CN108902169B - Application of lepidoptera insect tyrosine protein kinase in pest control - Google Patents

Abstract

The invention discloses application of lepidoptera tyrosine protein kinase in pest control, which can increase the susceptibility of a lepidoptera Abl to germs after the lepidoptera Abl is inhibited and expressed, silkworms are more easily infected with green head septicemia and prodigious fungus septicemia, and the survived mutant enters five-year-old and wandering periods in advance relative to wild type, and the pupa weight and the cocoon weight are obviously reduced, and the hatching rate is also obviously reduced. If the expression of the Abl of the lepidoptera insect is inhibited, the purpose of pest control can be realized. Theoretically, if the Abl gene is over-expressed, the properties such as silk protein yield and productivity are obviously improved.

Description

Application of lepidoptera insect tyrosine protein kinase in pest control

Technical Field

The invention relates to application of lepidoptera insect tyrosine protein kinase in pest control.

Background

Lepidoptera includes two kinds of insects, i.e., moth and butterfly, and belongs to the subclass pteroidea and holomorphia. About 20 thousands of species are known worldwide, and about 8000 more species are known in china. This order is the 2 nd largest order of the Insecta, second only to the Coleoptera. The distribution range is very wide, and the tropical varieties are most abundant. Most kinds of larvae are harmful to various cultivated plants, and those with larger body form usually eat leaves or bore branches completely. Smaller patients tend to suffer from leaf curl, leaf ornamentation, scabbling, silking and netting, or food intake by digging into plant tissues.

Silkworm (Bombyx mori) is a lepidopteran seriator insect using mulberry leaves as food, and the silkworm passes through 4 morphological and physiological different development stages of eggs, larvae, pupae and imagoes in the whole life.

Abl is a non-receptor tyrosine protein kinase, which was discovered by the analysis of the re-sequencing data of silkworms and wild silkworms of various representative strains. In vertebrates, it has been found through investigations that the loss of Abl impairs the development and responsiveness of T-and B-cells. However, the function of Abl in silkworms is poorly understood.

The CRISPR-Cas 9 system is a new technology which can accurately edit genome DNA at fixed points after Zinc Finger Nucleases (ZFNs) and TALEN nucleases, and is applied to accurate modification and fixed point mutation of genomes of animals such as mice, rats, silkworms and the like and plants such as arabidopsis thaliana, rice and the like. Therefore, the accurate fixed-point editing is carried out on the Abl gene of the silkworm by adopting a CRISPR-Cas 9 mediated genome editing technology, and the function of the Abl in the silkworm is researched.

Disclosure of Invention

The invention aims to provide application of lepidoptera insect tyrosine protein kinase in pest control.

The technical scheme adopted by the invention is as follows:

an application of a lepidoptera insect tyrosine protein kinase gene Abl as a pest control target.

An application of an inhibitor for expressing and/or inhibiting lepidoptera insect tyrosine protein kinase gene Abl in preparing a medicament for preventing and treating insect pests.

The application of an inhibitor for inhibiting the expression and/or activity of an Abl gene of a lepidoptera insect tyrosine protein kinase in inhibiting the egg laying of an insect body.

Further, the lepidopteran insect is a silkworm.

Further, the tyrosine protein kinase gene Abl expression inhibitor is sgRNA inhibiting the expression of the gene Abl.

Further, the sgRNA functions as GGGGATCGTCCTCTTCGTGATGG.

The invention has the beneficial effects that:

the lepidoptera insect Abl is inhibited and expressed to increase the susceptibility of the insect body to pathogenic bacteria, the silkworms are more easily infected with green head septicemia and prodigiosin septicemia, the survived mutants enter five-year-old and wandering periods in advance relative to wild type, the pupa weight and the cocoon weight are obviously reduced, and the hatching rate is also obviously reduced. If the expression of the Abl of the lepidoptera insect is inhibited, the purpose of pest control can be realized. Theoretically, if the Abl gene is over-expressed, the properties such as silk protein yield and productivity are obviously improved.

