CN104673815B - Compound piggyBac recombinant vectors and its preparation method and application - Google Patents
Compound piggyBac recombinant vectors and its preparation method and application Download PDFInfo
- Publication number
- CN104673815B CN104673815B CN201510055652.XA CN201510055652A CN104673815B CN 104673815 B CN104673815 B CN 104673815B CN 201510055652 A CN201510055652 A CN 201510055652A CN 104673815 B CN104673815 B CN 104673815B
- Authority
- CN
- China
- Prior art keywords
- silkworm
- piggybac
- attp
- sequence
- transgenic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of compound piggyBac recombinant vectors and its preparation method and application, the recombinant vector inserts destination gene expression frame between wild type piggyBac transposon arm R1 and L1, riddled basins expression cassette I and II, the piggyBac transposases expression cassette and truncated-type piggyBac transposon arm L2 and R2 regulated and controled by heat-inducible promoter, can easily mediate target gene together with riddled basins and piggyBac transposase expression cassette sequences silkworm genome integration, set up and screen the transgenic bombyx mori system of target gene high efficient expression, then piggyBac transposases are induced to be expressed in transgenic bombyx mori body by Heat thermostability, complete deletion of all transposon sequence and riddled basins sequences in progeny transgenic domestic silkworm gene group can be achieved, the remaining destination gene expression frame by the grappling of attP sites can conveniently realize the replacement of other foreign genes and the target gene by the integrase mediated cassete exchange reactions of phiC31, and then realize site-directed integration of other foreign genes in the genomic locus.
Description
Technical field
The invention belongs to biological technical field, it is related to a kind of piggyBac recombinant vectors and preparation method thereof, further relates to this
Application of the recombinant vector in stable, replaceable type high-efficient transgenic silkworm expression system is prepared.
Background technology
Mediated in Drosophila melanogaster since realizing insect genetic transformation report, be based on using the P factors from nineteen eighty-two first case
The genetic transformation system of transposons be widely used at past more than 30 years the bases of insect and other invertebrates with
Application study.Wherein, it is most widely used and is derived from cabbage looper (Trichoplusia ni) with ripe Transposon System
PiggyBac transposon.PiggyBac is a kind of typical II types Transposon System, and its interior zone sequential coding 1 contains
The transposase of 594 amino acid.The transposase may act on the inverted terminal repeat sequence at piggyBac transposon two ends
(Terminal inverted repeat, TIR) and its DNA sequence dna closed on, and then piggyBac transposon is mediated from original position
Point excision, is then integrated into a new host genome site containing conservative " TTAA " sequence.PiggyBac transposon
One the disadvantage is that, its mediate foreign gene is different in the insertion position of host chromosome or insertion copy number, can cause outer
The expression of source gene is influenceed by position effect, and may cause the mutant inactive of gene contained by host itself, that is, exists
Insertion mutation phenomenon.And utilize locus specificity restructuring (Site-specific recombination, SSR) technology then can
The position effect for effectively overcoming transposon-mediated foreign gene to be integrated in genome random integration without targeting and easily
The shortcomings of should influenceing.
Site-specific recombination is to realize that gene site-directed insertion knocks out one of maximally effective means with fixed point at present.Its
As the gene functional research and the method system of genetic modification of one highly effective, high targeting, it has been widely used in
The various modes such as arabidopsis, mouse, drosophila are biological, are increasingly becoming genetically modified animals and plants research field and carry out the strong of genetic manipulation
Powerful.Site-specific recombination system the most frequently used at present includes FLP/FRT, Cre/loxP and phiC31/att system
Deng.Streptomyces Phage phiC31 integrases recombinate the member of enzyme family as serine, can be catalyzed bacterial attachment site (attB
Site) effective one-way restructuring occurs between phage attachment site (attP sites).AttB sites and attP sites are most
Small length is respectively 34bp and 39bp, and it is not homotactic heavy that attB sites and attP sites produce attL and attR 2 after recombinating
Group site.In the case of no co-factor, between attL and attR sites can not be mediated again restructuring occurs for phiC31 integrases instead
Should.The characteristics of this irreversible restructuring and shorter recombination site, has attracted many researchers further to study phiC31 integration
Potential using value of the enzyme in higher eucaryote genetic engineering.
