CN110184296B - Method for preparing lepidopteran insects with male-female high sterility and nucleic acid construct thereof - Google Patents

Abstract

The invention discloses a method for preparing lepidoptera insects with male and female high sterility and a nucleic acid construct thereof. The method comprises the following steps: 1) Constructing a Vasa gene knockout nucleic acid construct comprising the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a first Vasa gene target and polyA; a U6 promoter, a second Vasa gene target and polyA; 2) Co-transferring fresh lepidoptera insect eggs by the construct and PHA3PIG plasmid capable of expressing Piggybac transposase to obtain a generation G0, and selfing to obtain a generation G1; and 3) mating the G1 generation with a transgenic lepidopteran insect expressing the Cas9 protein to obtain a G2 generation. The invention successfully constructs the lepidoptera insects with high sterility on the premise of not influencing normal mating behavior by using the CRISPR/Cas9 technology based on the PiggyBac transposon, and has important value in the aspect of preventing and controlling the lepidoptera insects by using the sterility technology.

Description

Method for preparing lepidopteran insects with male-female high sterility and nucleic acid construct thereof

The present application claims priority from chinese patent application CN201810123478.1, having application date 2018, 02, and 07. The present application refers to the entirety of the above-mentioned chinese patent application.

Technical Field

The invention belongs to the technical field of biology, and relates to a method for preparing lepidoptera insects with both male and female high sterility and a nucleic acid construct thereof.

Background

Silkworm is used as a long-history economic insect, and has a cultivation history of over 5000 years in China, so that the economic value of the silkworm still has a higher proportion in the foreign trade in China until the present day. Today, with the rapid development of modern biotechnology, silkworms as representatives of Lepidoptera (Lepidoptera) insects are becoming an important biological model organism not only due to their economic value, but also due to their mature feeding method, short life cycle and obvious biological characteristics of metamorphosis development. With the initial drawing of the genome framework diagram of the silkworms in the world at the beginning of the 21 st century in China, the study on the silkworms gradually enters the post-genomics era, and in recent years, the silkworms as lepidoptera insect model organisms play an important role in the study of the fields of a silkworm bioreactor and lepidoptera pest control. At present, lepidoptera is the most important insect for agriculture and forestry, including corn borer (Ostrinia nubilalis), cutworm (Agrotis ypsilon), cotton bollworm (Heliothis armigera) and other insects seriously harming agriculture and forestry, and brings about huge economic loss every year. In order to reduce economic losses caused by pests, biological control of pests is also becoming increasingly important with the continued development of biotechnology. Biological control has the characteristics of safety of people and livestock, no pollution and no formation of resistance, and compared with chemical control, the biological control has great advantages in terms of environmental damage. Currently, the most widely used in biological control is the insect sterility technology (SIT), i.e., sterile pests are produced in the field after being obtained by radiation or hybridization methods, and the number of pest populations is reduced by reducing the pest offspring through mating with wild insect pests. In the sterile control of lepidopteran pests, many even irradiation doses (generally 300-500 Gy) are needed to obtain complete sterility, and the mating competitiveness of the lepidopteran pests is reduced by higher irradiation doses, so that the control effect is affected, and therefore, in the biological control of lepidopteran pests, genetic sterility methods are increasingly valued. Therefore, the silkworm is used as a model organism of lepidopteran insects, and a large number of sterile individuals are obtained through genetic operation, so that the silkworm has great significance for preventing and controlling lepidopteran pests in the future.

At present, the silkworm sterile technology in China is mainly a silkworm male sterile line developed by silkworm industry research of China agricultural sciences, namely Zhenjiang wild abortion. The male sterile line of the silkworm is a sterile line separated from offspring in the distant hybridization breeding process of wild silkworms and silkworms, and the offspring of the line often have sterile symptoms. And continuously carrying out passage screening to finally obtain the temperature sensitive sterile line No1 and the constitutive sterile line No2. The sterility of the temperature sensitive sterile line No. 1 in spring is 10% -90%, a small number of the sterile offspring show 100% sterility in the following summer, 99% sterility in autumn, and the No. 1 sterility is greatly influenced by the environmental temperature. The sterility of the constitutive sterile line No2 is 95-100% in spring, few fertile offspring of the constitutive sterile line are 100% high sterile in summer and autumn, and the No2 is not greatly influenced by the environmental temperature. The Zhenjiang wild abortion is used as a male sterile line of the silkworm, and compared with 3 types (1) male moth penile myodegeneration slp (2) sperm lack slo (3) abnormal sperm pod sls reported abroad, the Zhenjiang wild abortion has the characteristics of high sterility and dysplasia polytype of reproductive system, and is an ideal sterile line of the silkworm at present. However, the Zhenjiang field abortion has the following problems:

1) The Zhenjiang wild male sterile strain is obtained by distant hybridization breeding of wild silkworms and silkworms, which is difficult to operate in other lepidoptera pests, and taking plutella xylostella and cutworm as examples, the large difference between species of the pests like the wild silkworms and the wild silkworms is not found at present.

2) The Zhenjiang wild abortive male sterile line needs to be continuously passaged, the breeding work is huge, if the generation is interrupted, the same male sterile line is difficult to recover, and the repeatability is poor.

