CN112553250B

CN112553250B - Method for preparing female sterile lepidopteran insects and nucleic acid construct thereof

Info

Publication number: CN112553250B
Application number: CN201910850906.5A
Authority: CN
Inventors: 黄勇平; 徐霞; 毕洪论; 李恺; 何琳; 许军; 王耀辉; 刘祖莲
Original assignee: Center for Excellence in Molecular Plant Sciences of CAS
Current assignee: Center for Excellence in Molecular Plant Sciences of CAS
Priority date: 2019-09-10
Filing date: 2019-09-10
Publication date: 2024-01-26
Anticipated expiration: 2039-09-10
Also published as: CN112553250A

Abstract

The invention discloses a method for preparing female sterile lepidopteran insects and a nucleic acid construct thereof. The method comprises the following steps: 1) Constructing an Osp gene knockout nucleic acid construct comprising, from the 5 'end to the 3' end, the following operably linked elements: a U6 promoter, a first Osp gene target and polyA; a U6 promoter, a second Osp gene target and polyA; 2) Co-transferring fresh lepidoptera insect eggs by the construct and PHA3PIG plasmid capable of expressing Piggybac transposase to obtain a generation G0, and selfing to obtain a generation G1; and 3) mating the G1 generation with a transgenic lepidopteran insect expressing the Cas9 protein to obtain a G2 generation. The invention successfully constructs female sterile lepidoptera insects on the premise of not influencing normal mating behavior by using the CRISPR/Cas9 technology based on piggyBac transposons, and has important value in the aspect of controlling the lepidoptera insects by the female sterile technology.

Description

Method for preparing female sterile lepidopteran insects and nucleic acid construct thereof

Technical Field

The invention belongs to the technical field of biology, and relates to a method for preparing female sterile lepidopteran insects and a nucleic acid construct thereof.

Background

Silkworm is a typical model economic insect, and is one of economic insects which take mulberry leaves as foodstuff and spin cocoons. The silkworm is used as a research object for the genetic control of insect pests, especially lepidoptera pests, which can have great influence on the aspect of genetic control of agriculture and forestry pests, and can be popularized and applied to other lepidoptera insects. The biological sterility control technology of pests at the present stage mostly uses radiation and tetracycline induction, and the two sterility technologies are time-consuming and labor-consuming and cannot have stable genetic effect strains. Therefore, it is urgent to study a stable genetic and next-generation female effectively sterile line.

Insect sterility technology has been the focus of research for pest control, with the first successful destruction of trypanosoma spiralis (Cochliomyia hominivorax) in the united states in human history using radiation sterility technology in early 50 s of the last century, and 2 months in 1975, japan has been overwhelmed by releasing radiation-treated sterile bactrocera cucurbitae (Bactrocera cucuribitae). Female specific lethality can be achieved by modulating the splicing factors of the female with tetracycline. Although both radiation and tetracycline induce sterile insects, both require extensive feeding to induce sterility and the resulting sterile individuals are less competitive than the wild type.

During mating reproduction of insects, genes associated with female ovum development are essential for female reproduction success. The ovum generation gene can influence the formation and development of ovum, and then influence the fertility, offspring survival rate and the like of female. It has been reported that the secretion of genes involved in female ovum genesis during reproductive mating is plastic, can evolve rapidly under natural selection, and is more complex than hitherto thought.

Disclosure of Invention

The invention aims at overcoming the defect of lack of female sterile lepidopteran insect strains in lepidopteran insect genetic sterile technology, and provides a method for preparing female sterile lepidopteran insects and a nucleic acid construct thereof.

To this end, the present invention provides a method of preparing female sterile lepidopteran insects comprising the steps of:

1) Constructing an Osp gene knockout nucleic acid construct comprising, from the 5 'end to the 3' end, the following operably linked elements: a first sgRNA expression element and a second sgRNA expression element; the first sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a first Osp gene target and polyA; the second sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a second Osp gene target and polyA;

2) Co-transferring fresh lepidoptera insect eggs with the Osp gene knockout nucleic acid construct and PHA3PIG plasmid capable of expressing Piggybac transposase in the step 1), incubating, and transforming moths to obtain a generation G0, and selfing the generation G0 to obtain a generation G1; and

3) Mating the G1 generation in the step 2) with a transgenic lepidopteran insect expressing Cas9 protein to obtain the G2 generation, and obtaining the lepidopteran insect with female high sterility.

Preferably, the nucleotide sequence of the first Osp gene target is shown as SEQ ID NO. 1, and the nucleotide sequence of the second Osp gene target is shown as SEQ ID NO. 2.

Preferably, the Osp gene knockout nucleic acid construct further comprises a first selectable marker gene expression cassette.

Preferably, the first selectable marker gene is a red fluorescent protein gene.

