CN110117613B - Method for preparing male sterile lepidoptera insect and nucleic acid construct thereof - Google Patents

Abstract

A method for making male sterile lepidopteran insects and nucleic acid constructs therefor. The method comprises the following steps: constructing a Ser2 knock-out nucleic acid construct comprising the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a first Ser2 gene target and polyA; a U6 promoter, a second Ser2 gene target and polyA; co-transforming the construct and PHA3PIG plasmid capable of expressing Piggybab transposase into lepidoptera fresh insect eggs to obtain G0 generation, and selfing to obtain G1 generation; and mating the G1 generation with a transgenic lepidoptera insect expressing the Cas9 protein to obtain a G2 generation. The invention successfully constructs the male sterile lepidoptera insect on the premise of not influencing the normal mating behavior by utilizing the CRISPR/Cas9 technology based on the PiggyBac transposon, and has important value in the aspect of preventing and controlling the lepidoptera insect through the male sterility technology.

Description

Method for preparing male sterile lepidoptera insect and nucleic acid construct thereof

Technical Field

The invention belongs to the technical field of biology, and relates to a method for preparing male sterile lepidoptera insects and a nucleic acid construct thereof.

Background

Silkworm is a typical model economic insect, and is one of economic insects which uses mulberry leaves as food, and spins and cocoons. The silkworm is used as a research object for controlling insect pests, particularly genetic control of lepidoptera pests, and has great influence on the genetic control of agricultural and forestry pests, and can be popularized and applied to other lepidoptera insects. Most of the current biological pest control sterility technologies are induced by radiation and tetracycline, and the two sterility technologies are time-consuming and labor-consuming and cannot have stable genetic effect lines, and most of the sterility technologies release sterile males to control pests, but the sterile males are weak in competitiveness and cannot be effectively mated compared with wild males. In nature, female adults are mostly less motile during mating, mating by releasing sex pheromones to attract males. Therefore, the research on an effective sterile line of female insects and next generation males, which is stably inherited and can pass releasing sex information, is imminent.

Male sterility has been a focus of pest control, and early in the last 50 s, the united states used the radiation sterility technology to successfully eradicate trypanosoma cruzi (cochliomia hominivorax) for the first time in human history, and in 2 months of 1975, japan succeeded in eradicating sterile melon flies (Bactrocera cucuribiae) by releasing them through radiation treatment. Female-specific lethality can be achieved by using tetracycline to regulate female splicing factors. Although both radiation and tetracycline can induce sterile insects, the target sterile insects for both are female and not male.

During the mating reproduction of insects, male seminal proteins, which are essential for the reproductive success of males and females, are transferred into females by the ejaculatory activity. Male seminal protein can affect the success of male sperm competition and female fertility, longevity, offspring survival rate, etc. It has been reported that secretion of male accessory gonadal proteins during reproductive mating is plastic, can evolve rapidly under natural selection, and is more complex than hitherto thought.

Disclosure of Invention

The invention aims to overcome the defect of lepidoptera insect lines which lack male sterility in a lepidoptera insect genetic sterility technology, and provides a method for preparing male sterile lepidoptera insects and a nucleic acid construct thereof.

To this end, the present invention provides a method for preparing male sterile lepidopteran insects, comprising the steps of:

1) Constructing a Ser2 knock-out nucleic acid construct comprising the following operably linked elements from the 5 'end to the 3' end: a first sgRNA expression element and a second sgRNA expression element; the first sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a first Ser2 gene target and polyA; the second sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a second Ser2 gene target and polyA;

2) Co-transforming the Ser2 gene knockout nucleic acid construct in the step 1) and a PHA3PIG plasmid capable of expressing Piggybab transposase into lepidoptera fresh insect eggs, hatching and dissolving moths to obtain a G0 generation, and selfing the G0 generation to obtain a G1 generation; and

3) Mating the G1 generation described in the step 2) with a transgenic lepidoptera insect expressing Cas9 protein to obtain a G2 generation, namely obtaining the male and female highly sterile lepidoptera insect.

