig) species.
Therefore, for the locus 3, the gene segregation rules are met on all detected varieties and individual hair color segregation phenotypes, and the black homozygous genotype AA individual is selected to quickly fix the hair color of offspring in the processes of specialized strain breeding and new variety (matched line) cultivation, or one of the selected parents is a homozygous black pig individual to carry out hybridization to produce black offspring commercial pigs without hair color segregation.
(III) detection of MC1R Gene site 4(C/T)
Table 55 variety/strain site 4 gross color detection results
For site 4, the Duroc and Backxia pigs, which are the exogenic pigs, were TT genotypes, the Taihu and Tibetan pigs, which are the endemic pig, were CC genotypes, and the new black male parent species, S06, were CC and CT genotypes. The SNP mutation at the position 4 has a causal relationship with the hair color of the pig, wherein allele C determines the black hair color, and C is dominant to T.
TABLE 6 detection results of hair color of the filial generation sites 4 of different varieties
The results of the observation of the hair color phenotype of the filial generations of different varieties and the detection of the locus 4 genotype show that:
(1) the offspring of the hybridization of the foreign pig and the local pig (Duroc X Taihu pig, Duroc X Tibetan) are all black, and the genotypes are all heterozygote CT;
(2) the hair color of the filial generation of the local pig breed Tibetan pig X Taihu pig is black, and the genotypes of the filial generation are homozygous CC;
(3) the hybridization progeny of the local pig (Tibetan pig X Taihu pig) is used as a female parent and is hybridized with the foreign pig Duroc and the Backxia pig which are used as male parents, the hair color of the progeny is black, and the genotype is heterozygous CT;
(4) the hair color of the new black male parent variety S06 is black when the new black male parent variety is hybridized with the female pig of the Tibetan pig XTaihu lake pig breed, wherein the genotype of the offspring of the S06 individual with the genotype of CC when the new black male parent variety is hybridized with the female pig of the Tibetan pig XTaihu lake pig breed is CC, and the genotype of the offspring of the individual with the genotype of CT when the individual with the genotype of CT is hybridized with the female pig of the Tibetan pig XTaihu lake pig breed is CC and CT;
(5) when an S06 individual with the genotype of CC is hybridized with a Duroc (Tibetan pig) sow in Taihu lake, the hair color of the offspring is black, the genotypes are CC and CT respectively, when an S06 individual with the genotype of CT is hybridized with a Duroc (Tibetan pig) sow in Taihu lake, the hair color of the offspring is obviously separated, and the genotypes of the individuals with hair color separation are TT;
(6) the separation rule of the hair color of the filial generation of the S06 individual and the sow of the Baker Xiaxu (Tibetan pig X Taihu lake pig) species is the same as the separation rule of the hair color of the filial generation of the S06 individual and the sow of the Duroc (Tibetan pig X Taihu lake pig) species.
Therefore, for the site 4, the gene segregation rules are met on all detected varieties and individual hair color segregation phenotypes, and the black homozygous genotype CC individual is selected to quickly fix the hair color of offspring in the processes of specialized strain breeding and new variety (matched line) cultivation, or one of the selected parents is a homozygous black pig individual to carry out hybridization to produce black offspring commercial pigs without hair color segregation.
In conclusion, in the processes of specialized strain breeding and new variety (matched line) cultivation, the selection of AA at the site 2, the selection of GG at the site 3 and the selection of CC genotype at the site 4 are favorable for the purpose of quickly fixing the hair color of the offspring; in the production process of the black commercial pig, the male parent and the female parent are black homozygous genotypes, so that the hair color of the offspring commercial pig is completely black, and hair color separation is avoided.
In addition to the foregoing, reference throughout this specification to "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment described generally throughout this application. The appearances of the same phrase in various places in the specification are not necessarily all referring to the same embodiment. Further, when a particular feature, structure, or characteristic is described in connection with any embodiment, it is submitted that it is within the scope of the invention to effect such feature, structure, or characteristic in connection with other embodiments.
Although the invention has been described herein with reference to a number of illustrative embodiments thereof, it should be understood that numerous other modifications and embodiments can be devised by those skilled in the art that will fall within the spirit and scope of the principles of this disclosure. More specifically, various variations and modifications are possible in the component parts and/or arrangements of the subject combination arrangement within the scope of the disclosure and claims of this specification. In addition to variations and modifications in the component parts and/or arrangements, other uses will also be apparent to those skilled in the art.