Silkworm is that current human beings worldwide utilizes to obtain one of most successful and most long economic insects, is quite weighed as a kind of
The Lepidoptera model organism wanted, important value and meaning with further investigation.With domestic silkworm gene framing figure, fine figure and
The completion of genetic mutation collection of illustrative plates, domestic silkworm gene group research has stepped into functional genome's epoch.Based on piggyBac transposon
System sets up transgenic bombyx mori to carry out the functional study of gene, has become current silkworm functional gene research field most important
One of technological means.Silkworm is also current application piggyBac transposon the most extensively and relative the most ripe non-Drosophila
Insect species.However, the position brought currently with random integration of the piggyBac mediate foreign genes in silkworm genome
Put effect and insertion mutation phenomenon brings many harmful effects to domestic silkworm gene functional study, such as unpredictable gene table
The change reached, the structure for destroying host gene, normal growth and development of influence transgenic bombyx mori etc..Also, due to piggyBac
The randomness that mediate foreign gene is integrated is simple repeatedly to mediate different external sources using piggyBac transposon is hardly possible
Gene carries out site-directed integration in the target site of some determination.And as previously described, if it is possible to utilize phiC31/att site-specifics
Property recombination system mediate foreign gene carry out site-directed integration and replacement in the domestic silkworm gene group target site that has determined, be possible to
Effect overcomes the shortcoming of piggyBac mediate foreign gene radom insertions.
Another potential problems for setting up transgenic insect using Transposon System are, are mediated and inserted by transposon vector
There is wild effect after integration in the transgenosis of host genome.At present including Drosophila melanogaster, red flour beetle, Mediterranean
Again swivel bases of the piggyBac in host genome is observed in various insects species including trypetid, anopheles stephensi and silkworm
Phenomenon.Contain the piggyBac-like sequences with transcriptional activity in host genome, can encode generate it is active endogenous
Property transposase, be a critically important reason for producing this piggyBac swivel base phenomenon again.Identified in domestic silkworm gene group
More than 100 piggyBac-like sequences, many of which sequence has proven to be respectively provided with transcriptional activity.Utilize piggyBac swivel bases
Swivel base again after son insertion host genome, realizes the transposons arm sequence that piggyBac one side or both sides include terminal repeat
The deletion of row, is a kind of available strategy for eliminating wild effect after piggyBac transposon is integrated., Handler etc. in 2004
The compound piggyBac transposon vectors containing 3 transposons arms are constructed, swivel base again after piggyBac insertion is utilized so that
The exogenous dna fragment for being integrated into Drosophila melanogaster genome only remains 1 transposons arm sequence of one side, it is achieved thereby that target
In the stable integration of Drosophila melanogaster genome transposition event again no longer occurs for gene.2006, Dafa'alla etc. pairs
PiggyBac transposon vectors are further improved, and they are realized again by using swivel base again after piggyBac insertion
The deletion of all piggyBac transposon sequences in addition to target gene, ensures that the target gene in Mediterranean fruitfly gene
Stable integration in group.But, it is this to realize the strategy of transgenosis stable integration by deleting piggyBac two side arms sequence
Silkworm and other lepidopteran insect species are not yet applied at present.
Therefore, binding site specific recombination systems, the piggyBac transposon systems of optimization and transgenic bombyx mori external source
Protein expression system, explores a kind of initiative stabilization, the general and effective side of replaceable type high-efficient transgenic silkworm expression system
Method, will eliminate shadow of the wild effect to gene expression after insertion position effect and potential insertion mutation and integration to be effective
Ring, be that the gene functional research of silkworm, different protein expression researchs etc. provide good basis, while this is also to promote silkworm work(
It is the need for energy genome research development and inevitable.