Drawings

FIG. 1 is target site selection for CRISPR/Cas9 system knock-out of Abl gene;

FIG. 2 is a diagram showing incubation conditions after knocking out an Abl gene by silkworm egg microinjection;

FIG. 3 shows the suppressed expression of Abl (Abl)^-) Compared with wild type, the polypide of the Chinese caterpillar fungus is more easily infected with the septicemia adolescens and the septicemia linguistici;

FIG. 4 shows the suppressed expression of Abl (Abl)^-) The larval stage of the worm body is shorter than that of the wild type, and in the figure, Mutant 1-3 represents an Abl inhibited expression body (Abl)^-) Wild 1-3 represents a Wild type;

FIG. 5 shows that the expression of Abl is suppressed (Abl)^-) The silkworm pupa phenotype of (a);

FIG. 6 shows that the expression of Abl is suppressed (Abl)^-) The weight of the silkworm chrysalis is obviously reduced (N is 80, mean + -SD), and the silkworm chrysalis is more concentrated; mutant representation of Abl^-；

FIG. 7 shows that the expression of Abl is suppressed (Abl)^-) Silkworm cocoon phenotype of (a);

FIG. 8 inhibited expression of Abl (Abl)^-) The total weight of the silkworm cocoons is obviously reduced (mean + -SD) and is more concentrated;

FIG. 9 inhibited expression of Abl (Abl)^-) The weight of the silkworm cocoon layer is obviously reduced (mean + -SD) and is more concentrated;

FIG. 10 inhibition of Abl expression (Abl)^-) The hatching rate of the silkworms is obviously reduced.

Detailed Description

The present invention will be further described with reference to the following examples.

Example 1 phenotype of silkworm Gene Abl expression inhibition

Knocking out silkworm tyrosine protein kinase (Abl) gene by CRISPR/Cas9 system

(1) Selection of target sites

The CDS sequence of the Abl gene (SEQ ID NO: 1) is 3747bp in total, and the specific sequence is as follows:

ATGGGCGCGCAGCAGGCCAAAGAACGCGGCACCGCCAGCGGCGCGTCCATGCGTTCGGCGCGCAGCAAGCCACGGGTGCCGAAGGACCCCCGCATGCTCGGCTCCAACATATTCACTGAACATAGCGAGGCGCTGCTGCAGAGCCGACCGCTGCCGCACATCCCAGACCTGCCCGACGAGGCCGCCGCGCCACCCGCTCCGCTGCCGCTCGACTCCGCTAACAGATGGACCTCGAAGGAGAATCTTTTGGCCCATCACGAAGAGGACGATCCCCAGCTGTTCGTAGCCCTCTACGATTTCCAGGCGGGAGGGGAGAACCAGCTCACGCTCAAGAAAGGCGAGCAGGTGCGCATCATGAGCTACAACAAGAGCGGCGAGTGGTGCGAAGCCCACACGCTGACTGGGGCCGTGGGCTGGGTGCCCAGCAACTACGTCACTCCAGTCAACAGTCTCGAGAAGCATTCATGGTACCATGGGCCGATTTCCCGCAACGCGGCGGAGTACCTCCTCTCGTCTGGGATCAATGGCAGCTTCCTGGTCCGCGAATCGGAATCGAGTCCTGGGCAACGCAGCATATCCCTCCGCTACGAAGGGAGAGTTTACCACTACCGCATCAACGAAGACGCCGATGGGAAGGTTTATGTGACCTCCGAGTCGAAGTTCGGAACGTTAGCGGAGCTGGTCCACCATCACTCGGTGGCGGGGGACGGTCTAATTACGCAGCTGCTGTATCCAGCACCGAAGCGCTCGAAGCCTACAGTGTTCCCCCTGGCTCCCCCCGACCACTGGGAGATCGATCGCACGGACATAGTGATGAAGCACAAGCTGGGCGGCGGCCAGTATGGAGACGTTTACGAAGCCGCTTGGAAGCGCGGCAACATCACGGTGGCGGTCAAAACACTCAAGGACGATACGATGGCGCTCAAGGATTTCCTGGAGGAAGCCTCCATAATGAAAGAGATGCGACACCCGAACCTGGTGCAGCTGCTCGGCGTGTGCACACGCGAGCCCCCGTTCTATATTATTACGGAGTTTATGTCCCGCGGAAACCTGCTGGAGTACCTGCGGGCGGGGGCGAGGGAGTGCGTGCCGGGCGCGGTCGTGCTCATGTACATGGCGACGCAGATAGCGTCCGGCATGAGCTACCTCGAGAGCCGCTCCTTCATCCACCGCGACCTCGCCGCCAGGAACTGCCTCGTGGGGGAGAACCATCTGGTCAAGGTGGCCGACTTCGGACTGGCTCGCCTGATGCGCGACGACACATACACGGCCCACGCCGGCGCCAAGTTCCCGATCAAGTGGACGGCGCCGGAGGGTCTGGCCTACAACACTTTCAGCACCAAATCGGATGTCTGGGCTTTCGGGATCCTGCTGTGGGAGATCGCCACGTACGGGATGTCTCCTTACCCCGGAGTGGATCTCGCGGACGTTTACCACATGCTTGAGAAGGGGTACCGCATGGAGTGTCCCCCGGGCTGCCCGGCGCCCGTCTACGAGCTCATGCGCGGCTGCTGGCAGTGGAGCCCCTCCGAGCGGCCCTCCTTCCGCGAGATACACCACGCGCTCGAGCACATGTTCCAGGACAACTCGATCACAGACGAAGTAGAGAAACAACTCCAAGAAGGCAGCGGCGCGCAGGCCGCCGGCACCCCGCTGCTGTCGCTGAAGAAGACGAGCGCCGACCCTCGAGCGGTGCAGATGCGGCGCCCGACCAACCGCCGCGGCAAGCAAGCCCCCACCCCTCCCAAACGCACTAGCCTGCTGTCCTCGTGCAGCTCCTTCCGCGAGTCGCAGTACGCCGCCGACGAGCACGCGCCCGACGACGCGCCCGCCGACGCGCTCGCCGACCTCAACGGAGGCGGGGGCCGCGGCGGGGCGGGGGCGGGGGCTGCGTCCTCAGAGGGGTCGCTGGCCGAGGCGACGCCCGACACCGACGAGTCCGCCGGCACCGAGCATCGGCATCGCCCCAAGCGACGTCATCACCATCCCCACCATCACCACAACGAGCCGCCCGCGAAGCAAGGCGTCCAAGTTGCCGCGCTCGAAGTGCAAAATGTCAAGCGAGCAATCAACAGATATGGGACGCTACCTAAAGGCGCACGTATCGGTGCTTTCTTGGAGTCCCTTCGCCAGAGTGGCGGTGGAGCGACGGCCGGAGCACCTGCCCGCGAGAGCTCCGCCCCCTCGTCTGAGGAGGCAAGGTCTCTGTCCCCGCGTACTGCGCGTGCCCAGCCACACATGATCCGGTCCAACTCCTCGGGCGGAGTGACGGCACCCTCGCCTGCCTCCCCGCGCGCCTCCCGTGCCACCCCTCAGCTGCGATCGTTTACCGGCAGCCCTGCTAAGCCTCGTCCGCGCATAGCGGAGTTGGAATTCCCGCCTCCACCGCCAGACCTACCGCCTCCCCCTGAAGACACCCAACCTCCACCTCCACCTCCGCCGCCGCCCCCCGCAGACCCCGCCGACTCGATCCTCGACCCTCCGCCCCCACTACTCGATAGTCATTTCGACTTCAATGAAAAACCCGCTAAACAAACAATGAAAGAAATGTTAGAGTTAAAACTCGTCGCAGAGATAAAGGAAAGAGCCGATAAAAAGAAGCAAAAGCTAAAAGAATCGCCTCCGTTCGAGGAACAAAATGTAGATTCGCAGCCTTCGTTCGGAGACCCTGTCACCAGATTAGTCTCTGAACTTTCAGAGAGCTTAAATATGGAAGCACTTCGTCGCGTCGATCGCAAACTTGATTCGGCAAAGACAGAAGACGGGAAGGAATCTGTGTCGCCGATTGACTTAAAGGCGAGCTTAAGAAAAACTGCGTACGGTAATAATGCAGAACAGAAAAGATCAGACGCGGAATCCAAAGTGGGTACCGATTTTAAATCGCAATTGAAGAAAGTAGAAGCCAACAAGAAGACTTCCGGAACAAACAAAGAACAAGAGGAGGGCGGTCGTCCGATCATCGACTTTAAGTCCCGTCTACGTAAGGTGGACAGCGGCGCGAATGTTACGAACGGAGCCAAGAAGTTCGAACAGACCTCACCAGATGAGAAAGAAGCTATCAAAAAAGACATTTCAAAGACAGAAGAACTCGACAGGTATCGATCAGAAAGTGGATCTTTGGACACGAGCGGCGGAGACGAGGAAGACAAGCGTCGGAGCACCGGCAGCATCAGTAGCCTAAAGAAACTGTGGGAGAGCAAAGAAACCGAAGAGAGACTCAGTCCCAAGATGAGAGCGCGAGACAACGAGTCCGACGAGGTCTCCCCTGAGGAACGATCCTGCGCGGCGAGGGGCGCGGGGCGGCGCGACGACAAGCCCAGCGTACCCAGCAAGCCCGTCGGGGTGCGGAAGCCGAGCAAGGGCGGTATCTACGCCAGCCCGCAAGTGGGCCCCGAGGAGGCGGAGAGCGGCGCCGCGCTGCGGGAGGTGCGCGGCGCGCTGGAGGCGTGCACGCGGTCCGTGCGGCGCGGCGGGGGGCGCGGCTCGCTGTGGCGGCTGCAGAGCTCGGAGCGGCTGGCGCGGCTCGGCGGGGTGTGCGGGGCGGCGGCCACCGCGTGCTCGCCACACGTGCGCGTGCAGCTGCGGGCCGCCGCCGCGCGACTGGAGGCGCAGGCGCGGGCGCTCGCCTCGCCCGCACCGCACACCCACCACCTCGCCGACGCCGTCGACCACGCGCTGCGGGACCTCGCCGACGTACTCAACCGGTGCTCCTCTTCTTCCTCTCACCCCACCAACAACATCCCGTAA(SEQ ID NO：1)。