Preferably, the nucleotide sequence of the first Ser2 gene target point is shown in SEQ ID NO. 1, and the nucleotide sequence of the second Ser2 gene target point is shown in SEQ ID NO. 2.

Preferably, the Ser2 gene knockout nucleic acid construct further comprises a first selectable marker gene expression cassette.

Preferably, the first selectable marker gene is a red fluorescent protein gene.

Preferably, the transgenic lepidopteran insect expressing a Cas9 protein contains a Cas9 gene expression cassette, and the Cas9 gene expression cassette comprises the following operably linked elements from 5 'end to 3' end: nos promoter, cas9 protein coding sequence and SV40 terminator.

Preferably, the transgenic lepidopteran insect expressing Cas9 protein further comprises a second selection marker gene expression cassette. Preferably, the second selectable marker gene is green fluorescent protein.

Preferably, the co-transformation is to mix the Ser2 gene knockout nucleic acid construct and PHA3PIG plasmid capable of expressing Piggybab transposase and then obtain a mixed solution for microinjection of fresh insect eggs.

Preferably, the lepidopteran insect is a silkworm.

The invention also provides a Ser2 gene knockout nucleic acid construct comprising the following operably linked elements from the 5 'end to the 3' end: a first sgRNA expression element and a second sgRNA expression element; the first sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a first Ser2 gene target and polyA; the second sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a second Ser2 gene target and polyA.

The invention also provides a method for controlling lepidopteran pests, which comprises the following steps: male sterile lepidopteran insects prepared as described above are released in the field and mated with wild lepidopteran insects to reduce progeny and reduce population numbers.

The invention utilizes the CRISPR/Cas9 technology based on piggyBac transposon to knock out silkworm Ser2 gene, provides stable and effective male sterile genetic strain, and solves the problem that the traditional method for inducing sterile insects by radiation and tetracycline can not stably and effectively inherit to offspring. The silkworm Ser2 gene is knocked out for the first time, and male insect mutants in offspring are sterile through the release of female mutants, so that the controllability of insects is realized. The invention combines the silkworm embryo microinjection technology, the fluorescence detection and the molecular biological operation to knock out the silkworm Ser2 gene, thereby obtaining the male sterile stable genetic strain. Can be popularized to the biological control of pests and promote the development of environment-friendly control.

Drawings

FIG. 1 shows the structure diagram of Ser2 gene of Bombyx mori and the construction pattern diagram of plasmid. A: silkworm Ser2 gene structure and target spot knock-out, red is PAM sequence. B: and constructing a pattern diagram of the Ser2 gene transgenic plasmid.

FIG. 2 silkworm Ser2 gene knockout results in male sterility. A: eggs laid by mating of wild type female and male insects (WT female and WT female) can be developed, eggs laid by mating of wild type female insects and mutant male insects (delta Ser2 female and WT female) cannot be developed, eggs laid by mating of wild type male insects and mutant female insects (WT male and delta Ser2 female) can be developed, and eggs laid by mating of mutant female insects and mutant male insects (delta Ser2 male and delta Ser2 female) cannot be developed. B: quantitative plots of the number of offspring after mating of adults show that the number of offspring is very different between mutant males compared to wild type and mutant females.

Detailed Description

The inventor constructs a BmSer2 gene mutation silkworm strain by combining a silkworm embryo microinjection technology, fluorescence detection and molecular biological operation through selection of a gene mutation site and construction of a transgenic plasmid, finds that after Ser2 gene mutation, normal mating behaviors of male and female mutants are not affected, the hatching rate of silkworm eggs with the female mutants as parents is normal, but the hatching rate of silkworm eggs with the male mutants as parents is close to 0, so that the BmSer2 gene mutant silkworm male sterility is seen, can be used for genetic control of lepidoptera insects, and prevents and treats the lepidoptera insects, thereby completing the invention.