The content of the invention
An object of the present invention is a kind of compound piggyBac recombinant vectors of offer, and the recombinant vector can be in mediation
External source target gene realizes that all transposon sequences and riddled basins sequence are deleted completely from domestic silkworm gene group after integrating,
Retain external source target gene only in silkworm genome, and can realize other foreign genes in silkworm by phiC31/att systems
The fixed point of genome is replaced；The second object of the present invention is to provide a kind of preparation of the compound piggyBac recombinant vectors
Method, it is easy to operate；The third object of the present invention be to provide the compound piggyBac recombinant vectors prepare it is stable, can
Application in displaced type high-efficient transgenic silkworm expression system；The fourth object of the present invention is to provide a kind of using described compound
Type piggyBac recombinant vectors prepare the stable, method of replaceable type high-efficient transgenic silkworm expression system, and this method can be real
Now all transposon sequences and riddled basins sequence in addition to external source target gene are deleted completely in silkworm genome,
Ensure that external source target gene stable integration in silkworm genome is without occurring transposition event again, the expression of gained transgenic bombyx mori
System can also be realized other by cassete exchange (RMCE) the reaction integrase mediated phiC31 based on phiC31/att systems
Foreign gene is replaced in the fixed point of identical integration site.
Concrete technical scheme is as follows：
1. compound piggyBac recombinant vectors, external source is inserted between wild type piggyBac transposon arm R1 and L1
Destination gene expression frame, riddled basins expression cassette I and II, the piggyBac transposases regulated and controled by heat-inducible promoter
(PBase) expression cassette and truncated-type piggyBac transposon arm L2 and R2；The two ends anchor of the external source destination gene expression frame
Surely there are 2 phiC31 being collectively aligned to integrate enzyme recognition sites (attP sites), formed attP- external source destination gene expressions frame-
AttP sequences；The truncated-type piggyBac transposon arm L2 forward directions are arranged in attP- external source destination gene expression frame-attP sequences
5 ' ends of row；The truncated-type piggyBac transposon arm R2 reversed arrangements are in attP- external source destination gene expression frame-attP sequences
3 ' ends of row；The riddled basins expression cassette I is located at wild type piggyBac transposon arm R1 and truncated-type piggyBac
Between transposons arm L2；The riddled basins expression cassette II is located at truncated-type piggyBac transposon arm R2 and wild type
Between piggyBac transposon arm L1；The piggyBac transposases expression cassette be arranged in riddled basins expression cassette II it
Afterwards, it is similarly positioned between transposons arm R2 and L1；The sequence such as SEQ ID No.1 of the wild type piggyBac transposon arm R1
Shown, wild type piggyBac transposon arm L1 sequence is as shown in SEQ ID No.2, truncated-type piggyBac transposon arm L2
Sequence as shown in SEQ ID No.3, truncated-type piggyBac transposon arm R2 sequence as shown in SEQ ID No.4, truncate
Also contain TTAA sites respectively in 3 ' ends of type piggyBac transposon arm L2 and R2 sequence.
It is preferred that, the external source destination gene expression frame is the fluorescent protein expression started with sericterium specific promoter
Frame.
It is furthermore preferred that the external source destination gene expression frame is the enhancing started with bombyx mori silk fibroin heavy chain promoter (FibH)
Green fluorescent protein (EGFP) expression cassette.
It is preferred that, riddled basins the expression cassette I and II are the fluorescence labelings started with tissue-specific promoter
Gene expression frame.
It is furthermore preferred that the riddled basins expression cassette I is started with eye and 3 × P3 of neural specific expression promoter
Red fluorescent protein (DsRed) expression cassette；The riddled basins expression cassette II is the EGFP tables started with 3 × P3 promoters
Up to frame.
It is preferred that, the heat-inducible promoter is Drosophila melanogaster hsp70 gene promoters.