Preferably, the transgenic lepidopteran insect expressing Cas9 protein contains a Cas9 gene expression cassette, the Cas9 gene expression cassette comprising the following operably linked elements from 5 'end to 3' end: the Nos promoter, cas9 protein coding sequence and SV40 terminator.

Preferably, the transgenic lepidopteran insect expressing Cas9 protein further comprises a second selectable marker gene expression cassette. Preferably, the second selectable marker gene is a green fluorescent protein.

Preferably, the cotranslations are prepared by microinjection of fresh insect eggs into a mixed solution obtained by mixing the Osp gene knockout nucleic acid construct with PHA3PIG plasmid capable of expressing piggyBac transposase.

Preferably, the lepidopteran insect is a silkworm.

The present invention also provides an Osp gene knockout nucleic acid construct comprising the following operably linked elements from the 5 'end to the 3' end: a first sgRNA expression element and a second sgRNA expression element; the first sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a first Osp gene target and polyA; the second sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a second Osp gene target and polyA.

The invention also provides a method for controlling lepidopteran pests, comprising the steps of: female sterile lepidopteran insects prepared by the method are released in the wild, and offspring are reduced and population quantity is reduced by mating the female sterile lepidopteran insects with wild lepidopteran insects.

The invention uses the CRISPR/Cas9 technology based on piggyBac transposon to knock out silkworm Osp genes, provides a stable and effective female sterile genetic strain, and solves the problem that the traditional method for inducing sterile insects by radiation and tetracycline can not inherit offspring stably and effectively. The silkworm Osp gene is knocked out for the first time, so that the release of female mutants is successfully realized, and female mutants in offspring are sterile, thereby realizing the controllability of insects. The invention combines the silkworm embryo microinjection technology, fluorescence detection and molecular biological operation, and knocks out silkworm Osp genes to obtain a female sterile stable genetic strain. Can be popularized to biological control of pests and promote the development of environment-friendly control.

Drawings

FIG. 1 is a diagram showing the construction of silkworm Osp gene and the construction of plasmid. A: silkworm Osp gene structure and knockout target, red is PAM sequence. B: and (3) constructing a model diagram of the transgenic plasmids of the Osp genes.

FIG. 2 silkworm Osp gene knockout results in female sterility. A: eggs laid by wild type females and males mating (WT female) and wild type females mating (Δosp female) and mutant females mating (Δosp female) can develop, eggs laid by wild type males mating (WT female) and mutant females mating (WT female) do not develop, and eggs laid by mutant females and males mating (Δosp female) and mutant Δosp female do not develop. B: quantification of the number of offspring after mating of adults the number of offspring is very different between mutant females compared to wild type and mutant females.

Detailed Description

Through extensive research and repeated experiments, the invention combines the silkworm embryo microinjection technology, fluorescence detection and molecular biological operation through the selection of gene mutation sites and the construction of transgenic plasmids, constructs a BmOsp gene mutation silkworm strain, and after the Osp gene mutation is found, the normal mating behavior of male and female mutants is not affected, the hatching rate of silkworm eggs by taking male mutants as parents is normal, but the hatching rate of silkworm eggs by taking female mutants as parents is close to 0, so that the BmOsp gene mutant silkworm is female highly sterile, can be used for genetic control of lepidopteran insect and control lepidopteran pests, thereby completing the invention.

Lepidoptera of

Lepidoptera include both moth and butterfly insects. Belongs to the subclass pteridosis and the class of holomorphism. About 20 tens of thousands are known worldwide, and about 8000 or more are known in China. This order is the 2 nd most order of the class entomophagous, next to coleoptera. Including the family of the Faberidae; pinaceae, such as wheat moth, pink bollworm, potato tuber moth, sweet potato moth, etc.; the Phantom species, such as Phantom gossypii, phantom sojae atricolor, etc.; the borer moth family, such as shirttail, corn borer, etc.; ulnara, such as great bridgeworm, etc.; pinaceae, such as Pink cabbage, etc.; nocturnal moth families such as noctuid, cotton bollworm, etc.; podoptera, such as Plutella xylostella; pacific, such as Pteriidae, etc.; the family of naviridae, such as trichostrongylodes naviculatus, etc.; the family of the Phantom, such as Phantom chrysalis, phantom rubra, fall webworm, etc.; the family of the Araliaceae, such as grape Tianmoth, etc.; silkworm moth, such as silkworm; the family of the Fabricius, such as Ailanthus; pteridae, such as rice bracts, etc. Lepidopteran insects are extremely widely distributed, with tropical species being the most abundant. Most kinds of larvae are harmful to various cultivated plants, and the large-sized people often eat up leaves or drill branches. The smaller body shape is often harmful to the people from rolling up, attaching leaves, binding sheaths, spinning wires and netting or drilling into plant tissues for feeding. The imago takes nectar and the like as supplementary nutrition, or the degradation of the mouth organ does not eat any more, and the imago is generally not directly endangered.