3) The sterility mechanism of Zhenjiang wild abortive male sterile lines is complex, shows various unused mutant phenotypes, and cannot correspond to genes genetically, so that it is very difficult to hope to obtain similar sterile lines in other lepidoptera pests through genetic means.

4) The Zhenjiang wild abortive male sterile line is a temperature sensitive sterile line No1 or a constitutive sterile line No2, and has a certain number of fertile offspring, and the sterility is not thorough.

5) The Zhenjiang wild abortive male sterile line only has male sterility, and compared with male and female sterility, the Zhenjiang wild abortive male sterile line has half the effect of preventing and controlling lepidoptera pests.

Therefore, the field is urgently required to obtain the silkworm strain which is highly sterile for male and female silkworms, has high operation repeatability, has a complete sterility theory mechanism and is easy to popularize in lepidoptera pests in the future.

Disclosure of Invention

The invention aims at overcoming the defect of a lepidopteran insect strain lacking male-female high sterility in a lepidopteran insect genetic sterility technology, and provides a method for preparing a lepidopteran insect with male-female high sterility and a nucleic acid construct thereof.

To this end, the present invention provides a method for preparing lepidopteran insects which are highly sterile to male and female, comprising the steps of:

1) Constructing a Vasa gene knockout nucleic acid construct comprising the following operably linked elements from the 5 'end to the 3' end: a first sgRNA expression element and a second sgRNA expression element; the first sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a first Vasa gene target and polyA; the second sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a second Vasa gene target and polyA;

2) Co-transferring fresh lepidoptera insect eggs with the Vasa gene knockout nucleic acid construct and PHA3PIG plasmid capable of expressing Piggybac transposase in the step 1), incubating, and transforming moths to obtain a generation G0, and selfing the generation G0 to obtain a generation G1; and

3) Mating the G1 generation in the step 2) with a transgenic lepidopteran insect expressing Cas9 protein to obtain the G2 generation, and obtaining the lepidopteran insect with male and female high sterility.

Preferably, the nucleotide sequence of the first Vasa gene target is shown as SEQ ID NO. 1, and the nucleotide sequence of the second Vasa gene target is shown as SEQ ID NO. 2.

Preferably, the Vasa gene knockout nucleic acid construct further comprises a first selectable marker gene expression cassette.

Preferably, the first selectable marker gene is a red fluorescent protein gene.

Preferably, the transgenic lepidopteran insect expressing Cas9 protein contains a Cas9 gene expression cassette, the Cas9 gene expression cassette comprising the following operably linked elements from 5 'end to 3' end: the Nos promoter, cas9 protein coding sequence and SV40 terminator.

Preferably, the transgenic lepidopteran insect expressing Cas9 protein further comprises a second selectable marker gene expression cassette.

Preferably, the cotransformation is a microinjection of fresh insect eggs from a mixture of the Vasa knockdown nucleic acid construct and PHA3PIG plasmid capable of expressing Piggybac transposase.

Preferably, the lepidopteran insect is a silkworm.

The invention also provides a Vasa gene knockout nucleic acid construct comprising the following operably linked elements from the 5 'end to the 3' end: a first sgRNA expression element and a second sgRNA expression element; the first sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a first Vasa gene target and polyA; the second sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: u6 promoter, second Vasa gene target and polyA.

The invention also provides a method for controlling lepidopteran pests, comprising the following steps: the lepidoptera insects with male and female high sterility prepared by the method are released in the wild, and offspring are reduced and population quantity is reduced by mating the lepidoptera insects with wild lepidoptera insects.

The invention relates to a gene BmVasa capable of regulating and controlling the spawning size and the hatching rate of silkworms. BmVasa gene mutation silkworm strain is constructed by a CRISPR/Cas9 genome editing technology which is constructed by depending on piggyBac transposons, and the spawning size and the hatching rate of the silkworm are regulated by a genetic control technology. The invention also provides a method for selecting the mutation sites of the genes and constructing transgenic plasmids. Experiments prove that the mutation of BmVasa can regulate the size of silkworm eggs and the spawning hatching rate of the silkworm eggs, and provides a target gene for controlling pests through a genetic method in the future. The invention obtains the silkworm strain which is highly sterile to both male and female silkworms, has high operation repeatability, has complete sterility theory mechanism and is easy to popularize in lepidoptera pests in future through genetic technology.

Drawings

FIG. 1 is a plasmid map of PXL-BacII-IE1-DsRed2-Real-U6-BmVasasgRNA1-U6-BmVasasg RNA.

FIG. 2 shows the expression of EGFP and DsRed of transgenic silkworm chrysalis under white light, green fluorescence and red fluorescence, respectively. A is PXL-BacII-IE1-DsRed2-Real-U6-BmVasasgRNA1-U6-BmVasasg RNA2 transgenic silkworm strain; b is a transgenic silkworm strain Nos-Cas9; c is a BmVasa mutant strain obtained by hybridizing A and B.

FIG. 3 is a size comparison of spawning of mutant silkworms after mating with wild silkworms with spawning of wild silkworms by selfing. Δbmvasa: a BmVasa mutant; WT: wild type.