selecting a proper site according to the CDS sequence of the Abl gene by the selection principle of GG (19N) GG; after target selection, which is confirmed to be in one exon (see FIG. 1), the sgRNA in this application functions as the target sequence GGGGATCGTCCTCTTCGTGATGG (SEQ ID NO: 2), and the GC content of the whole target should be controlled to 50% -60%.

(2) Amplification of transcription templates

1. Designing a primer:

a forward primer F:

TAATACGACTCACTATAGGGGATCGTCCTCTTCGTGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC(SEQ ID NO：3)

reverse primer R:

AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAA(SEQ ID NO：4)

2. amplification of template Abl

Reaction system:

reaction procedure: 95 deg.C for 2 min; 95 ℃, 10s, 55 ℃, 30s, 72 ℃, 33s, 30 cycles; 72 deg.C, 10 min.

3. Positive plasmid construction

Recovering the target DNA fragment from the PCR product, and connecting the target DNA fragment into a PMD-18T vector by the following connection system:

and transforming the connected carrier into competent cells, culturing and screening positive colonies, carrying out colony PCR detection and sequencing verification on the positive colonies, and verifying that the correct colonies are the required positive colonies.

The primers used for colony PCR detection are PMD-T-F and R20, the size of a PCR product is about 530bp, and the specific sequences of the colony PCR detection primers are as follows:

PMD-T-F:CGGTGATGACGGTGAAAACCTC(SEQ ID NO：5)，

R20:AAGCACCGACTCGGTGCC(SEQ ID NO：6)。

4. amplification of transcription templates

Using the positive colony plasmid as template, amplifying the transcription template by primer

Kit instructions for operation), the reaction system is as follows:

reaction procedure: 95 deg.C for 2 min; 95 ℃, 10s, 55 ℃, 30s, 72 ℃, 30s, 34 cycles; 72 deg.C, 10 min.

(3) sgRNA synthesis

The nucleotides were placed on ice and the 10 × Reaction Buffer was placed at room temperature. (

Kit) reference

The Kit instructions were used to perform sgRNA synthesis.