As described above, most of lepidopteran insects are pests, and few are also economically valuable insects, such as silkworms. Therefore, research on large-scale female sterility technology of lepidopteran insects will produce great practical significance for pest control and economic value of transgenic products.

Thus, in a preferred embodiment, the lepidopteran insect of the invention is a silkworm.

The current lepidopteran insect transgenic technology is usually carried out in a transposon mode. The piggyBac transposon is a transposon derived from lepidoptera insects, is originally obtained by infecting a Trichoplusia ni (Trichoplusia ni) TN-368 cell line by a Baculovirus (Baculovirus), is first isolated from Galleria mellonella (GmMNPV) and Autographa californica (AcMNPV) nuclear polyhedrosis viruses, and is proved to be accurate in excision test of pink bollworm (Pectinophora gassypiella) embryo, silkworm (Bombyx mori) egg cell and the like. Experiments in yellow typhoid mosquitoes (Aedes aegypti), noctuid, silkworm egg cells and the like also show that piggyBac can smoothly swivel, and the frequency of excision and swivel is high. In silkworms, the study was started in 1997, and the transposable effect of piggyBac transposon on silkworms was found, and researchers subsequently studied silkworms using piggyBac transposon. Deep research on piggyBac transposons lays a theoretical foundation for genetic control of pests.

The principle of the currently commonly used genome editing technology is to induce non-homologous end joining (Nonhomologous end joining, NHEJ) and homologous recombination repair (Homologous recombination, HR) of DNA repair systems in cells by artificially generating DNA Double Strand Breaks (DSBs) at specific sites in the genome. Through the repair path, the generated DNA double bond rupture site is considered to realize gene mutation, specific mutation introduction and site-directed modification. Genome editing is divided into three categories, wherein the CRISPR/Cas9 technology cost is low, and the target point shearing efficiency is high.

Osp (also called Ovarian serine protease) is a serine protease, has extremely strong conservation, is ubiquitous in animals, and plays an important role in reproductive development. Osp belongs to serine gene family in gene family, and the gene of the family generally comprises various genes for reproductive development. The Osp gene of the invention is an Osp gene of lepidoptera insects, preferably silkworms. The BmOsp gene of silkworm is a proper material for researching reproduction of lepidopteran insects and preventing and controlling lepidopteran insects by a sterile technology.

The invention prefers the target sequence of the Osp gene, and the Osp gene is knocked out by taking the target sequence in the CRISPR/Cas9 technology, thereby obtaining the function of the female sterile mutant. According to the target site characteristics of the CRISPR/Cas9 system, the two preferable targets are respectively positioned at the tenth and eleventh exons of the silkworm Osp gene (GenBank: NM_ 001043703.1). More preferably, TS1 (GGTTCGTCCAATATGCTTACCGG) and TS2 (GGACAAGTGTAAGCATGAAGAGG), respectively.

Thus, the present invention includes nucleic acids having 50% or more (preferably 60% or more, 70% or more, 80% or more, more preferably 90% or more, more preferably 95% or more, most preferably 98% or more, such as 99%) homology with the preferred Osp gene target sequence 1 or 2 (SEQ ID NO:1 or 2) of the present invention, which also have the function of knocking out the Osp gene as a target sequence in CRISPR/Cas9 technology, thereby obtaining sterile mutants. "homology" refers to the level of similarity (i.e., sequence similarity or identity) between two or more nucleic acids in terms of percentage of positional identity.

In view of the teachings of the present invention and the prior art, it will be readily understood by those of ordinary skill in the art that, although a target sequence of an Osp gene derived from bombyx mori is provided in the examples of the present invention, an Osp gene target sequence derived from other insects of the order lepidoptera, such as spodoptera litura, plutella xylostella, having a certain homology (conservation) with the promoter of the present invention, may be conveniently isolated from other insects and its function verified by those skilled in the art after reading the present application in light of the information provided herein.

(1) BmOsp gene knockout vector:

the BmOsp knockout plasmid PXL-BacII-IE1-DsRed2-U6-BmOspsgRNA1-U6-BmOspsgRNA2 used in the present invention was modified based on the PiggyBac transposon (Piggybac transposon, see Fraser et al Insect Moecular Biology, 1996) widely used in insect transgenic research. The following are provided:

firstly, red fluorescent protein DsRed driven by an IE1 promoter (Kojima et al, virus research, 2008) is introduced into a PiggyBac transposon vector, and the red fluorescent protein DsRed is constructed into a PXL-BacII-IE1-DsRed2 transgenic vector. After successful transfer into the vector, transgenic positive individuals can express red fluorescence in a whole body from the late embryo stage, and the screening is convenient. Then two insertion U6 sequences-polyA sequences (U6 is a promoter sequence, polyA sequence is a polyadenylation sequence at the 3' -end of mRNA) are sequentially inserted into the PXL-BacII-IE1-DsRed2 plasmid, wherein the U6 sequence is shown as SEQ ID NO:3, and the polyA sequence is: "TTTTTT". To this end, the piggyBac transposon vector was transformed into the plasmid PXL-BacII-IE1-DsRed2-U6-U6.