Lepidoptera (Lepidoptera)

The lepidoptera includes two kinds of insects, i.e., moths and butterflies. Belonging to subclasses of pteridophytes and holomorphia. About 20 thousands of species are known worldwide, and about 8000 more species are known in china. This order is the 2 nd order of the Insecta, second only to Coleoptera. Including the family of the Mericidae; pieridaes, such as wheat moth, pink bollworm, potato tuber moth, sweet potato wheat moth, and the like; tortricidae, such as cotton brown looper, soybean pod borer, and the like; borer family, such as Grapholitha molesta Busck, corn borer, etc.; family of Chilidae, such as Daqiangchongchong, and the like; pietaceae, such as Pieris rapae, etc.; noctuidae such as Trichoplusia ni, heliothis armigera, etc.; the family Bombycidae, such as gypsy moth, etc.; papilionaceae, such as Jade with butterfly, and golden butterfly; naviridae, such as navicula caterpillar; the family of the Arctiidae, such as the Bombycis flavicans, the Arctia sanguinea, and the like; family of hawkmothae, such as grape hawkmoth; bombycidae, such as Bombyx mori, etc.; family Bombycidae, such as Ailanthus altissima; skipper family, such as rice skipper. The range of lepidopteran insects is extremely wide, and the tropical species are most abundant. Most of the larvae are harmful to various cultivated plants, and those with larger body form usually eat leaves or bore branches and trunks completely. Smaller patients tend to suffer from leaf curl, leaf ornamentation, scabbling, silking and netting, or food intake by digging into plant tissues. The adult insects mostly take nectar and the like as supplementary nutrition, or the mouth organs are degraded and are not taken for eating, so that direct harm is not caused generally.

In summary, lepidopteran insects are most pests in the periphery, and a few, for example, silkworms are economically valuable insects. Therefore, the research on the large-scale male sterility technology of lepidoptera insects has great practical significance for the prevention and control of pests and transgenic products with economic value.

Thus, in a preferred embodiment, the lepidopteran insect of the present invention is a silkworm.

The present lepidopteran insect transgenic technology is performed by means of a transposon. The piggyBac transposon is a transposon derived from lepidopteran insects, and is originally obtained by infecting a Trichoplusia ni (Trichoplusia ni) TN-368 cell line with Baculovirus (Baculovirus) and primarily isolated from Galleria mellonella (GmNMPV) and Autographa californica (AcMNPV) nuclear polyhedrosis virus, and the excision tests of the piggyBac transposon and the like all prove the accuracy of excision of the piggyBac transposon. Experiments in yellow typhoid mosquitoes (Aedes aegypti), powdered mosquito moths, silkworm ova and the like also show that piggyBac can be successfully transposed, and the excision and transposition frequencies are high. The study in silkworms began in 1997, where the transposable action of piggyBac transposons on silkworms was discovered, and researchers subsequently studied the silkworms using the piggyBac transposons. The intensive research of the piggyBac transposon lays a theoretical foundation for the genetic control of pests.

The principle of the currently widely used genome editing technology is to induce the DNA repair system in cells to generate non-Homologous end joining (NHEJ) and Homologous recombination repair (HR) by artificially generating DNA Double Strand Breaks (DSB) at specific sites of the genome. Through the repair approach, the generated DNA double bond fracture is considered to realize gene mutation, specific mutation introduction and site-specific modification. Genome editing is divided into three categories, wherein the CRISPR/Cas9 technology has low cost and high target cutting efficiency.

Ser2 (also known as serine protease 2) is a serine protease, has strong conservation, is ubiquitous in animals, and plays an important role in reproductive development. Ser2 belongs to the serine gene family in the gene family, and the gene family generally comprises a plurality of genes for reproductive development. The Ser2 gene of the present invention is a Ser2 gene of lepidopteran insects, preferably of Bombyx mori. The BmSer2 gene of silkworm is a suitable material for researching the reproduction of lepidoptera insects and preventing and controlling lepidoptera pests by a sterility technology.

The invention preferably selects a Ser2 gene target sequence, and the target sequence is used as the target sequence in the CRISPR/Cas9 technology to knock out the Ser2 gene, thereby obtaining the function of the male sterile mutant. According to the characteristics of target sites of CRISPR/Cas9 system, two preferred targets of the invention are respectively located in the fourth exon and the fifth exon of Bombyx mori Ser2 gene (GenBank: NM-001160203.1). More preferably, the designations are TS1 (GGATGAACCCAAATTATGAGGGG) and TS2 (CCTCGAGAGAAACCCTTTTAAAAGGCC), respectively.