In the compound piggyBac recombinant vectors of the present invention, except starting EGFP gene in domestic natural silk gland with FibH
Specifically expressing, and the FibH-EGFP expressed with fibroin heavy chain fusion expresses outer frame, other external source destination gene expression frames are equally fitted
With；Except the DsRed expression cassettes started with 3 × P3 promoters and the EGFP started with 3 × P3 promoters express outer frame, other sieves
Select marker gene expression cassette equally applicable；It is other in addition to FibH, 3 × P3 promoters, Drosophila melanogaster hsp70 gene promoters
Sericterium specific promoter (such as fib-L gene FibL, P25 GFPs fhx/P25 and sericin 1 gene Ser1 promoters),
Tissue-specific promoter (such as fat-body, middle intestines and blood specific promoter), heat-inducible promoter also can be according to the present invention
The strategy of offer is used to build compound piggyBac recombinant vectors.
2. the preparation method of compound piggyBac recombinant vectors, comprises the following steps：
A. sense primer attP-R2-F-SpeI and anti-sense primer R2-R-XhoI is used, with pBac { 3 × P3-DsRedaf }
Carrier is that template enters performing PCR amplification, obtains attP-pBacR2 fragments, pSL { 3 × P3- are connected into after SpeI and XhoI double digestions
EGFP-SV40 } carrier, obtain pSL { attP-R2-3 × P3-EGFP-SV40 } recombinant vector；The sense primer attP-R2-
F-SpeI sequence is as shown in SEQ ID No.5, and anti-sense primer R2-R-XhoI sequence is as shown in SEQ ID No.6；
B. sense primer SV40-F-NotI and anti-sense primer SV40-R-SphI is used, with pBac { 3 × P3-DsRedaf }
Carrier is that template enters performing PCR amplification, obtains SV40polyA fragments, pSLfa1180fa loads are connected into after NotI and SphI double digestions
Body, obtains pSL-SV40polyA recombinant vectors；The sequence of the sense primer SV40-F-NotI as shown in SEQ ID No.7,
Anti-sense primer SV40-R-SphI sequence is as shown in SEQ ID No.8；
Using sense primer PBase-F-SpeI and anti-sense primer PBase-R-NotI, entered using pHA3PIG carriers as template
Performing PCR is expanded, and obtains PBase genetic fragments, pSL-SV40polyA carriers are connected into after SpeI and NotI double digestions, are obtained
PSL-PBase-SV40 recombinant vectors；The sequence of the sense primer PBase-F-SpeI is as shown in SEQ ID No.9, and downstream is drawn
Thing PBase-R-NotI sequence is as shown in SEQ ID No.10；
Using sense primer Hsp70-F-SphI/SpeI and anti-sense primer Hsp70-R-SpeI, using pMLS104 carriers as mould
Plate enters performing PCR amplification, obtains hsp70 promoter gene fragments, pSL-PBase-SV40 carriers are connected into after SpeI single endonuclease digestions, are obtained
To pSL { Hsp70-PBase-SV40 } recombinant vector；The sequence of the sense primer Hsp70-F-SphI/SpeI such as SEQ ID
Shown in No.11, anti-sense primer Hsp70-R-SpeI sequence is as shown in SEQ ID No.12；
C. SphI single endonuclease digestions pSL { Hsp70-PBase-SV40 } recombinant vector is utilized, Hsp70-PBase-SV40 pieces are reclaimed
Section, then pSL { attP-R2-3 × P3-EGFP-SV40 } recombinant vector through identical digestion is inserted into, obtain pSL { attP-
R2-3 × P3-EGFP-SV40-Hsp70-PBase-SV40 } recombinant vector；
D. sense primer attP-L2-F-AscI and anti-sense primer L2-R-AscI is used, with pBac { 3 × P3-DsRedaf }
Carrier is that template enters performing PCR amplification, obtains pBacL2-attP fragments, pBac { 3 × P3- are connected into after AscI single endonuclease digestions
DsRedaf }-R3 carriers, obtain pBac { R1-3 × P3-DsRed-SV40-L2-attP-FibH-EGFP-LBS-L1 } restructuring loads
Body；The sequence of the sense primer attP-L2-F-AscI is as shown in SEQ ID No.13, anti-sense primer L2-R-AscI sequence
As shown in SEQ ID No.14；
E. recombinated and carried using FseI single endonuclease digestions pSL { attP-R2-3 × P3-EGFP-SV40-Hsp70-PBase-SV40 }
Body, reclaims attP-R2-3 × P3-EGFP-SV40-Hsp70-PBase-SV40 fragments, then be inserted into through identical digestion
PBac { R1-3 × P3-DsRed-SV40-L2-attP-FibH-EGFP-LBS-L1 } recombinant vector, that is, obtain compound
PiggyBac recombinant vectors.