Detailed Description

Through extensive research and repeated experiments, the present inventors combine the silkworm embryo microinjection technology with the fluorescence detection and molecular biological operation through the selection of gene mutation sites and the construction of transgenic plasmids, and construct a BmVasa gene mutation silkworm strain, after Vasa gene mutation is found, the normal mating behavior of the silkworm is not affected, but the silkworm egg hatching rate of female mutants serving as parents is only about 1%, wherein the silkworm egg hatching rate of male mutants serving as parents is close to 0, and the female and male silkworm of BmVasa gene mutants are highly sterile, so that the present invention can be used for genetic control of lepidopteran insect and control of lepidopteran pests, thereby completing the present invention.

Lepidoptera of

Lepidoptera include both moth and butterfly insects. Belongs to the subclass pteridosis and the class of holomorphism. About 20 tens of thousands are known worldwide, and about 8000 or more are known in China. This order is the 2 nd most order of the class entomophagous, next to coleoptera. Including the family of the Faberidae; pinaceae, such as wheat moth, pink bollworm, potato tuber moth, sweet potato moth, etc.; the Phantom species, such as Phantom gossypii, phantom sojae atricolor, etc.; the borer moth family, such as shirttail, corn borer, etc.; ulnara, such as great bridgeworm, etc.; pinaceae, such as Pink cabbage, etc.; nocturnal moth families such as noctuid, cotton bollworm, etc.; podoptera, such as Plutella xylostella; pacific, such as Pteriidae, etc.; the family of naviridae, such as trichostrongylodes naviculatus, etc.; the family of the Phantom, such as Phantom chrysalis, phantom rubra, fall webworm, etc.; the family of the Araliaceae, such as grape Tianmoth, etc.; silkworm moth, such as silkworm; the family of the Fabricius, such as Ailanthus; pteridae, such as rice bracts, etc. Lepidopteran insects are extremely widely distributed, with tropical species being the most abundant. Most kinds of larvae are harmful to various cultivated plants, and the large-sized people often eat up leaves or drill branches. The smaller body shape is often harmful to the people from rolling up, attaching leaves, binding sheaths, spinning wires and netting or drilling into plant tissues for feeding. The imago takes nectar and the like as supplementary nutrition, or the degradation of the mouth organ does not eat any more, and the imago is generally not directly endangered.

As described above, most of lepidopteran insects are pests, and few are also economically valuable insects, such as silkworms. Therefore, the research on the large-scale sterile technology of lepidopteran insects can generate great practical significance for preventing and controlling pests and economically valuable transgene products.

Thus, in a preferred embodiment, the lepidopteran insect of the invention is a silkworm.

The current lepidopteran insect transgenic technology is usually carried out in a transposon mode. The PiggyBac transposon is a transposon derived from lepidoptera insects, is originally obtained by infecting a Trichoplusia ni (Trichoplusia ni) TN-368 cell line by a Baculovirus (Baculovirus), is first isolated from Galleria mellonella (GmMNPV) and Autographa californica (AcMNPV) nuclear polyhedrosis viruses, and is proved to be accurate in excision test of pink bollworm (Pectinophora gassypiella) embryo, silkworm (Bombyx mori) egg cell and the like. Experiments in yellow typhoid mosquitoes (Aedes aegypti), noctuid, silkworm egg cells and the like also show that PiggyBac can smoothly swivel, and the frequency of excision and swivel is high. The study in silkworms began in 1997 and found the transposable effect of the PiggyBac transposon on silkworms, which researchers subsequently studied using the PiggyBac transposon. Deep research on the PiggyBac transposon lays a theoretical foundation for genetic control of pests.

The principle of the currently commonly used genome editing technology is to induce non-homologous end joining (Nonhomologous end joining, NHEJ) and homologous recombination repair (Homologous recombination, HR) of DNA repair systems in cells by artificially generating DNA Double Strand Breaks (DSBs) at specific sites in the genome. Through the repair path, the generated DNA double bond rupture site is considered to realize gene mutation, specific mutation introduction and site-directed modification. Genome editing is divided into three categories, wherein the CRISPR/Cas9 technology cost is low, and the target point shearing efficiency is high.

Vasa (also known as Vasa-like-gene, VLG) is an ATP-dependent RNA helicase, has extremely strong conservation, is ubiquitous in animals, and plays an important role in gonadal development and reproduction. Vasa belongs to the DEAD-box gene family among gene families, whose genes generally contain a variety of ATP-dependent RNA helicases and ATP-dependent DNA helicases. The invention is thatVasa gene of (A)Is lepidopteran insectVasa gene of (A)Preferably silkworm.BmVasa group of silkwormIs a suitable material for researching reproduction of lepidopteran insects and controlling lepidopteran insects by a sterile technology.

In view of the teachings of the present invention and the prior art, it will be readily appreciated by those of ordinary skill in the art that, although the present examples provide a target sequence for the Vasa gene derived from Bombyx mori, other Vasa gene target sequences derived from lepidoptera insects, such as Asian corn borer, cotton bollworm, which have some homology (conservation) to the promoter of the present invention, are included within the scope of the present invention, as long as one of ordinary skill in the art, after reading the present application, can readily isolate the Vasa gene target sequence from other insects and verify its function based on the information provided herein.