Thus, the invention encompasses nucleic acids having 50% or more (preferably 60% or more, 70% or more, 80% or more, more preferably 90% or more, more preferably 95% or more, most preferably 98% or more, e.g., 99%) homology with the preferred Ser2 gene target sequence 1 or 2 (SEQ ID NO:1 or 2) of the invention, which also have the function of knocking out the Ser2 gene as a target sequence in CRISPR/Cas9 technology, thereby obtaining sterile mutants. "homology" refers to the level of similarity (i.e., sequence similarity or identity) between two or more nucleic acids in terms of percentage positional identity.

In view of the teachings of the present invention and the prior art, it will be understood by those of ordinary skill in the art that although the examples of the present invention provide target sequences of Ser2 genes derived from silkworms, other insects from the order lepidoptera, such as diamond back moth and spodoptera litura, target sequences of Ser2 genes having a certain homology (conservation) with the promoters of the present invention, so long as those skilled in the art can easily isolate the target sequences of Ser2 genes from other insects and verify their functions based on the information provided by the present application after reading the present application.

(1) BmSer2 gene knockout vector:

the BmSER2 knockout plasmid PXL-BacII-IE1-DsRed2-U6-BmSER2sgRNA1-U6-BmSER2sgRNA2 used in the invention is prepared by modifying a PiggyBac transposon (see Fraser et al, institute molecular Biology, 1996)) widely applied to Insect transgene research. The following:

firstly, red fluorescent protein DsRed driven by IE1 promoter (Kojima et al, virusSearch, 2008) is introduced into PiggyBac transposon vector, so as to construct PXL-BacII-IE1-DsRed2 transgenic vector. After the vector is successfully transferred, the transgenic positive individuals can express red fluorescence in whole body from the late embryonic stage, and the screening is convenient. Then, two inserted U6 sequence-polyA sequences (U6 is a promoter sequence, and the polyA sequence is a polyadenylic acid sequence at the 3' end of mRNA) are sequentially inserted into the PXL-BacII-IE1-DsRed2 plasmid, wherein the U6 sequence is shown as SEQ ID NO:3, and the polyA sequence is shown as follows: "TTTTTT". So far, the PiggyBac transposon vector is transformed into a plasmid PXL-BacII-IE1-DsRed2-U6-U6.

Then, target identification primers F1, R1, F2 and R2 are used by a silkworm whole genome template, and a target fragment is obtained by a PCR method. Sequencing and determining the target sequence. Synthesizing long primers sgRNA-F1, sgRNA-R1, sgRNA-F2, sgRNA-R2, sgRNA-Knpi-F, sgRNA-HindIII-R, sgRNA-Overlap-F and sgRNA-Overlap-R. Wherein two pairs of primers of sgRNA-KnpI-F and sgRNA-R1, sgRNA-F1 and sgRNA-Overlap-R respectively use PXL-BacII-IE1-DsRed2-U6-U6 plasmid as a template, a product is obtained through PCR, and then the product takes a volume ratio of 2 as the template, and sgRNA-KnpI-F and sgRNA-Overlap-R as primers, and a BmSer2sgRNA-1 fragment with a restriction enzyme KnpI homologous arm is obtained through PCR. Similarly, after products are obtained by taking sgRNA-Overlap-F and sgRNA-R2, sgRNA-F2 and sgRNA-HindIII-R as first round PCR primers, and then a BmSer2sgRNA-2 fragment with a restriction enzyme HindIII homologous arm is obtained by taking sgRNA-Overlap-F and sgRNA-HindIII-R as second round primers through PCR.