3. compound piggyBac recombinant vectors are in stable, replaceable type high-efficient transgenic silkworm expression system is prepared
Using.
4. prepare stable, replaceable type high-efficient transgenic silkworm expression system using compound piggyBac recombinant vectors
Method, comprises the following steps：
A. compound piggyBac recombinant vectors and transposase expression vector are imported into the G0 of termination of diapause for silkworm seed jointly,
The heterozygosis G1 inserted with single R1-L1 swivel bases minor structures copied and high efficient expression foreign protein in genome is filtered out for transgenosis
Silkworm；
B. the heterozygosis G1 that acquisition is screened in step a is returned for transgenic bombyx mori and wild type silkworm and produces G2 for silkworm seed,
The diapause for releasing G2 for silkworm seed is handled with HCl, embryo or 4 instar larvaes are carried out with Heat thermostability, then by the G2 generations after Heat thermostability
Transgenic bombyx mori obtains G3 for transgenic bombyx mori with the backcrossing of wild type silkworm, filters out turn of transgenic structure both sides in genome
Stand is the G3 that deletes of R1-L2 and R2-L1 for transgenic bombyx mori, and the G3 in the genome of transgenic bombyx mori for only containing
By the external source destination gene expression frame sequence of 2 attP being collectively aligned site grapplings, that is, obtain stabilization, replaceable type efficient
Transgenic bombyx mori expression system.
Further, the Heat thermostability method is daily heat shock 3 times, every time 42 DEG C of heat shocks 1 hour, continuous heat shock 3~5
My god.
5. prepare stable, replaceable type high-efficient transgenic silkworm expression system using compound piggyBac recombinant vectors
Method, comprises the following steps：
A. compound piggyBac recombinant vectors and transposase expression vector are imported into the G0 of termination of diapause for silkworm seed jointly,
The heterozygosis G1 inserted with single R1-L1 swivel bases minor structures copied and high efficient expression foreign protein in genome is filtered out for transgenosis
Silkworm；
B. the heterozygosis G1 that acquisition is screened in step a is returned for transgenic bombyx mori and wild type silkworm and produces G2 for silkworm seed,
The diapause for releasing G2 for silkworm seed is handled with HCl, embryo or 4 instar larvaes are carried out with Heat thermostability, then by the G2 generations after Heat thermostability
The backcrossing of transgenic bombyx mori and wild type silkworm obtains G3 for transgenic bombyx mori, filter out transgenic structure one side R1 in genome-
L2 transposons occurs to delete and retain the G3 of R2-L1 transposons for transgenic bombyx mori；
The G3 for deleting and retaining R2-L1 transposons occurs for the unilateral R1-L2 transposons that c. step b is obtained for transgenosis man
Silkworm carries out the 2nd according to step b and takes turns heat-inducible, filters out the transposons i.e. R1-L2 and R2-L1 of genome transgenic structure both sides
The G4 deleted for transgenic bombyx mori, the G4 in the genome of transgenic bombyx mori only containing being collectively aligned by 2
The external source destination gene expression frame sequence of attP sites grappling, that is, obtain stabilization, replaceable type high-efficient transgenic silkworm expression
System.
Further, the Heat thermostability method is daily heat shock 3 times, every time 42 DEG C of heat shocks 1 hour, continuous heat shock 3~5
My god.