Thus, the invention encompasses nucleic acids having 50% or more (preferably 60% or more, 70% or more, 80% or more, more preferably 90% or more, more preferably 95% or more, most preferably 98% or more, such as 99%) homology to the preferred Vasa gene target sequence 1 or 2 (SEQ ID NO:1 or 2) of the invention, which also have the function of knocking out the Vasa gene as target sequence in the CRISPR/Cas9 technique, thereby giving rise to sterile mutants. "homology" refers to the level of similarity (i.e., sequence similarity or identity) between two or more nucleic acids in terms of percentage of positional identity.

In the invention, bmVasa gene mutation targets are as follows:

target 1 is GGTGGCCGAGGCGGAGGACGAGG;

target 2 is GGCACTGGTGCTGTGCGCCATCAAGG.

(1) BmVasa gene knockout vector:

the BmVasa knockout plasmid PXL-BacII-IE1-DsRed2-Real-U6-BmVasasgRNA1-U6-BmVasasgRNA2 used in the invention is modified based on the PiggyBac transposon (Piggybac transposon see Fraser et al Insect Moecular Biology, 1996) widely applied to insect transgenic research. The following are provided:

firstly, red fluorescent protein DsRed driven by an IE1 promoter (Kojima et al, virus research, 2008) is introduced into a PiggyBac transposon vector, and the red fluorescent protein DsRed is constructed into a PXL-BacII-IE1-DsRed2 transgenic vector. After successful transfer into the vector, transgenic positive individuals can express red fluorescence in a whole body from the late embryo stage, and the screening is convenient. Then two insertion U6 sequences-polyA sequences (U6 is a promoter sequence, polyA sequence is a polyadenylation sequence at the 3' -end of mRNA) are sequentially inserted into the PXL-BacII-IE1-DsRed2 plasmid, wherein the U6 sequence is shown as SEQ ID NO:3, and the polyA sequence is: "TTTTTT". To this end, the piggyBac transposon vector was transformed into the plasmid PXL-BacII-IE1-DsRed2-Real-U6-U6.

Then, silkworm gonad RNA is subjected to reverse transcription to obtain silkworm cDNA, and target spot identification primers SiteF and SiteR are used by taking the cDNA as a template to obtain BmVasa gene cDNA fragments by a PCR method. Sequencing, selecting target sequences. The long primers BmVasa-sgRNA-1 and BmVasa-sgRNA-2 are synthesized, and form primer pairs with the primers sgRNA-SalI-R and sgRNA-NheI-R with homologous arm fragments respectively, and the BmVasasgRNA-1 fragment and the BmVasasgRNA-2 fragment with homologous arms of restriction endonucleases SalI and NheI respectively are synthesized by PCR by taking PXL-BacII-IE1-DsRed2-Real-U6-U6 plasmid as a template.

Finally, the PXL-BacII-IE1-DsRed2-Real-U6-U6 plasmid was digested with the restriction enzyme SaiI. The enzyme digestion product is mixed with BmVasasaRNA-1 fragment with SalI homology arm, inserted into the downstream of the first U6 promoter by homologous recombination, sequenced, and the insertion is confirmed to be correct, thus obtaining PXL-BacII-IE1-DsRed2-Real-U6-BmVasasgRNA1-U6 plasmid. Then the restriction enzyme NheI is used for cutting PXL-BacII-IE1-DsRed2-Real-U6-BmVasasgRNA1-U6 Plasmid, then the Plasmid is mixed with BmVasasRNA-2 fragment with NheI homology arm, and then inserted into the downstream of a second U6 promoter by a homologous recombination method, after the sequencing is correct, the Plasmid Midi kit of Qiagen company is used for purification for standby. Thus, bmVasa knockout plasmid PXL-BacII-IE1-DsRed2-Real-U6-BmVasasgRNA1-U6-BmVasasgRNA2 was obtained.

(2) Transgenic silkworm Vasa knockout strain

PHA3PIG plasmid (see Tamura et al, nature Biotechnology, 2000) capable of expressing Piggybac transposase is used for assisting in generating Piggybac transposon, and Vasa knockout plasmid PXL-BacII-IE1-DsRed2-Real-U6-BmVasasgRNA1-U6-BmVasasgRNA2 and PHA3PIG plasmid are mixed and injected into wild silkworm fresh eggs by a microinjection method, and the specific method is referred to Kanda ﹠ Tamura (1991). Sealing with nontoxic glue after injection to prevent pollution, incubating in aseptic environment at 25deg.C, raising silkworm, selfing the current generation (G0 generation), and screening out red fluorescent individuals under fluorescent microscope.