Finally, the plasmid PXL-BacII-IE1-DsRed2-U6-U6 was digested with restriction enzymes KnpI and HindIII. And mixing the enzyme digestion product with a BmSer2RNA-1 fragment with a KnpI homologous arm and a BmSer2RNA-2 fragment with a HindIII homologous arm, respectively inserting the mixture into the downstream of a U6 promoter by a homologous recombination method, sequencing, and obtaining a PXL-BacII-IE1-DsRed2-U6-BmSer2sgRNA1-U6-BmSer2sgRNA2 plasmid after confirming that the insertion is correct. After sequencing was correct, it was purified using the Qiagen Plasmid Midi kit for use. Thus, the BmSer2 knock-out plasmid PXL-BacII-IE1-DsRed2-U6-BmSer2sgRNA1-U6-BmSer2sgRNA2 was obtained (see FIG. 1 for the plasmid scheme).

(2) Transgenic silkworm Ser2 knockout strain

In the invention, a PHA3PIG plasmid (see Tamura et al, nature Biotechnology, 2000) capable of expressing Piggybab transposase is used for assisting in generating piggyBac transposon, and a Ser2 knockout plasmid PXL-BacII-IE1-DsRed 2-U6-BmSier 2sgRNA 1-U6-BmSier 2sgRNA2 and the PHA3PIG plasmid are mixed and injected into fresh silkworm eggs by a microinjection method, wherein the specific method is Kanda \65120andTamura (1991). Sealing with nontoxic glue to prevent pollution after injection, incubating in sterile environment at 25 deg.C, feeding newly hatched silkworm, selfing the current generation (G0 generation) of silkworm moth, and screening out red fluorescent individual from the obtained G1 generation of silkworm egg under fluorescent microscope.

Silkworm Nos-Cas9 is a silkworm transgenic activation strain. The transgenic silkworm strain expresses EGFG green fluorescence throughout the body, expresses Cas9 protein in a gonad, and is a parent silkworm for obtaining double-fluorescence silkworms in the future. Constructed according to the literature (Xu, j., chen, s., zeng, b., james, a.a., tan, a.and Huang, y. (2017) Bombyx mobile P-element textual information Inhibitor (mpsi) Is a Key automatic factory for silk work max determination. Plos gene, 13, e 1006576). Firstly, a green fluorescent protein EGFP driven by an IE1 promoter (Kojima et al, virusResearch, 2008) is introduced into a PiggyBac transposon vector to construct a PXL-BacII-IE1-EGFP transgenic vector. Then cloning the promoter of the silkworm Nos gene, the Cas9 gene and the SV40 terminator sequence respectively. The PXL-BacII-IE1-EGFP transgenic vector is inserted once by a homologous recombination method, so that a PXL-BacII-IE1-EGFP-Nos-Cas9-SV40 transgenic plasmid is obtained. Finally, the wild silkworm is injected by a micro-injection method to obtain the transgenic silkworm strain Nos-Cas9. The sequence of the Nos promoter is shown in the patent "Bombyx mori gonad specific expression promoter and its capture method" (patent application No. 201610360601.2, chen Holly plum, etc., 2016). The sequence of the Cas9 gene is shown as SEQ ID NO. 4. The SV40 terminator sequence is shown as SEQ ID NO. 5. Sealing with nontoxic glue to prevent pollution after injection, incubating in sterile environment at 25 deg.C, feeding newly-hatched silkworms, selfing the current generation (G0 generation), and screening green fluorescent individuals from the obtained G1 generation newly-hatched silkworms under a fluorescent microscope.

And then feeding and mating the screened G1 generation red fluorescent individual and the Nos-Cas 9G 1 generation green fluorescent individual, screening double-fluorescent (namely red light and green light) silkworm larvae from the obtained G2 generation silkworm larvae under a fluorescent microscope, extracting a genome from the obtained double-fluorescent silkworm to identify the mutation condition of a target spot, observing the mating reproduction phenomenon after the double-fluorescent silkworm larvae grow to adults, and counting the oviposition condition.