The beneficial effects of the present invention are：
(1) the invention provides a kind of compound piggyBac recombinant vectors containing 4 transposons arms, the recombinant vector
It can easily mediate external source target gene together with riddled basins and piggyBac transposase expression cassette sequences in silkworm base
Because of the integration of group, the transgenic bombyx mori system of simultaneously exogenous target gene high efficient expression is set up, can then be lured by Heat thermostability
PiggyBac transposases are led to express in transgenic bombyx mori body, realize all transposon sequences in addition to external source target gene and
Complete deletion of the riddled basins sequence in progeny transgenic domestic silkworm gene group, so that it is guaranteed that external source target gene is in offspring
Stable integration is without occurring swivel base phenomenon again in transgenic bombyx mori genome, while the presence for avoiding riddled basins is external
The influence of source destination gene expression and the bio-safety problem brought.Transposon sequence and riddled basins sequence are deleted
Transgenic bombyx mori genome afterwards contains by the external source destination gene expression frame of attP sites grappling, by based on phiC31/att
Cassete exchange the reaction integrase mediated phiC31 of system can conveniently realize replacing for other foreign genes and the target gene
Change, and then realize site-directed integration of other foreign genes in the genomic locus.
(2) base is efficiently turned in preparation stabilization, replaceable type the invention provides the compound piggyBac recombinant vectors
Because of the application in silkworm expression system and a kind of specific application process, it is in first with compound piggyBac recombinant vectors
The randomness of silkworm genome insertion, sets up and is inserted simultaneously containing external source target gene, screening mark in chromosome of mulberry silkworm diverse location
Remember multiple transgenic strains of the expression cassette sequence of gene and heat-inducible promoter regulation and control piggyBac swivel base expression of enzymes, once sieve
Choose external source destination gene expression one transgenic strain of horizontal highest, you can heat-inducible strategy is utilized, in the embryo of silkworm
Tire puberty or 4 instar larvae puberties, continued by 42 DEG C and the repeatedly method of Heat thermostability transgenic bombyx mori, realized all
The complete deletion of transposon sequence and riddled basins sequence in progeny transgenic domestic silkworm gene group, operating method is simply easy
Row and cost is extremely low, not only ensure that stable integration of the external source target gene in transgenic bombyx mori genome, it is to avoid turn base
Because of the loss or swivel base again in host silkworm, also effectively prevent influence of the riddled basins to destination gene expression and its
The Transgene-safty problem brought.The transgenic bombyx mori system obtained using the above method, its silkworm genes of individuals group purpose base
Because 2 attP being collectively aligned sites are contained in both sides, it can be reacted conveniently by cassete exchange integrase mediated phiC31
Realize that other foreign genes are replaced in the fixed point of identical chromosomal foci, therefore, the transgenosis man set up using the inventive method
Silkworm expression system is a kind of stable, replaceable type high-efficient transgenic silkworm expression system.
To sum up, compound piggyBac recombinant vectors of the invention and using its foundation is stable, replaceable type efficiently turns base
It is unstable after effectively eliminating insertion position effect and potential insertion mutation and integrating because of the method for silkworm expression system
Influence of the phenomenon to gene expression, is that the gene functional research of silkworm, different protein expression researchs etc. provide strong instrument.
Brief description of the drawings
In order that the purpose of the present invention, technical scheme and beneficial effect are clearer, the present invention provides drawings described below：
Fig. 1 is the structural representation of compound piggyBac recombinant vectors PB-TP (A) and transposons arm (B).
Fig. 2 detects photo for the TS1 silkworms containing different fluorescent marker genes are red with green fluorescence.
Fig. 3 is schematic diagram (A) and wild type 871, TS1- of the R1-L1 transgenic structures in TS1-RgG domestic silkworm gene groups
Photo (B) of the cocoon shell of RgG1~TS1-RgG4 silkworms under white light and green fluorescence；" H ", " X " and " S " is represented respectively
HaeIII, XhoI and SpeI；The white light exposure time is 1/800sec, and the green fluorescence time for exposure is 1/10sec.