Silkworm Nos-Cas9 is a silkworm transgenic activation line. The transgenic silkworms of the strain express EGFG green fluorescence in the whole body, and express Cas9 protein in gonads, so that the strain is a parent silkworms for obtaining double-fluorescence silkworms in the future. Constructed according to literature (Xu, j., chen, s, zeng, b., james, a.a., tan, a.and Huang, y. (2017) building mori P-element Somatic Inhibitor (BmPSI) Is a Key Auxiliary Factor for Silkworm Male Sex determination, plos Genet,13, e 1006576). Firstly, a green fluorescent protein EGFP driven by an IE1 promoter (Kojima et al, virus research, 2008) is introduced into a PiggyBac transposon vector to construct a PXL-BacII-IE1-EGFP transgenic vector. Then cloning the promoter of the silkworm Nos gene, the Cas9 gene and the SV40 terminator sequence, respectively. The PXL-BacII-IE1-EGFP transgenic vector is inserted once through a homologous recombination method, so that the PXL-BacII-IE1-EGFP-Nos-Cas9-SV40 transgenic plasmid is obtained. Finally, the wild silkworm is microinjected to obtain a transgenic silkworm strain Nos-Cas9. The sequence of the Nos promoter is described in the patent "promoter for the specific expression of the gonad of silkworm" and its capturing method "(patent application No. 201610360601.2, chen Rongmei, etc., 2016). The sequence of the Cas9 gene is shown as SEQ ID NO. 4. The SV40 terminator sequence is shown in SEQ ID NO. 5. Sealing with nontoxic glue after injection to prevent pollution, incubating in aseptic environment at 25deg.C, raising silkworm, selfing the current generation (G0 generation), and screening out green fluorescent individuals under fluorescent microscope.

And then feeding and mating the screened G1 generation red fluorescent individuals and the Nos-Cas9G1 generation green fluorescent individuals, screening the obtained G2 generation newly-hatched silkworms with a fluorescence microscope to obtain double-fluorescence (namely red-light-emitting and green-light-emitting) newly-hatched silkworms, extracting genome of the obtained double-fluorescence silkworms to identify target mutation conditions, and counting spawning conditions.

(3) Detection of BmVasa mutant silkworms

The invention discovers that BmVasa gene mutation has substantial influence on silkworm egg size and hatching rate by verifying BmVasa gene mutation of double-fluorescence silkworm and counting spawning conditions. The identification of the genetic mutation condition is as follows: and (3) picking a plurality of double-fluorescence silkworms in the period of formic silkworm, extracting genome, cloning target fragments by a PCR method, and sequencing. The spawning condition of the double-fluorescence silkworms can be counted by mating a large number of single-sex double-fluorescence silkworms with wild silkworms at an ambient temperature of 25 ℃ for 5 hours and then disassembling the pairs, and then spawning for 36 hours in the same environment.

The invention has the advantages that: the CRISPR/Cas9 technology based on piggyBac transposon is utilized for the first time to successfully construct a silkworm strain with high sterility on the premise of not influencing normal mating behavior. The obtained transgenic BmVasa mutant silkworm strain does not have any obstacle when being mated with a wild type in the same environment, but the silkworm egg hatching rate of female mutants serving as parents is only about 1%, wherein the silkworm egg hatching rate of male mutants serving as parents is close to 0. In addition, the invention makes the acquisition of mutants very easy. The invention has important value in the aspect of preventing and controlling lepidoptera pests through a sterile technology.

EXAMPLE 1 construction of vectors

1. The BmVasa knockout plasmid PXL-BacII-IE1-DsRed2-Real-U6-BmVasasgRNA1-U6-BmVasasgRNA2 is obtained by cloning through a PCR method. The method comprises the following specific steps:

I. BmVasa-sgRNA-1 and sgRNA-SalI-R are used as primers, PXL-BacII-IE1-DsRed2-Real-U6-U6 plasmid is used as a template, and a PCR reaction system is configured by KOD PLUS Taq enzyme (Takara Bio-engineering company) according to the following system to obtain BmVasasgRNA-1 fragment.

Name of the name	Dosage (μl)
		10×Buffer	5
2mM dNTPs	5
		25mM MgSO 4	2
BmVasa-sgRNA-1	1.5
		sgRNA-SalI-R	1.5
KOD-Plus	0.5
		PXL-BacII-IE1-DsRed2-Real-U6-U6 plasmid	100ng
Adding deionized water to	50

The PCR procedure was set as follows:

the PCR product was purified using the Gel Extraction Kit D2500 kit for use.

Likewise, bmVasasgRNA-2 fragment was obtained using the primer BmVasa-sgRNA-2, the primer sgRNA-NheI-R and the PCR purification product as described above as templates.

II, enzyme cutting PXL-BacII-IE1-DsRed2-Real-U6-U6 plasmid. The enzyme digestion system is as follows:

and (3) enzyme cutting: 37℃for 1 hour.

The cleavage products were purified using the Plasmid Midi kit from Qiagen.

III. BmVasasgRNA-1 and BmVasasgRNA-2 fragments were inserted downstream of the U6 promoter of PXL-BacII-IE1-DsRed2-Real-U6-U6 using One Step Cloning Kit. (taking the insertion of BmVasasgRNA-1 as an example)

The reaction system is as follows:

the reaction procedure: 37 ℃ for 30min; ice bath for 5min.

And IV, transforming the recombinant plasmid obtained in the step III, plating, and performing colony PCR on every other day. The reaction system is the same as the step I. Positive monoclonal sequencing, using primers: sgRNA-F3421; sgRNA-R20.