Then, target fragments are obtained by PCR method by using target identification primers F1, R1, F2 and R2 from the whole genome template of silkworm. Sequencing and determining target sequences. The long primers sgRNA-F1, sgRNA-R1, sgRNA-F2, sgRNA-R2, sgRNA-KnpI-F, sgRNA-HindIII-R, sgRNA-overlay-F and sgRNA-overlay-R were synthesized. Wherein, two pairs of primers of the sgRNA-KnpI-F and the sgRNA-R1, the sgRNA-F1 and the sgRNA-Overlap-R respectively take PXL-BacII-IE1-DsRed2-U6-U6 plasmid as a template, a product is obtained by PCR, then the product takes the volume ratio of 2:1 as the template, and the sgRNA-KnpI-F and the sgRNA-Overlap-R as the primers, and the BmOspsgRNA-1 fragment with the restriction endonuclease KnpI homology arm is obtained by PCR. Similarly, the sgRNA-Overlap-F and the sgRNA-R2, the sgRNA-F2 and the sgRNA-HindIII-R are used as primers for the first round of PCR, after the products are obtained, the sgRNA-Overlap-F and the sgRNA-HindIII-R are used as primers for the second round, and the BmOspsgRNA-2 fragment with the homologous arm of the restriction endonuclease HindIII is obtained through PCR.

Finally, the PXL-BacII-IE1-DsRed2-U6-U6 plasmid was digested with restriction enzymes KnpI and HindIII. The enzyme digestion product is mixed with BmOspRNA-1 fragment with KnpI homology arm and BmOspRNA-2 fragment with HindIII homology arm, and then inserted into the downstream of U6 promoter respectively by homologous recombination method, and then sequenced, and after confirming that the insertion is correct, PXL-BacII-IE1-DsRed2-U6-BmOspsgRNA1-U6-BmOspsgRNA2 plasmid is obtained. After proper sequencing, the kit was used for purification using the Plasmid Midi kit from Qiagen. Thus, bmOsp knockout plasmid PXL-BacII-IE1-DsRed2-U6-BmOspsgRNA1-U6-BmOspsgRNA2 was obtained (plasmid pattern view see FIG. 1).

(2) Transgenic silkworm Osp knockout strain

PHA3PIG plasmid capable of expressing Piggybac transposase is used in the invention (see Tamura et al, nature Biotechnology, 2000) to assist in generating Piggybac transposon, and an Osp knockout plasmid PXL-BacII-IE1-DsRed2-U6-BmOspsgRNA1-U6-BmOspsgRNA2 and PHA3PIG plasmid are mixed and injected into fresh silkworm eggs by a microinjection method, and the specific method is referred to Kanda ﹠ Tamura (1991). Sealing with nontoxic glue after injection to prevent pollution, incubating in aseptic environment at 25deg.C, raising silkworm, selfing current generation (G0 generation) silkworm moth, and screening out red fluorescent individuals under fluorescent microscope.

Silkworm Nos-Cas9 is a silkworm transgenic activation line. The transgenic silkworms of the strain express EGFG green fluorescence in the whole body, and express Cas9 protein in gonads, so that the strain is a parent silkworms for obtaining double-fluorescence silkworms in the future. Constructed according to literature (Xu, j., chen, s, zeng, b., james, a.a., tan, a.and Huang, y. (2017) building mori P-element Somatic Inhibitor (BmPSI) Is a Key Auxiliary Factor for Silkworm Male Sex determination, plos Genet,13, e 1006576). Firstly, a green fluorescent protein EGFP driven by an IE1 promoter (Kojima et al, virus research, 2008) is introduced into a PiggyBac transposon vector to construct a PXL-BacII-IE1-EGFP transgenic vector. Then cloning the promoter of the silkworm Nos gene, the Cas9 gene and the SV40 terminator sequence, respectively. The PXL-BacII-IE1-EGFP transgenic vector is inserted once through a homologous recombination method, so that the PXL-BacII-IE1-EGFP-Nos-Cas9-SV40 transgenic plasmid is obtained. Finally, the wild silkworm is microinjected to obtain a transgenic silkworm strain Nos-Cas9. The sequence of the Nos promoter is described in the patent "promoter for the specific expression of the gonad of silkworm" and its capturing method "(patent application No. 201610360601.2, chen Rongmei, etc., 2016). The sequence of the Cas9 gene is shown as SEQ ID NO. 4. The SV40 terminator sequence is shown in SEQ ID NO. 5. Sealing with nontoxic glue after injection to prevent pollution, incubating in aseptic environment at 25deg.C, raising silkworm, selfing the current generation (G0 generation), and screening out green fluorescent individuals under fluorescent microscope.