Claims (5)
1. A pig offspring hair color prediction method based on haplotype MC1R × 31 gene is characterized in that: the method is to detect at least one of 661bp locus, 721bp locus and 781bp locus of the haplotype MC1R x 31 gene of the male parent and/or female parent boar, wherein:
(1) when 661bp locus of haplotype MC1R x 31 is AA genotype, allele A determines that the progeny is hair black, and A is dominant to G;
(2) when 721bp locus of haplotype MC1R × 31 is GG genotype, allele G determines that the progeny is black, and G is dominant to A;
(3) when 781bp locus of haplotype MC1R × 31 is CC genotype, allele C determines that the progeny is black, and C is dominant to T;
when the paternal and/or maternal swine haplotype MC1R x 31 gene satisfies any one of the above (1) to (3), it is predicted that the progeny will have a full black hair color.
2. The method of claim 1, wherein the method of predicting the coat color of the offspring of swine based on haplotype MC1R x 31 comprises: the method adopts the Snapshot technology to detect the loci of the haplotype MC1R x 31 genes of the male parent and/or female parent boars.
3. The method for predicting the hair color of the offspring of pigs based on haplotype MC1R x 31 gene according to claim 1 or 2, wherein: the method is used for predicting the hair color of the offspring of the Duroc pigs, the Bake summer pigs, the Taihu pigs and the Tibetan pigs.
4. The method of claim 1, wherein the method of predicting the coat color of the offspring of swine based on haplotype MC1R x 31 comprises: in the detection of the paternal and/or maternal swine haplotype MC1R x 31 gene, the outside primer and the effective sequence at least comprise one of the following:
。
5. the method for predicting the hair color of swine offspring based on haplotype MC1R x 31 gene according to claim 1 or 4, wherein: in the detection of the paternal and/or maternal swine haplotype MC1R x 31 gene, the kit further comprises an inner primer, and the effective sequence of the inner primer at least comprises one of the following sequences:
。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110373349.XA CN112813177A (en) | 2019-11-04 | 2019-11-04 | Pig offspring hair color prediction method based on haplotype MC1R x 31 gene |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110373349.XA CN112813177A (en) | 2019-11-04 | 2019-11-04 | Pig offspring hair color prediction method based on haplotype MC1R x 31 gene |
| CN201911066191.0A CN110622920A (en) | 2019-11-04 | 2019-11-04 | Breeding method of pure black and hairy pig breeds |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911066191.0A Division CN110622920A (en) | 2019-11-04 | 2019-11-04 | Breeding method of pure black and hairy pig breeds |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112813177A true CN112813177A (en) | 2021-05-18 |
Family
ID=68978868
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911066191.0A Pending CN110622920A (en) | 2019-11-04 | 2019-11-04 | Breeding method of pure black and hairy pig breeds |
| CN202110373349.XA Pending CN112813177A (en) | 2019-11-04 | 2019-11-04 | Pig offspring hair color prediction method based on haplotype MC1R x 31 gene |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911066191.0A Pending CN110622920A (en) | 2019-11-04 | 2019-11-04 | Breeding method of pure black and hairy pig breeds |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN110622920A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116171936A (en) * | 2023-04-23 | 2023-05-30 | 成都铁骑力士饲料有限公司 | Cultivation method of novel Sichuan black pig strain |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112210608A (en) * | 2020-09-10 | 2021-01-12 | 四川农业大学 | Rapid and accurate fixing method for hair color character of new variety of bred black pigs and application |
| CN114698585A (en) * | 2020-11-16 | 2022-07-05 | 广东壹号地方猪研究院有限公司 | Method for breeding new variety of black pigs |
| TWI804902B (en) * | 2021-06-28 | 2023-06-11 | 國立臺灣大學 | Primer sets for grouping pigs from coat color and its methods and kits |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20160001888A (en) * | 2014-06-27 | 2016-01-07 | 대한민국(농촌진흥청장) | Novel SNP marker for discriminating level of meat quality and Black Coat Color of pig and use thereof |
| CN105648071A (en) * | 2016-02-26 | 2016-06-08 | 昆明学院 | SNP (single nucleotide polymorphism) marker and method for identifying MC1R (melanocortin receptor 1) genes of pig breeds and colors of pig breeds as well as application |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107586857B (en) * | 2017-10-26 | 2021-07-27 | 重庆市畜牧科学院 | Nucleic acid, kit and method for rapidly identifying red and black hair color genes of pigs |