Sequencing results prove that the BmVasasgRNA-1 fragment is inserted correctly. The Plasmid was purified using the Plasmid Midi kit from Qiagen. Using this plasmid, the I, II, III, IV procedure was repeated and the BmVasasgRNA-2 fragment was inserted to obtain the Vasa knockout plasmid PXL-BacII-IE1-DsRed2-Real-U6-BmVasasgRNA1-U6-BmVasasgRNA2 (plasmid map see FIG. 1) for subsequent injection. The primers or enzymes required in the repeat I, II, III, IV step are: step I, bmVasa-sgRNA-2, sgRNA-SalI-R; step II, nheI endonuclease (NEB Co.); III, sgRNA-F3421, sgRNA-R3667.

Example 2 acquisition and detection of transgenic silkworms

The Vasa knockout plasmid PXL-BacII-IE1-DsRed2-Real-U6-BmVasasgRNA1-U6-BmVasasgRNA2 prepared in example 1 and the plasmid PHA3PIG capable of expressing the Piggybac transposase were mixed in equal amounts and injected into the initial spawning of silkworms. The injection method was microinjection according to the method described by Kanda ﹠ Tamura (1991). Sealing with nontoxic glue after injection to prevent pollution, incubating in aseptic environment at 25deg.C, breeding silkworm, selfing current generation (G0 generation) silkworm moth, and screening transgenic silkworm individual with red fluorescence (BmVasa mutant intermediate strain) under fluorescence microscope.

Equal amounts of the PXL-BacII-IE1-EGFP-Nos-Cas9-SV40 transgenic plasmid and the plasmid PHA3PIG capable of expressing the Piggybac transposase are mixed and injected into the initial spawning of silkworm. The injection method was microinjection according to the method described by Kanda ﹠ Tamura (1991). Sealing with nontoxic glue after injection to prevent pollution, incubating in aseptic environment at 25deg.C, breeding silkworm, selfing current generation (G0 generation) silkworm moth, and screening transgenic silkworm individual with green fluorescence under fluorescence microscope to obtain transgenic silkworm strain Nos-Cas9.

And then feeding and mating the red fluorescence transgenic silkworms and the green fluorescence transgenic silkworms which are obtained by screening, screening the obtained G2-generation newly-hatched silkworms (namely red-light-emitting and green-light-emitting newly-hatched silkworms) under a fluorescence microscope, extracting genome of the obtained double-fluorescence silkworms to identify target mutation conditions, and counting spawning conditions (see figure 2).

Identification of the Gene mutation situation: the genome of 10 double-fluorescence silkworms is extracted in the period of formic silkworm, and the primers SiteF and SiteR are used for cloning target fragments by a PCR method and sequencing. Sequencing results show that the sequences of the target 1 and the target 2 in BmVasa genes in the double-fluorescence silkworms are mutated.

Conditions of spawning by double fluorescent silkworms: 30 single sex double fluorescent silkworms were mated with wild silkworms at an ambient temperature of 25 ℃ for 5 hours, followed by spawning in the same environment for 36 hours, and the spawning amount was counted, see fig. 3 and table 1. As can be seen, the eggs laid by female silkworms and normal male silkworms which generate mutation (namely double fluorescence) by BmVasa are commonly malformed, and the hatching rate is only 1%; the eggs laid by the male silkworms and the normal female silkworms which are mutated (namely double fluorescence) by BmVasa are not malformed, but the hatching rate is close to 0%. In conclusion, the average hatching rate of offspring generated by mating the silkworm with normal silkworm, which is mutated (i.e. bifluorescent) by BmVasa, is less than 1%.

TABLE 1 spawning conditions

The specific embodiments described herein are offered by way of example only to illustrate the spirit of the invention. Those skilled in the art may make various modifications or additions to the described embodiments or substitutions thereof without departing from the spirit of the invention or exceeding the scope of the invention as defined in the accompanying claims.

Sequence listing

<110> Shanghai university

Shanghai Institute of life sciences, Chinese Academy of Sciences

<120> a method for producing lepidopteran insects with both male and female high sterility and nucleic acid construct therefor