And then feeding and mating the screened G1 generation red fluorescent individuals and the Nos-Cas 9G 1 generation green fluorescent individuals, screening the obtained G2 generation newly-hatched silkworms under a fluorescence microscope to obtain double-fluorescence (namely red-light-emitting and green-light-emitting) newly-hatched silkworms, extracting genome of the obtained double-fluorescence silkworms to identify target mutation conditions, observing mating reproduction phenomena after the obtained double-fluorescence silkworms grow to adults, and counting spawning conditions.

(3) Detection of BmOsp mutant silkworms

The invention discovers that BmOsp gene mutation has substantial influence on female silkworm hatchability by verifying BmOsp gene mutation of double-fluorescence silkworm and counting spawning conditions of the BmOsp gene mutation. Identification of the Gene mutation situation: and (3) picking a plurality of double-fluorescence silkworms to extract genome in the period of the newly hatched silkworms, cloning target fragments by a PCR method and sequencing. The obtained transgenic individual can be selected by observing red and green fluorescence and silkworm eggs with red and green fluorescent protein expression. The different sexes are distinguished by pupal stage, and whether female sterility is determined at the time of adult. The spawning condition of the double-fluorescence silkworms can be counted by mating a large number of single-sex double-fluorescence silkworms with wild silkworms at an ambient temperature of 25 ℃ for 5 hours and then disassembling the pairs, and then spawning for 36 hours in the same environment.

The invention has the advantages that: the female silkworm strain with high sterility is successfully constructed on the premise of not influencing normal mating behavior by using the CRISPR/Cas9 technology based on piggyBac transposon for the first time. The obtained transgenic BmOsp mutant silkworm strain has no obstacle no matter whether the male and female mutants mate with the wild type in the same environment, the silkworm egg hatching rate of the male mutant as a parent is normal, and the silkworm egg hatching rate of the female mutant as a parent is close to 0. In addition, the invention makes the acquisition of mutants very easy. The invention has important value in the aspect of preventing and controlling lepidoptera pests through female sterility technology.

EXAMPLE 1 construction of vectors

1. The BmOsp knockout plasmid PXL-BacII-IE1-DsRed2-U6-BmOspsgRNA1-U6-BmOspsgRNA2 is obtained by cloning through a PCR method. The method comprises the following specific steps:

the BmOspsgRNA-1 fragment with the restriction endonuclease KnpI homology arm is obtained by PCR by taking the two pairs of primers of the sgRNA-KnpI-F and the sgRNA-R1, the sgRNA-F1 and the sgRNA-Overlap-R as templates and the PXL-BacII-IE1-DsRed2-U6-U6 plasmid as templates, respectively, and then taking the volume ratio of 2:1 as templates. Similarly, the sgRNA-Overlap-F and the sgRNA-R2, the sgRNA-F2 and the sgRNA-HindIII-R are used as primers for the first round of PCR, after the products are obtained, the sgRNA-Overlap-F and the sgRNA-HindIII-R are used as primers for the second round, and the BmOspsgRNA-2 fragment with the homologous arm of the restriction endonuclease HindIII is obtained through PCR.

Finally, the PXL-BacII-IE1-DsRed2-U6-U6 plasmid was digested with restriction enzymes KnpI and HindIII. The enzyme digestion product is mixed with BmOspRNA-1 fragment with KnpI homology arm and BmOspRNA-2 fragment with HindIII homology arm, and then inserted into the downstream of U6 promoter respectively by homologous recombination method, and then sequenced, and after confirming that the insertion is correct, PXL-BacII-IE1-DsRed2-U6-BmOspsgRNA1-U6-BmOspsgRNA2 plasmid is obtained. After proper sequencing, the kit was used for purification using the Plasmid Midi kit from Qiagen. Thus, bmOsp knockout plasmid PXL-BacII-IE1-DsRed2-U6-BmOspsgRNA1-U6-BmOspsgRNA2 was obtained. Wherein the PCP was prepared using KOD PLUS Taq enzyme (Takara Bio-engineering Co.) as follows.

Name of the name	Dosage (μl)
		10×Buffer	5
2mM dNTPs	5
		25mM MgSO ₄	2
KOD-Plus	0.5
		Primer-F	1(10mM)
Primer-R	1(10mM)
		Template	2
Adding double distilled water to	50

The PCR procedure was set as follows:

the PCR product was purified using the Gel Extraction Kit D2500 kit for use.

II, enzyme cutting PXL-BacII-IE1-DsRed2-Real-U6-U6 plasmid. The enzyme digestion system is as follows:

name of the name	Dosage of
		KnpI endonuclease (NEB Co.)	3μl
HindIII endonuclease (NEB Co.)	3μl
		PXL-BacII-IE1-DsRed2-U6-U6 plasmid	3μg
Deionized water	～50μl

And (3) enzyme cutting: 37 ℃, overnight (> 8 h).

The cleavage products were purified using the Plasmid Midi kit from Qiagen.