4, reaction system:

add Nuclean-free Water to 10. mu.l.

Reaction procedure: water bath at 37 ℃ overnight (about 16 h).

And (3) filling 10ul of reaction solution to 300-400 ul by using RNA free water, adding isovolume phenol, chloroform and isoamylol to purify the sgRNA, and setting the final concentration to 500-1000 ng/ul after purification, wherein the final injection concentration is determined according to the requirement of the user.

(4) Abl gene knockout by silkworm egg microinjection

Silkworm eggs are placed on glue-coated silkworm egg paper for spawning in advance, then the silkworm eggs are placed in sterile double-distilled water, soaked for five to ten minutes until the silkworm eggs can be easily swept down by a collinear pen, then washed for 3 times by clear water, then the silkworm eggs are placed in order according to the rule that the thicker side faces the injection side, dried and stained with glue for secondary fixation, and then the mixed Cas9 protein and sgRNA mixture (the concentration of the sgRNA is about 500ng/ul, the concentration of the Cas 9-mRNA is about 300ng/ul) is subjected to microinjection by a double-needle injection system of a microinjection instrument after the drying is carried out, so that 320 silkworm eggs are totally injected, 281 silkworm eggs are hatched, and the hatching rate is 87.8% (table 1 and figure 2).

TABLE 1 statistics of silkworm egg microinjection knock-out of Abl Gene

The marked developmental unhatched positivity means that some silkworms successfully developed the shape of silkworms but failed to successfully hatch or break shells after injection.

Secondly, phenotype of silkworm gene Abl inhibited expression (by sgRNA knockout)

(1) Susceptible to infection of pathogenic bacteria

Observing the phenotype of silkworm after injecting the knock-out gene Abl, finding that the body of the silkworm with suppressed Abl expression is easily infected and infected by germ in the feeding process, as shown in figure 3, the Abl is suppressed and expressed (Abl)^-) Compared with wild type, the worm body of the Chinese caterpillar fungus is easy to infect the septicemia of the green head, the ganoderma lucidum septicemia and the like.

(2) The larval stage becomes short

The Abl is inhibited from expression compared to wild type (Abl)^-) The worm body of (A) enters the 5-year-old and migratory phase earlier, and thus the Abl is inhibited from being expressed (Abl)^-) The larval stage of the worm was shorter than the wild type, indicating a shorter feeding time for the larvae (fig. 4).

(3) Decrease of pupa weight

Abl is inhibited in expression compared to wild type, whether male or female (Abl)^-) The weight of the silkworm pupae is obviously reduced (figure 5 and figure 6).

(4) Decrease of cocoon weight

Abl is inhibited in expression compared to wild type, whether male or female (Abl)^-) The weight of the silkworm whole cocoons and the weight of the cocoon shells are obviously reduced (figure 7, figure 8 and figure 9).

(5) Decreased hatching rate

The Abl is inhibited from expression compared to wild type (Abl)^-) The hatching rate of silkworms was remarkably decreased, as shown in Table 2 and FIG. 10.

TABLE 2 inhibited expression of Abl (Abl)^-) Comparison of oviposition and hatchability between the bodies and the wild type

The above results demonstrate that inhibition of the expression of the Abl of lepidopteran insects can affect the growth of the insect bodies, reduce the feeding time of larvae, reduce the weight of silkworm pupae, reduce the weight of cocoons, simultaneously reduce the hatching rate and increase the susceptibility of the insect bodies to pathogenic bacteria. If the expression of the Abl of the lepidoptera insect is inhibited, the purpose of pest control can be achieved. Theoretically, if the Abl gene is over-expressed, the properties such as silk protein yield and productivity are obviously improved.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> university of south China