Fig. 4 is the SDS-PAGE (A) and Western blotting that EGFP albumen is expressed in TS1-RgG silkworm silk
(B) detect；A：Wild type 871 (WT), TS1-RgG1~TS1-RgG4 silkworms silk albumen with beta -mercaptoethanol handle after
Electrophoresis detection, arrows restructuring EGFP albumen (~57kDa), triangle sign GFP standards are carried out in 12%SDS-PAGE glue
Product (27kDa), M represents protein markers；B：Using GFP antibody by Western blotting detections with being arranged in (A)
Row identical protein sample, arrows restructuring EGFP albumen, triangle sign GFP standard items (25ng, 50ng and 100ng).
Fig. 5 is the genomic DNA for detecting XhoI or SpeI digestion by Southern blotting using DsRed probes
Testing result.
Fig. 6 be using compound piggyBac recombinant vectors PB-TP screening transgenic high efficient expressions transgenic bombyx mori simultaneously
Realize the transgenosis tactful schematic diagram that stability is integrated in host genome.
Fig. 7 is used for Hybridization Strategies of the G3 for silkworm of fluoroscopic examination for initiative.
Fig. 8 is the detection of expression result photo of DsRed and EGFP gene in TS3 larvas.
Fig. 9 is the different transgenosis of 4 kinds of TS3 domestic silkworm genes group and the sequence of the domestic silkworm gene group same loci of wild type 871
Structural representation.
Figure 10 be to based on piggyBac again swivel base realize TS3 domestic silkworm gene groups two ends transposons deletion event molecule
Identification.
Figure 11 is the sequencing analysis of wild type 871 and TS3-g2 domestic silkworm gene group pcr amplification products.
Figure 12 is used for Hybridization Strategies of the G5 for silkworm of fluoroscopic examination for initiative.
Figure 13 be HST or non-HST treatment conditions under R2-L1 TS3-gG2 silkworm offsprings deletion efficiency；Error line table
Show standard deviation (n=3)；Statistical significant difference：*P<0.01, * * P<0.001.
Figure 14 is that heterozygosis TS4-gG2 or heterozygosis TS4-g2 silkworm moths and the silkworm moth of wild type 871 mate each G5 produced for silkworm
In the G5 containing g fluorescence phenotypes for larva proportion.All data confirm thats counted to FibH-EGFP expression cassettes stability,
Without statistical significant difference (P between above-mentioned ratio value>0.05).
Figure 15 is Detection of Stability of the integrated transgene in TS3-g2 silkworm offsprings, and wherein A exists for detection EGFP gene
Expression in the new larvae of TS7-g2 silkworms, the larva and cocoon shell in 7 days 5 ages；B be using primer pair pBm2902-3 '/
PBm2902-5 ' and pBm2902-3 '/FibH-MR carry out Genomic PCR detection, and " -/- ", " +/- " and "+/+" represent non-respectively
Transgenosis, Heterozygous transgenic and homozygous transgenic DNA sample.
Embodiment
Below in conjunction with accompanying drawing, the preferred embodiments of the present invention are described in detail.It is unreceipted specific in embodiment
The experimental method of condition, generally according to normal condition, such as Molecular Cloning:A Laboratory guide (third edition, J. Pehanorm Brookers etc. write)
Described in condition, or according to the condition proposed by manufacturer.
The middle practical diapause silkworm strain 871 (white cocoon) of system is preserved by laboratory where inventor.Carrier pSLfa1180fa
(Carsten Horn.et al2000)、pBac{3×P3-DsRedaf}(AiChun Zhao.et al2010)、pSL{3×
P3-EGFP-SV40}(Dingpei Long.et al2012)、pHA3PIG(Toshiki Tamura.et al2000)、
PMLS104 (Mark L.Siegal.et al1996) and pBac { 3 × P3-DsRedaf }-R3 (AiChun Zhao.et
Al2010) preserved by laboratory where inventor.