The BmOspsgRNA-1 and BmOspsgRNA-2 fragments were inserted downstream of the U6 promoter of PXL-BacII-IE1-DsRed2-U6-U6, respectively, using One Step Cloning Kit. The reaction system is as follows:

the reaction procedure: 37 ℃ for 30min; ice bath for 5min.

And IV, transforming the recombinant plasmid obtained in the step III, plating, and performing colony PCR on every other day. The reaction system is the same as the step I. Positive monoclonal sequencing. The primers used were: sgRNA-F3421 and sgRNA-R3667.

Sequencing results confirm that BmOspsgRNA-1 and BmOspsgRNA-2 fragments are properly inserted. The Plasmid was purified using the Plasmid Midi kit from Qiagen. Thus, an Osp knockout plasmid PXL-BacII-IE1-DsRed2-U6-BmOspsgRNA1-U6-BmOspsgRNA2 was obtained for subsequent injection.

EXAMPLE 2 obtaining of transgenic silkworms

The Osp knockout plasmid PXL-BacII-IE1-DsRed2-U6-BmOspsgRNA1-U6-BmOspsgRNA2 prepared in example 1 and the plasmid PHA3PIG capable of expressing the Piggybac transposase were mixed in equal amounts and injected into the initial spawning of silkworms. The injection method was microinjection according to the method described by Kanda ﹠ Tamura (1991). Sealing with nontoxic glue after injection to prevent pollution, incubating in aseptic environment at 25deg.C, breeding silkworm, selfing current generation (G0 generation) silkworm moth, and screening transgenic silkworm individual with red fluorescence (BmOsp mutant intermediate strain) under fluorescence microscope.

Subsequently, the red fluorescence transgenic silkworms and the green fluorescence transgenic silkworms which are obtained by screening are bred and mated with each other, the obtained G2-generation newly-hatched silkworms are screened for double fluorescence (namely red light emitting and green light emitting) newly-hatched silkworms (namely BmOsp mutant strain) under a fluorescence microscope, the genome of the obtained double fluorescence silkworms is extracted to identify target mutation conditions, and statistical spawning and hatching rate conditions are observed (see figure 2).

EXAMPLE 3 detection of transgenic silkworms

Identification of the Gene mutation situation: the genome of 10 double-fluorescence silkworms is extracted in the period of the newly hatched silkworms, and target fragments are cloned and sequenced by a PCR method by using primers F1 and R1, F2 and R2. Sequencing results show that the sequences of the target 1 and the target 2 in BmOsp genes in the double-fluorescence silkworm body are mutated.

Conditions of spawning by double fluorescent silkworms: 30 single sex double fluorescent silkworms are mated with wild silkworms at the temperature of 25 ℃ for 5 hours, then the mating is carried out, the silkworms are laid in the same environment for 36 hours, and the spawning amount and the hatching rate are counted, see figure 2. It can be seen that the egg hatchability of male silkworms and normal female silkworms, in which BmOsp is mutated (i.e., bifluorescent), is normal; the egg hatching rate of female silkworms with BmOsp mutation (namely double fluorescence) and normal male silkworms is close to 0, and the egg hatching rate of the mating of the mutant female silkworms and the mutant male silkworms is close to 0. In summary, bmOsp produces mutant (i.e., bifluorescent) female silkworm sterility (FIG. 2).

In adults, eggs laid by wild females and males mating (WT × WT) can develop; eggs laid by mating wild females with mutant males (Δosp × WT) can develop; eggs laid by mating wild male worms with mutant female worms (WT ×. DELTA. Osp }) do not develop; eggs laid by mating (delta Osp female ×delta Osp female) of the mutant females and males do not develop. The result shows that the female mutant is sterile, and the system is stably inherited to the offspring through male mutant fertility, and the female mutant in the offspring can be sterile, so that the quantity controllability is achieved.

All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.

/>

Sequence listing

<110> Shanghai life science institute of China academy of sciences

<120> a method for preparing female sterile lepidopteran insect and nucleic acid construct thereof