| CN108419756A (en) * | 2018-06-20 | 2018-08-21 | 安徽浩翔农牧有限公司 | A kind of Ba Huai pig breeding methods |
| CN110273010B (en) * | 2019-07-03 | 2023-12-08 | 西南大学 | Identification and application method of MC1R gene haplotype |
-
2019
- 2019-11-04 CN CN201911066191.0A patent/CN110622920A/en active Pending
- 2019-11-04 CN CN202110373349.XA patent/CN112813177A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20160001888A (en) * | 2014-06-27 | 2016-01-07 | 대한민국(농촌진흥청장) | Novel SNP marker for discriminating level of meat quality and Black Coat Color of pig and use thereof |
| CN105648071A (en) * | 2016-02-26 | 2016-06-08 | 昆明学院 | SNP (single nucleotide polymorphism) marker and method for identifying MC1R (melanocortin receptor 1) genes of pig breeds and colors of pig breeds as well as application |
Non-Patent Citations (4)
| Title |
|---|
| C. LU等: "Haplotype diversity in MC1R locus between the Min and white-haired pig breeds", 《ACTA AGRICULTURAE SCANDINAVICA, SECTION A — ANIMAL SCIENCE》 * |
| DBSNP: "rs45434629、rs45434630、rs45435031", 《ENSEMBL》 * |
| PENGJU ZHAO等: "Evidence of evolutionary history and selective sweeps in the genome of Meishan pig reveals its genetic and phenotypic characterization", 《GIGASCIENCE》 * |
| 彭刚: "猪MC1R、ASIP、TYR、TYRP1和SLC45A2基因多态性及其与毛色相关性研究", 《中国优秀硕士学位论文全文数据库农业科技辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116171936A (en) * | 2023-04-23 | 2023-05-30 | 成都铁骑力士饲料有限公司 | Cultivation method of novel Sichuan black pig strain |
| CN116171936B (en) * | 2023-04-23 | 2023-07-04 | 成都铁骑力士饲料有限公司 | Cultivation method of novel Sichuan black pig strain |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110622920A (en) | 2019-12-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112813177A (en) | Pig offspring hair color prediction method based on haplotype MC1R x 31 gene | |
| CN108410994B (en) | SNP marker influencing Hu sheep lambing traits and application thereof | |
| CN108103208B (en) | SNP marker influencing Hu sheep lambing traits and application thereof | |
| CN107099607B (en) | Primer combination and kit for simultaneously detecting 93 cattle genetic defect genes and lethal haplotypes | |
| CN113502335B (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN109694916B (en) | Molecular marker related to sheep feed conversion rate and application thereof | |
| CN111910008A (en) | Molecular marker related to chicken growth and development and application thereof | |
| CN111926085B (en) | Molecular marker influencing chicken muscle brightness and application thereof | |
| CN111926086A (en) | Molecular marker influencing oblique growth of chicken body and application thereof | |
| CN116356037A (en) | Molecular marker related to chicken feed utilization rate and application thereof | |
| WO2022134553A1 (en) | Molecular marking method for detecting pass rate of hatching goose eggs | |
| CN107988385B (en) | Method for detecting marker of PLAG1 gene Indel of beef cattle and special kit thereof | |
| CN107475413B (en) | Method for screening crassostrea gigas parent shellfish with high content of unsaturated fatty acid C20:3 omega 6 | |
| CN112921101A (en) | Molecular marker related to sheep remaining feed intake and application thereof | |
| CN110079613B (en) | Molecular marker of heat stress tolerance of Holstein cattle and detection method | |
| CN114350818B (en) | Prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof | |
| CN115992251A (en) | Molecular marker related to Hu sheep growth traits and application thereof | |
| CN115044682A (en) | Molecular marker related to growth traits of Hu sheep, detection method and application thereof | |
| CN111849999B (en) | Rice GS3 mutant gene, molecular marker and application thereof | |
| CN109022594B (en) | Cattle AHSG gene SNP marker related to conversion efficiency of beef cattle feed | |
| CN113913530A (en) | Molecular marker related to sheep body height and application thereof | |
| CN116837112B (en) | SNP molecular marker related to yak growth traits and application thereof | |
| CN114182025B (en) | SNP molecular marker related to pig feed conversion rate and application thereof | |
| CN114369670B (en) | SNP molecular marker located in SREBF2 gene and related to muscovy duck sexual precocity trait and application | |
| CN118064604A (en) | Molecular identification primer group for chicken with heart-shaped edging feather phenotype and breeding method of chicken with heart-shaped edging feather phenotype |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210518 |