Application of lepidoptera insect tyrosine protein kinase in pest control

<130>

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 3747

<212> DNA

<213> Artificial sequence

<400> 1

atgggcgcgc agcaggccaa agaacgcggc accgccagcg gcgcgtccat gcgttcggcg 60

cgcagcaagc cacgggtgcc gaaggacccc cgcatgctcg gctccaacat attcactgaa 120

catagcgagg cgctgctgca gagccgaccg ctgccgcaca tcccagacct gcccgacgag 180

gccgccgcgc cacccgctcc gctgccgctc gactccgcta acagatggac ctcgaaggag 240

aatcttttgg cccatcacga agaggacgat ccccagctgt tcgtagccct ctacgatttc 300

caggcgggag gggagaacca gctcacgctc aagaaaggcg agcaggtgcg catcatgagc 360

tacaacaaga gcggcgagtg gtgcgaagcc cacacgctga ctggggccgt gggctgggtg 420

cccagcaact acgtcactcc agtcaacagt ctcgagaagc attcatggta ccatgggccg 480

atttcccgca acgcggcgga gtacctcctc tcgtctggga tcaatggcag cttcctggtc 540

cgcgaatcgg aatcgagtcc tgggcaacgc agcatatccc tccgctacga agggagagtt 600

taccactacc gcatcaacga agacgccgat gggaaggttt atgtgacctc cgagtcgaag 660

ttcggaacgt tagcggagct ggtccaccat cactcggtgg cgggggacgg tctaattacg 720

cagctgctgt atccagcacc gaagcgctcg aagcctacag tgttccccct ggctcccccc 780

gaccactggg agatcgatcg cacggacata gtgatgaagc acaagctggg cggcggccag 840

tatggagacg tttacgaagc cgcttggaag cgcggcaaca tcacggtggc ggtcaaaaca 900

ctcaaggacg atacgatggc gctcaaggat ttcctggagg aagcctccat aatgaaagag 960

atgcgacacc cgaacctggt gcagctgctc ggcgtgtgca cacgcgagcc cccgttctat 1020

attattacgg agtttatgtc ccgcggaaac ctgctggagt acctgcgggc gggggcgagg 1080

gagtgcgtgc cgggcgcggt cgtgctcatg tacatggcga cgcagatagc gtccggcatg 1140

agctacctcg agagccgctc cttcatccac cgcgacctcg ccgccaggaa ctgcctcgtg 1200

ggggagaacc atctggtcaa ggtggccgac ttcggactgg ctcgcctgat gcgcgacgac 1260

acatacacgg cccacgccgg cgccaagttc ccgatcaagt ggacggcgcc ggagggtctg 1320

gcctacaaca ctttcagcac caaatcggat gtctgggctt tcgggatcct gctgtgggag 1380

atcgccacgt acgggatgtc tccttacccc ggagtggatc tcgcggacgt ttaccacatg 1440

cttgagaagg ggtaccgcat ggagtgtccc ccgggctgcc cggcgcccgt ctacgagctc 1500

atgcgcggct gctggcagtg gagcccctcc gagcggccct ccttccgcga gatacaccac 1560

gcgctcgagc acatgttcca ggacaactcg atcacagacg aagtagagaa acaactccaa 1620

gaaggcagcg gcgcgcaggc cgccggcacc ccgctgctgt cgctgaagaa gacgagcgcc 1680

gaccctcgag cggtgcagat gcggcgcccg accaaccgcc gcggcaagca agcccccacc 1740

cctcccaaac gcactagcct gctgtcctcg tgcagctcct tccgcgagtc gcagtacgcc 1800

gccgacgagc acgcgcccga cgacgcgccc gccgacgcgc tcgccgacct caacggaggc 1860

gggggccgcg gcggggcggg ggcgggggct gcgtcctcag aggggtcgct ggccgaggcg 1920

acgcccgaca ccgacgagtc cgccggcacc gagcatcggc atcgccccaa gcgacgtcat 1980

caccatcccc accatcacca caacgagccg cccgcgaagc aaggcgtcca agttgccgcg 2040

ctcgaagtgc aaaatgtcaa gcgagcaatc aacagatatg ggacgctacc taaaggcgca 2100

cgtatcggtg ctttcttgga gtcccttcgc cagagtggcg gtggagcgac ggccggagca 2160

cctgcccgcg agagctccgc cccctcgtct gaggaggcaa ggtctctgtc cccgcgtact 2220

gcgcgtgccc agccacacat gatccggtcc aactcctcgg gcggagtgac ggcaccctcg 2280

cctgcctccc cgcgcgcctc ccgtgccacc cctcagctgc gatcgtttac cggcagccct 2340