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

ggttcgtcca atatgcttac cgg 23

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

ggacaagtgt aagcatgaag agg 23

<210> 3

<211> 467

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

aggttatgta gtacacattg ttgtaaatca ctgaattgtt ttagatgatt ttaacaatta 60

gtacttatta atattaaata agtacatacc ttgagaattt aaaaatcgtc aactataagc 120

catacgaatt taagcttggt acttggctta tagataagga cagaataaga attgttaacg 180

tgtaagacaa ggtcagatag tcatagtgat tttgtcaaag taataacaga tggcgctgta 240

caaaccataa ctgttttcat ttgtttttat ggattttatt acaaattcta aaggttttat 300

tgttattatt taatttcgtt ttaattatat tatatatctt taatagaata tgttaagagt 360

ttttgctctt tttgaataat ctttgtaaag tcgagtgttg ttgtaaatca cgctttcaat 420

agtttagttt ttttaggtat atatacaaaa tatcgtgctc tacaagt 467

<210> 4

<211> 4140

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

atggacaaga agtactccat tgggctcgat atcggcacaa acagcgtcgg ctgggccgtc 60

attacggacg agtacaaggt gccgagcaaa aaattcaaag ttctgggcaa taccgatcgc 120

cacagcataa agaagaacct cattggcgcc ctcctgttcg actccgggga gacggccgaa 180

gccacgcggc tcaaaagaac agcacggcgc agatataccc gcagaaagaa tcggatctgc 240

tacctgcagg agatctttag taatgagatg gctaaggtgg atgactcttt cttccatagg 300

ctggaggagt cctttttggt ggaggaggat aaaaagcacg agcgccaccc aatctttggc 360

aatatcgtgg acgaggtggc gtaccatgaa aagtacccaa ccatatatca tctgaggaag 420

aagcttgtag acagtactga taaggctgac ttgcggttga tctatctcgc gctggcgcat 480

atgatcaaat ttcggggaca cttcctcatc gagggggacc tgaacccaga caacagcgat 540

gtcgacaaac tctttatcca actggttcag acttacaatc agcttttcga agagaacccg 600

atcaacgcat ccggagttga cgccaaagca atcctgagcg ctaggctgtc caaatcccgg 660

cggctcgaaa acctcatcgc acagctccct ggggagaaga agaacggcct gtttggtaat 720

cttatcgccc tgtcactcgg gctgaccccc aactttaaat ctaacttcga cctggccgaa 780

gatgccaagc ttcaactgag caaagacacc tacgatgatg atctcgacaa tctgctggcc 840

cagatcggcg accagtacgc agaccttttt ttggcggcaa agaacctgtc agacgccatt 900

ctgctgagtg atattctgcg agtgaacacg gagatcacca aagctccgct gagcgctagt 960

atgatcaagc gctatgatga gcaccaccaa gacttgactt tgctgaaggc ccttgtcaga 1020

cagcaactgc ctgagaagta caaggaaatt ttcttcgatc agtctaaaaa tggctacgcc 1080

ggatacattg acggcggagc aagccaggag gaattttaca aatttattaa gcccatcttg 1140

gaaaaaatgg acggcaccga ggagctgctg gtaaagctta acagagaaga tctgttgcgc 1200

aaacagcgca ctttcgacaa tggaagcatc ccccaccaga ttcacctggg cgaactgcac 1260

gctatcctca ggcggcaaga ggatttctac ccctttttga aagataacag ggaaaagatt 1320

gagaaaatcc tcacatttcg gataccctac tatgtaggcc ccctcgcccg gggaaattcc 1380

agattcgcgt ggatgactcg caaatcagaa gagaccatca ctccctggaa cttcgaggaa 1440

gtcgtggata agggggcctc tgcccagtcc ttcatcgaaa ggatgactaa ctttgataaa 1500

aatctgccta acgaaaaggt gcttcctaaa cactctctgc tgtacgagta cttcacagtt 1560

tataacgagc tcaccaaggt caaatacgtc acagaaggga tgagaaagcc agcattcctg 1620

tctggagagc agaagaaagc tatcgtggac ctcctcttca agacgaaccg gaaagttacc 1680

gtgaaacagc tcaaagaaga ctatttcaaa aagattgaat gtttcgactc tgttgaaatc 1740

agcggagtgg aggatcgctt caacgcatcc ctgggaacgt atcacgatct cctgaaaatc 1800

attaaagaca aggacttcct ggacaatgag gagaacgagg acattcttga ggacattgtc 1860

ctcaccctta cgttgtttga agatagggag atgattgaag aacgcttgaa aacttacgct 1920

catctcttcg acgacaaagt catgaaacag ctcaagaggc gccgatatac aggatggggg 1980

cggctgtcaa gaaaactgat caatgggatc cgagacaagc agagtggaaa gacaatcctg 2040

gattttctta agtccgatgg atttgccaac cggaacttca tgcagttgat ccatgatgac 2100

tctctcacct ttaaggagga catccagaaa gcacaagttt ctggccaggg ggacagtctt 2160

cacgagcaca tcgctaatct tgcaggtagc ccagctatca aaaagggaat actgcagacc 2220

gttaaggtcg tggatgaact cgtcaaagta atgggaaggc ataagcccga gaatatcgtt 2280

atcgagatgg cccgagagaa ccaaactacc cagaagggac agaagaacag tagggaaagg 2340

atgaagagga ttgaagaggg tataaaagaa ctggggtccc aaatccttaa ggaacaccca 2400

gttgaaaaca cccagcttca gaatgagaag ctctacctgt actacctgca gaacggcagg 2460

gacatgtacg tggatcagga actggacatc aatcggctct ccgactacga cgtggatcat 2520