<150> 201810123478.1

<151> 2018-02-07

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

ggtggccgag gcggaggacg agg 23

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

ggcactgctg tgcgccatca agg 23

<210> 3

<211> 467

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

aggttatgta gtacacattg ttgtaaatca ctgaattgtt ttagatgatt ttaacaatta 60

gtacttatta atattaaata agtacatacc ttgagaattt aaaaatcgtc aactataagc 120

catacgaatt taagcttggt acttggctta tagataagga cagaataaga attgttaacg 180

tgtaagacaa ggtcagatag tcatagtgat tttgtcaaag taataacaga tggcgctgta 240

caaaccataa ctgttttcat ttgtttttat ggattttatt acaaattcta aaggttttat 300

tgttattatt taatttcgtt ttaattatat tatatatctt taatagaata tgttaagagt 360

ttttgctctt tttgaataat ctttgtaaag tcgagtgttg ttgtaaatca cgctttcaat 420

agtttagttt ttttaggtat atatacaaaa tatcgtgctc tacaagt 467

<210> 4

<211> 4140

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

atggacaaga agtactccat tgggctcgat atcggcacaa acagcgtcgg ctgggccgtc 60

attacggacg agtacaaggt gccgagcaaa aaattcaaag ttctgggcaa taccgatcgc 120

cacagcataa agaagaacct cattggcgcc ctcctgttcg actccgggga gacggccgaa 180

gccacgcggc tcaaaagaac agcacggcgc agatataccc gcagaaagaa tcggatctgc 240

tacctgcagg agatctttag taatgagatg gctaaggtgg atgactcttt cttccatagg 300

ctggaggagt cctttttggt ggaggaggat aaaaagcacg agcgccaccc aatctttggc 360

aatatcgtgg acgaggtggc gtaccatgaa aagtacccaa ccatatatca tctgaggaag 420

aagcttgtag acagtactga taaggctgac ttgcggttga tctatctcgc gctggcgcat 480

atgatcaaat ttcggggaca cttcctcatc gagggggacc tgaacccaga caacagcgat 540

gtcgacaaac tctttatcca actggttcag acttacaatc agcttttcga agagaacccg 600

atcaacgcat ccggagttga cgccaaagca atcctgagcg ctaggctgtc caaatcccgg 660

cggctcgaaa acctcatcgc acagctccct ggggagaaga agaacggcct gtttggtaat 720

cttatcgccc tgtcactcgg gctgaccccc aactttaaat ctaacttcga cctggccgaa 780

gatgccaagc ttcaactgag caaagacacc tacgatgatg atctcgacaa tctgctggcc 840

cagatcggcg accagtacgc agaccttttt ttggcggcaa agaacctgtc agacgccatt 900

ctgctgagtg atattctgcg agtgaacacg gagatcacca aagctccgct gagcgctagt 960

atgatcaagc gctatgatga gcaccaccaa gacttgactt tgctgaaggc ccttgtcaga 1020

cagcaactgc ctgagaagta caaggaaatt ttcttcgatc agtctaaaaa tggctacgcc 1080

ggatacattg acggcggagc aagccaggag gaattttaca aatttattaa gcccatcttg 1140

gaaaaaatgg acggcaccga ggagctgctg gtaaagctta acagagaaga tctgttgcgc 1200

aaacagcgca ctttcgacaa tggaagcatc ccccaccaga ttcacctggg cgaactgcac 1260

gctatcctca ggcggcaaga ggatttctac ccctttttga aagataacag ggaaaagatt 1320

gagaaaatcc tcacatttcg gataccctac tatgtaggcc ccctcgcccg gggaaattcc 1380

agattcgcgt ggatgactcg caaatcagaa gagaccatca ctccctggaa cttcgaggaa 1440

gtcgtggata agggggcctc tgcccagtcc ttcatcgaaa ggatgactaa ctttgataaa 1500

aatctgccta acgaaaaggt gcttcctaaa cactctctgc tgtacgagta cttcacagtt 1560

tataacgagc tcaccaaggt caaatacgtc acagaaggga tgagaaagcc agcattcctg 1620

tctggagagc agaagaaagc tatcgtggac ctcctcttca agacgaaccg gaaagttacc 1680

gtgaaacagc tcaaagaaga ctatttcaaa aagattgaat gtttcgactc tgttgaaatc 1740

agcggagtgg aggatcgctt caacgcatcc ctgggaacgt atcacgatct cctgaaaatc 1800

attaaagaca aggacttcct ggacaatgag gagaacgagg acattcttga ggacattgtc 1860

ctcaccctta cgttgtttga agatagggag atgattgaag aacgcttgaa aacttacgct 1920

catctcttcg acgacaaagt catgaaacag ctcaagaggc gccgatatac aggatggggg 1980

cggctgtcaa gaaaactgat caatgggatc cgagacaagc agagtggaaa gacaatcctg 2040

gattttctta agtccgatgg atttgccaac cggaacttca tgcagttgat ccatgatgac 2100

tctctcacct ttaaggagga catccagaaa gcacaagttt ctggccaggg ggacagtctt 2160

cacgagcaca tcgctaatct tgcaggtagc ccagctatca aaaagggaat actgcagacc 2220

gttaaggtcg tggatgaact cgtcaaagta atgggaaggc ataagcccga gaatatcgtt 2280

atcgagatgg cccgagagaa ccaaactacc cagaagggac agaagaacag tagggaaagg 2340

atgaagagga ttgaagaggg tataaaagaa ctggggtccc aaatccttaa ggaacaccca 2400

gttgaaaaca cccagcttca gaatgagaag ctctacctgt actacctgca gaacggcagg 2460

gacatgtacg tggatcagga actggacatc aatcggctct ccgactacga cgtggatcat 2520

atcgtgcccc agtcttttct caaagatgat tctattgata ataaagtgtt gacaagatcc 2580

gataaaaata gagggaagag tgataacgtc ccctcagaag aagttgtcaa gaaaatgaaa 2640

aattattggc ggcagctgct gaacgccaaa ctgatcacac aacggaagtt cgataatctg 2700

actaaggctg aacgaggtgg cctgtctgag ttggataaag ccggcttcat caaaaggcag 2760

cttgttgaga cacgccagat caccaagcac gtggcccaaa ttctcgattc acgcatgaac 2820

accaagtacg atgaaaatga caaactgatt cgagaggtga aagttattac tctgaagtct 2880

aagctggtct cagatttcag aaaggacttt cagttttata aggtgagaga gatcaacaat 2940

taccaccatg cgcatgatgc ctacctgaat gcagtggtag gcactgcact tatcaaaaaa 3000

tatcccaagc ttgaatctga atttgtttac ggagactata aagtgtacga tgttaggaaa 3060

atgatcgcaa agtctgagca ggaaataggc aaggccaccg ctaagtactt cttttacagc 3120