(3) Detection of BmSer2 mutant silkworm

According to the invention, the BmSER2 gene mutation has substantial influence on the hatching rate of male silkworms by verifying the BmSER2 gene mutation of the bifluorescence silkworms and counting the oviposition conditions of the bifluorescence silkworms. Identification of gene mutation conditions: a plurality of bifluorescence silkworms are picked in the newly-hatched silkworm stage to extract genomes, and target fragments are cloned by a PCR method and sequenced. The transgenic individual can be obtained by observing red and green fluorescence to select silkworm eggs with red and green fluorescent protein expression. The different sexes are distinguished through the pupal stage, and whether the male is sterile is determined when the adult flies. The dual-fluorescence silkworm can lay eggs by mating a large number of single-sex dual-fluorescence silkworms with wild silkworms at the ambient temperature of 25 ℃ for 5 hours, then unpairing, laying eggs in the same environment for 36 hours, and counting the egg laying amount.

The invention has the advantages that: the method successfully constructs the silkworm strain with high male sterility on the premise of not influencing normal mating behavior by using the CRISPR/Cas9 technology based on piggyBac transposon for the first time. The obtained transgenic BmSer2 mutant silkworm strain has no obstacle no matter whether the male and female mutant is mated with a wild type in the same environment, the hatching rate of the silkworm eggs taking the female mutant as a parent is normal, but the hatching rate of the silkworm eggs taking the male mutant as a parent is close to 0. In addition, the present invention makes it very easy to obtain mutants. The invention has important value in the aspect of preventing and controlling lepidoptera pests through a male sterility technology.

Primer F1	GAATCGTGGCTCCTGTTGTAAAT
		Primer R1	AGAACAGGTGCTCGGTTTTTGTT
Primer F2	ATATCTCAGGTGCAGATTTTGCG
		Primer R2	TACTCGAATTGGAGCAAGCGAAT
Primer sgRNA-F1	GGATGAACCCAAAATTATGAGTTTTAGAGCTAGAAATAGCAAGTT
		Primer sgRNA-R1	TCATAATTTTGGGTTCATCCACTTGTAGAGCACGATATTTTGTAT
Primer sgRNA-F2	GGCCTTTAAAAGGGTTCTCGGTTTTAGAGCTAGAAATAGCAAGTT
		Primer sgRNA-R2	CGAGAACCCTTTTAAAGGCCACTTGTAGAGCACGATATTTTGTAT
Primer sgRNA-KnpI-F	CTCACTATAGGGCGAATTGGAGGTTATGTAGTACACATTGTTGTA

Sequence listing

Primer sgRNA-HindIII-R	TTTTCTTGTTATAGATATCAAAAAAAGCACCGACTCGGTG
		Primer sgRNA-Overlap-F	GCTAGCCATTGACTCCGCGGAGGTTATGTAGTACACATTGTTGTA
Primer sgRNA-Overlap-R	CCGCGGAGTCAATGGCTAGCAAAAAAGCACCGACTCGGTG
		Primer sgRNA-F3421	GTGGAGCTCCAGCTTTTGTT
Primer sgRNA-R3667	GTGAGTCAAAATGACGCATG

EXAMPLE 1 construction of the vector

1. The BmSer2 knockout plasmid PXL-BacII-IE1-DsRed2-U6-BmSer2sgRNA1-U6-BmSer2sgRNA2 is obtained by cloning through a PCR method. The method comprises the following specific steps:

two pairs of primers, namely, sgRNA-KnpI-F and sgRNA-R1, sgRNA-F1 and sgRNA-Overlap-R, respectively use PXL-BacII-IE1-DsRed2-U6-U6 plasmid as a template to obtain a product through PCR, and then the product takes a volume ratio of 2. Similarly, after products are obtained by taking sgRNA-Overlap-F and sgRNA-R2, sgRNA-F2 and sgRNA-HindIII-R as first round PCR primers, and then a BmSer2sgRNA-2 fragment with a restriction enzyme HindIII homologous arm is obtained by taking sgRNA-Overlap-F and sgRNA-HindIII-R as second round primers through PCR.