atcgtgcccc agtcttttct caaagatgat tctattgata ataaagtgtt gacaagatcc 2580

gataaaaata gagggaagag tgataacgtc ccctcagaag aagttgtcaa gaaaatgaaa 2640

aattattggc ggcagctgct gaacgccaaa ctgatcacac aacggaagtt cgataatctg 2700

actaaggctg aacgaggtgg cctgtctgag ttggataaag ccggcttcat caaaaggcag 2760

cttgttgaga cacgccagat caccaagcac gtggcccaaa ttctcgattc acgcatgaac 2820

accaagtacg atgaaaatga caaactgatt cgagaggtga aagttattac tctgaagtct 2880

aagctggtct cagatttcag aaaggacttt cagttttata aggtgagaga gatcaacaat 2940

taccaccatg cgcatgatgc ctacctgaat gcagtggtag gcactgcact tatcaaaaaa 3000

tatcccaagc ttgaatctga atttgtttac ggagactata aagtgtacga tgttaggaaa 3060

atgatcgcaa agtctgagca ggaaataggc aaggccaccg ctaagtactt cttttacagc 3120

aatattatga attttttcaa gaccgagatt acactggcca atggagagat tcggaagcga 3180

ccacttatcg aaacaaacgg agaaacagga gaaatcgtgt gggacaaggg tagggatttc 3240

gcgacagtcc ggaaggtcct gtccatgccg caggtgaaca tcgttaaaaa gaccgaagta 3300

cagaccggag gcttctccaa ggaaagtatc ctcccgaaaa ggaacagcga caagctgatc 3360

gcacgcaaaa aagattggga ccccaagaaa tacggcggat tcgattctcc tacagtcgct 3420

tacagtgtac tggttgtggc caaagtggag aaagggaagt ctaaaaaact caaaagcgtc 3480

aaggaactgc tgggcatcac aatcatggag cgatcaagct tcgaaaaaaa ccccatcgac 3540

tttctcgagg cgaaaggata taaagaggtc aaaaaagacc tcatcattaa gcttcccaag 3600

tactctctct ttgagcttga aaacggccgg aaacgaatgc tcgctagtgc gggcgagctg 3660

cagaaaggta acgagctggc actgccctct aaatacgtta atttcttgta tctggccagc 3720

cactatgaaa agctcaaagg gtctcccgaa gataatgagc agaagcagct gttcgtggaa 3780

caacacaaac actaccttga tgagatcatc gagcaaataa gcgaattctc caaaagagtg 3840

atcctcgccg acgctaacct cgataaggtg ctttctgctt acaataagca cagggataag 3900

cccatcaggg agcaggcaga aaacattatc cacttgttta ctctgaccaa cttgggcgcg 3960

cctgcagcct tcaagtactt cgacaccacc atagacagaa agcggtacac ctctacaaag 4020

gaggtcctgg acgccacact gattcatcag tcaattacgg ggctctatga aacaagaatc 4080

gacctctctc agctcggtgg agacagcagg gctgacccca agaagaagag gaaggtgtga 4140

<210> 5

<211> 231

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

gactctagat cataatcagc cataccacat ttgtagaggt tttacttgct ttaaaaaacc 60

tcccacacct ccccctgaac ctgaaacata aaatgaatgc aattgttgtt gttaacttgt 120

ttattgcagc ttataatggt tacaaataaa gcaatagcat cacaaatttc acaaataaag 180

catttttttc actgcattct agttgtggtt tgtccaaact catcaatgta t 231

Claims

1. A method of producing a female sterile lepidopteran insect comprising the steps of:

3) Mating the G1 generation in the step 2) with a transgenic lepidopteran insect expressing Cas9 protein to obtain a G2 generation, namely female sterile lepidopteran insect;

the lepidoptera insect is a silkworm;

the nucleotide sequence of the first Osp gene target is shown as SEQ ID NO. 1, and the nucleotide sequence of the second Osp gene target is shown as SEQ ID NO. 2.

2. The method of claim 1, wherein said Osp gene knockout nucleic acid construct further comprises a first selectable marker gene expression cassette.

3. The method of claim 2, wherein the first selectable marker gene is a red fluorescent protein gene.

4. The method of claim 1, wherein the transgenic lepidopteran insect expressing Cas9 protein comprises a Cas9 gene expression cassette comprising, from 5 'to 3' end, operably linked elements of: the Nos promoter, cas9 protein coding sequence and SV40 terminator.

5. The method of claim 4, wherein the transgenic lepidopteran insect expressing Cas9 protein further comprises a second selectable marker gene expression cassette.

6. The method of claim 1, wherein said cotransformation is microinjection of fresh insect eggs into a mixture of said Osp knockdown nucleic acid construct and a PHA3PIG plasmid expressing a Piggybac transposase.

7. A method for controlling lepidopteran pests, comprising the steps of: female sterile lepidopteran insects produced by the method of claim 1 are released in the wild, and offspring are reduced and population numbers are reduced by mating with wild lepidopteran insects.