aatattatga attttttcaa gaccgagatt acactggcca atggagagat tcggaagcga 3180

ccacttatcg aaacaaacgg agaaacagga gaaatcgtgt gggacaaggg tagggatttc 3240

gcgacagtcc ggaaggtcct gtccatgccg caggtgaaca tcgttaaaaa gaccgaagta 3300

cagaccggag gcttctccaa ggaaagtatc ctcccgaaaa ggaacagcga caagctgatc 3360

gcacgcaaaa aagattggga ccccaagaaa tacggcggat tcgattctcc tacagtcgct 3420

tacagtgtac tggttgtggc caaagtggag aaagggaagt ctaaaaaact caaaagcgtc 3480

aaggaactgc tgggcatcac aatcatggag cgatcaagct tcgaaaaaaa ccccatcgac 3540

tttctcgagg cgaaaggata taaagaggtc aaaaaagacc tcatcattaa gcttcccaag 3600

tactctctct ttgagcttga aaacggccgg aaacgaatgc tcgctagtgc gggcgagctg 3660

cagaaaggta acgagctggc actgccctct aaatacgtta atttcttgta tctggccagc 3720

cactatgaaa agctcaaagg gtctcccgaa gataatgagc agaagcagct gttcgtggaa 3780

caacacaaac actaccttga tgagatcatc gagcaaataa gcgaattctc caaaagagtg 3840

atcctcgccg acgctaacct cgataaggtg ctttctgctt acaataagca cagggataag 3900

cccatcaggg agcaggcaga aaacattatc cacttgttta ctctgaccaa cttgggcgcg 3960

cctgcagcct tcaagtactt cgacaccacc atagacagaa agcggtacac ctctacaaag 4020

gaggtcctgg acgccacact gattcatcag tcaattacgg ggctctatga aacaagaatc 4080

gacctctctc agctcggtgg agacagcagg gctgacccca agaagaagag gaaggtgtga 4140

<210> 5

<211> 231

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

gactctagat cataatcagc cataccacat ttgtagaggt tttacttgct ttaaaaaacc 60

tcccacacct ccccctgaac ctgaaacata aaatgaatgc aattgttgtt gttaacttgt 120

ttattgcagc ttataatggt tacaaataaa gcaatagcat cacaaatttc acaaataaag 180

catttttttc actgcattct agttgtggtt tgtccaaact catcaatgta t 231

Claims (6)

1. A method for producing lepidopteran insects that are highly sterile to the male and female, comprising the steps of:

1) Constructing a Vasa gene knockout nucleic acid construct comprising the following operably linked elements from the 5 'end to the 3' end: a first sgRNA expression element and a second sgRNA expression element; the first sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a first Vasa gene target and polyA; the second sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a second Vasa gene target and polyA;

the nucleotide sequence of the first Vasa gene target is shown as SEQ ID NO. 1, and the nucleotide sequence of the second Vasa gene target is shown as SEQ ID NO. 2;

2) Co-transferring fresh lepidoptera insect eggs with the Vasa gene knockout nucleic acid construct and PHA3PIG plasmid capable of expressing Piggybac transposase in the step 1), incubating, and transforming moths to obtain a generation G0, and selfing the generation G0 to obtain a generation G1;

the Vasa gene knockout nucleic acid construct further comprises a first screening marker gene expression cassette, wherein the first screening marker gene is a red fluorescent protein gene;

and

3) Mating the G1 generation in the step 2) with a transgenic lepidopteran insect expressing Cas9 protein to obtain a G2 generation, and obtaining the lepidopteran insect with male and female high sterility; the lepidopteran insect is a silkworm.

2. The method of claim 1, wherein the transgenic lepidopteran insect expressing Cas9 protein comprises a Cas9 gene expression cassette comprising, from 5 'to 3' end, operably linked elements of: the Nos promoter, cas9 protein coding sequence and SV40 terminator.

3. The method of claim 2, wherein the transgenic lepidopteran insect expressing Cas9 protein further comprises a second selectable marker gene expression cassette.

4. The method of claim 1, wherein said cotransformation is microinjection of fresh insect eggs from a mixture of said Vasa knockdown nucleic acid construct and a PHA3PIG plasmid capable of expressing a Piggybac transposase.

5. A Vasa gene knockout nucleic acid construct comprising, from the 5 'end to the 3' end, the following operably linked elements: a first sgRNA expression element and a second sgRNA expression element; the first sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a first Vasa gene target and polyA; the second sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a second Vasa gene target and polyA; the nucleotide sequence of the first Vasa gene target is shown as SEQ ID NO. 1, and the nucleotide sequence of the second Vasa gene target is shown as SEQ ID NO. 2.

6. A method for controlling lepidopteran pests, comprising the steps of: wild release of lepidopteran insects which are male and female highly sterile and prepared by the method of claim 1, reduction of offspring and population number by mating with wild lepidopteran insects; the lepidopteran insect is a silkworm.

Images