Finally, the PXL-BacII-IE1-DsRed2-U6-U6 plasmid was digested with the restriction enzymes Knpi and HindIII. And mixing the enzyme digestion product with a BmSer2RNA-1 fragment with a KnpI homologous arm and a BmSer2RNA-2 fragment with a HindIII homologous arm, respectively inserting the mixture into the downstream of a U6 promoter by a homologous recombination method, sequencing, and obtaining a PXL-BacII-IE1-DsRed2-U6-BmSer2sgRNA1-U6-BmSer2sgRNA2 plasmid after confirming that the insertion is correct. After sequencing was correct, it was purified using the Plasmid Midi kit from Qiagen for use. Thus, a BmSer2 knock-out plasmid PXL-BacII-IE1-DsRed2-U6-BmSer2sgRNA1-U6-BmSer2sgRNA2 is obtained. The PCR reaction system was configured using KOD PLUS Taq enzyme (Takara Bio Inc.) as follows.

The PCR program was set up as follows:

the PCR product was purified using Gel Extraction Kit D2500 Kit and used.

II, enzyme digestion of PXL-BacII-IE1-DsRed2-Real-U6-U6 plasmid. The enzyme digestion system is as follows:

name (R)	Dosage of
		Knpi endonuclease (NEB Co., ltd.)	3μl
HindIII endonuclease (NEB Co., ltd.)	3μl
		PXL-BacII-IE1-DsRed2-U6-U6 plasmid	3μg
Deionized water	～50μl

Enzyme digestion procedure: 37 ℃ overnight (> 8 h).

The cleavage products were purified using Qiagen Plasmid Midi kit.

Insert BmSer2sgRNA-1 and BmSer2sgRNA-2 fragments downstream of the U6 promoter of PXL-BacII-IE1-DsRed2-U6-U6, respectively, using the One Step Cloning Kit. The reaction system is as follows:

reaction procedures are as follows: 30min at 37 ℃; ice-bath for 5min.

And IV, transforming the recombinant plasmid obtained in the step III, plating, and performing colony PCR every other day. The reaction system is the same as the step I. Positive single clones were sequenced. The primers used were: sgRNA-F3421 and sgRNA-R3667.

Sequencing results prove that the BmSer2sgRNA-1 and BmSer2sgRNA-2 fragments are inserted correctly. The Plasmid was purified using the Qiagen Plasmid Midi kit. Thereby obtaining a Ser2 knockout plasmid PXL-BacII-IE1-DsRed2-U6-BmSER2sgRNA1-U6-BmSER2sgRNA2 for subsequent injection.

EXAMPLE 2 obtaining of transgenic silkworms

The Ser2 knock-out plasmid PXL-BacII-IE1-DsRed2-U6-BmSer2sgRNA1-U6-BmSer2sgRNA2 prepared in example 1 and plasmid PHA3PIG capable of expressing Piggybab transposase are mixed in equal amount and injected into the initial egg laying of the silkworm. The injection method was performed by microinjection according to the method described by Kanda \65120Tamura (1991). Sealing the injection with nontoxic glue to prevent pollution, incubating in sterile environment at 25 deg.C, feeding newly-hatched silkworms, selfing the current generation (G0 generation) of silkworms after moth transformation to obtain G1 generation of newly-hatched silkworms, and screening out transgenic silkworm individuals (i.e. BmSer2 mutant intermediate strain) with red fluorescence under a fluorescence microscope.

Subsequently, the screened red fluorescent transgenic silkworm and the green fluorescent transgenic silkworm Nos-Cas9 are bred and mated, the obtained G2 generation of ant silkworms are screened for double-fluorescent (namely red light and green light) ant silkworms (namely BmSer2 mutant strains) under a fluorescent microscope, the obtained double-fluorescent silkworm extracts genome to identify the target point mutation condition, and the conditions of egg laying and hatching rate are observed and counted (see figure 2).

Example 3 detection of transgenic silkworms

Identification of the mutation situation of the gene: in the stage of raising ant silkworms, 10 double-fluorescence silkworms are picked to extract the genome thereof, and target fragments are cloned and sequenced by a PCR method by using primers F1 and R1, F2 and R2. Sequencing results show that the sequences of the target point 1 and the target point 2 in the BmSer2 gene in the bifluorescent silkworm body are mutated.