gctaagcctc gtccgcgcat agcggagttg gaattcccgc ctccaccgcc agacctaccg 2400

cctccccctg aagacaccca acctccacct ccacctccgc cgccgccccc cgcagacccc 2460

gccgactcga tcctcgaccc tccgccccca ctactcgata gtcatttcga cttcaatgaa 2520

aaacccgcta aacaaacaat gaaagaaatg ttagagttaa aactcgtcgc agagataaag 2580

gaaagagccg ataaaaagaa gcaaaagcta aaagaatcgc ctccgttcga ggaacaaaat 2640

gtagattcgc agccttcgtt cggagaccct gtcaccagat tagtctctga actttcagag 2700

agcttaaata tggaagcact tcgtcgcgtc gatcgcaaac ttgattcggc aaagacagaa 2760

gacgggaagg aatctgtgtc gccgattgac ttaaaggcga gcttaagaaa aactgcgtac 2820

ggtaataatg cagaacagaa aagatcagac gcggaatcca aagtgggtac cgattttaaa 2880

tcgcaattga agaaagtaga agccaacaag aagacttccg gaacaaacaa agaacaagag 2940

gagggcggtc gtccgatcat cgactttaag tcccgtctac gtaaggtgga cagcggcgcg 3000

aatgttacga acggagccaa gaagttcgaa cagacctcac cagatgagaa agaagctatc 3060

aaaaaagaca tttcaaagac agaagaactc gacaggtatc gatcagaaag tggatctttg 3120

gacacgagcg gcggagacga ggaagacaag cgtcggagca ccggcagcat cagtagccta 3180

aagaaactgt gggagagcaa agaaaccgaa gagagactca gtcccaagat gagagcgcga 3240

gacaacgagt ccgacgaggt ctcccctgag gaacgatcct gcgcggcgag gggcgcgggg 3300

cggcgcgacg acaagcccag cgtacccagc aagcccgtcg gggtgcggaa gccgagcaag 3360

ggcggtatct acgccagccc gcaagtgggc cccgaggagg cggagagcgg cgccgcgctg 3420

cgggaggtgc gcggcgcgct ggaggcgtgc acgcggtccg tgcggcgcgg cggggggcgc 3480

ggctcgctgt ggcggctgca gagctcggag cggctggcgc ggctcggcgg ggtgtgcggg 3540

gcggcggcca ccgcgtgctc gccacacgtg cgcgtgcagc tgcgggccgc cgccgcgcga 3600

ctggaggcgc aggcgcgggc gctcgcctcg cccgcaccgc acacccacca cctcgccgac 3660

gccgtcgacc acgcgctgcg ggacctcgcc gacgtactca accggtgctc ctcttcttcc 3720

tctcacccca ccaacaacat cccgtaa 3747

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence

<400> 2

ggggatcgtc ctcttcgtga tgg 23

<210> 3

<211> 78

<212> DNA

<213> Artificial sequence

<400> 3

taatacgact cactataggg gatcgtcctc ttcgtgagtt ttagagctag aaatagcaag 60

ttaaaataag gctagtcc 78

<210> 4

<211> 79

<212> DNA

<213> Artificial sequence

<400> 4

aaaagcaccg actcggtgcc actttttcaa gttgataacg gactagcctt attttaactt 60

gctatttcta gctctaaaa 79

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence

<400> 5

cggtgatgac ggtgaaaacc tc 22

<210> 6

<211> 18

<212> DNA

<213> Artificial sequence

<400> 6

aagcaccgac tcggtgcc 18

Claims (3)

1.AblExpression inhibitor and/or activity inhibitor for increasing infection rate of silkworm pathogenic bacteria, shortening silkworm larva stage, and reducing silkworm pupa weight and cocoon weightThe application in the hatching rate is characterized in that: the above-mentionedAblThe CDS sequence of the gene is shown as SEQ ID NO: 1 is shown.

2. Use according to claim 1, characterized in that: the above-mentionedAblThe expression inhibitor is a suppressor geneAblExpressed sgRNA.

3. Use according to claim 2, characterized in that: the sgRNA target sequence for action is GGGGATCGTCCTCTTCGTGATGG.

Images