Situation of double-fluorescent silkworm laying: 30 single-sex bifluorescent silkworms and wild silkworms were mated at an ambient temperature of 25 ℃ for 5 hours, and then laid for 36 hours in the same environment, and the egg laying amount and the hatching rate were counted, see fig. 2. Therefore, the hatchability of eggs laid by female silkworms and normal male silkworms with mutation (i.e. double fluorescence) generated by BmSer2 is normal; the hatchability of eggs laid by male silkworms with mutant (i.e. bifluorescence) generated by BmSer2 and normal female silkworms approaches 0, and the hatchability of eggs laid by mating mutant female silkworms and male silkworms approaches 0. As described above, bmSer2 produces mutant (i.e., bifluorescent) male silkworm sterility (fig. 2).

When the wild female and male insects are mated (WT female parent and WT female parent) to produce eggs, the wild female and male insects can develop; mating the wild female with the mutant male (delta Ser2 female parent multiplied by WT female parent) to produce eggs which do not develop; eggs produced by mating wild male worms and mutated female worms (WT (female parent and delta Ser 2) can develop; the eggs produced by the mating of the mutated female and male insects (delta Ser2 female parent and delta Ser2 female parent) do not develop. The result shows that the male mutant is sterile, the system is stably inherited to the offspring through the fertility of the female mutant, and the male mutant in the offspring can be sterile, so that the quantity controllability is achieved.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes or modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the appended claims of the present application.

Claims (9)

1. A method of making a male sterile lepidopteran insect comprising the steps of:

1) Constructing a Ser2 gene knockout nucleic acid construct comprising the following operably linked elements from the 5 'end to the 3' end: a first sgRNA expression element and a second sgRNA expression element; the first sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a first Ser2 gene target and polyA; the second sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a second Ser2 gene target and polyA;

2) Co-transforming the Ser2 gene knockout nucleic acid construct in the step 1) and PHA3PIG plasmid capable of expressing Piggybab transposase into lepidoptera fresh insect eggs, incubating and dissolving moths to obtain G0 generation, and selfing the G0 generation to obtain G1 generation; and

3) Mating the G1 generation described in the step 2) with a transgenic lepidoptera insect expressing Cas9 protein to obtain a G2 generation, namely obtaining a male sterile lepidoptera insect which is a silkworm.

2. The method according to claim 1, wherein the nucleotide sequence of the first Ser2 gene target is shown as SEQ ID No. 1, and the nucleotide sequence of the second Ser2 gene target is shown as SEQ ID No. 2.

3. The method of claim 1, wherein the Ser2 knock-out nucleic acid construct further comprises a first selectable marker gene expression cassette.

4. The method of claim 3, wherein the first selectable marker gene is a red fluorescent protein gene.

5. The method of claim 1, wherein the transgenic lepidopteran insect expressing a Cas9 protein comprises a Cas9 gene expression cassette comprising the following operably linked elements from the 5 'end to the 3' end: nos promoter, cas9 protein coding sequence, and SV40 terminator.

6. The method of claim 5, wherein the transgenic lepidopteran insect expressing a Cas9 protein further comprises a second selectable marker gene expression cassette.

7. The method of claim 1, wherein said co-transformation is microinjection of fresh insect eggs into a mixture of said Ser2 knock-out nucleic acid construct and a PHA3PIG plasmid expressing Piggybac transposase.

8. A Ser2 knock-out nucleic acid construct comprising the following operably linked elements from the 5 'end to the 3' end: a first sgRNA expression element and a second sgRNA expression element; the first sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a first Ser2 gene target and polyA; the second sgRNA expression element comprises the following operably linked elements from the 5 'end to the 3' end: a U6 promoter, a second Ser2 gene target and polyA; the nucleotide sequence of the first Ser2 gene target point is shown as SEQ ID NO. 1, and the nucleotide sequence of the second Ser2 gene target point is shown as SEQ ID NO. 2.

9. A method of controlling lepidopteran pests comprising the steps of: male sterile lepidopteran insects produced according to the method of claim 1 are released from the field and mated with wild lepidopteran insects to reduce progeny and reduce population size.

Images