First, the structure of compound piggyBac recombinant vectors
Compound piggyBac recombinant vectors pBac { R1-3 × P3-DsRed-SV40-L2-attP-FibH-EGFP-LBS-
AttP-R2-3 × P3-EGFP-SV40-Hsp70-PBase-SV40-L1 } (piggyBac-derived target plasmid,
Structural representation referred to as " PB-TP ") is as shown in Figure 1.It contains 1 and starts EGFP gene spy in domestic natural silk gland using FibH
Different expression, and (FibH is referring to Publication No. CN1912116A's for the FibH-EGFP-LBS expression cassettes expressed with fibroin heavy chain fusion
Chinese patent).Contain 2 attP being collectively aligned sites in the two ends of FibH-EGFP-LBS expression cassettes.In PB-TP vector integrations
Enter domestic silkworm gene group and delete all transposable elements and riddled basins realize that stablizing for FibH-EGFP-LBS expression cassettes is whole
After conjunction, the above-mentioned attP sites being collectively aligned are to different outer available for being realized by the integrase mediated RMCE reactions of phiC31
Source gene (realizes the integrase mediated RMCE of phiC31 in the site-directed integration of identical integration site in silkworm genes of individuals group level
The tactful Chinese patent referring to Publication No. CN103232977A of reaction).The two of attP-FibH-EGFP-LBS-attP sequences
Holding truncated-type piggyBac transposon arm L2 (sequence is as shown in SEQ ID No.3) and R2 containing 2 arranged opposites, (sequence is such as
Shown in SEQ ID No.4).13 × P3-DsRed-SV40 of DsRed expression cassettes started with 3 × P3 promoters is located at wild type
Between piggyBac transposon arm R1 (sequence is as shown in SEQ ID No.1) and truncated-type piggyBac transposon arm L2.1 with
3 × P3-EGFP-SV40 of EGFP expression cassettes that 3 × P3 promoters start is located at truncated-type piggyBac transposon arm R2 and wild
Between type piggyBac transposon arm L1 (sequence is as shown in SEQ ID No.2).1 by Drosophila melanogaster hsp70 gene promoters
The expression cassette Hsp70-PBase-SV40 of regulation and control PBase gene expressions is arranged in after 3 × P3-EGFP-SV40 expression cassettes, equally
Between transposons arm R2 and L1.Therefore, PB-TP carrier structures combined 4 different transposons (R1-L1, R1-L2,
R2-L1 and L2-R2), and 3 × P3-DsRed (being represented with " R "), the 3 × P3-EGFP that these transposons can be contained by it
(being represented with " G ") and FibH-EGFP (represent) that fluorescent transgenic marks the various combination of expression cassette to make a distinction with " g ".Truncate
Type piggyBac arms L2 and R2 be used to improve again transposition efficiencies of the R1-L2 and R2-L1 in silkworm genome in the present invention,
And then improve the efficiency that R1-L2 and R2-L1 are deleted from initial chromosomal insertion locus.By piggyBac success swivel bases must
The element needed is not only held and 3 ' terminal repeat (the Terminal inverted held comprising piggyBac transposon 5 '
Repeat sequence, TIRs), the DNA sequence dna at piggyBac two ends is also included, particularly " TTAA " site, therefore the present invention
During compound piggyBac recombinant vectors are built, will also " TTAA " site insert and the 3 ' of L2 and R2 sequences hold (referring to
Primer sequence attP-R2-F-SpeI and attP-L2-F-AscI).
Specific construction method is as follows：
(1) amplimer is designed according to attP sites and pBac { 3 × P3-DsRedaf } carrier sequence：Sense primer
attP-R2-F-SpeI：5’-ttaactagtCCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGG
CCCTAGAAAGATAATCATAT-3 ' (SEQ ID No.5), single underscore is SpeI restriction enzyme sites, and double underline is
Unilateral " TTAA " site of piggyBac transposon arm；Anti-sense primer R2-R-XhoI：5’-
ggacctcgagTAAAAGTTTTGTTACTTTATAG-3 ' (SEQ ID No.6), underscore is XhoI restriction enzyme sites.Using upper
Amplimer is stated, performing PCR amplification, amplification condition are entered by template of pBac { 3 × P3-DsRedaf } carriers：94 DEG C of 5min, [94 DEG C
30sec, 60 DEG C of 30sec, 72 DEG C of 20sec] × 30 circulations, 72 DEG C of extension 8min.PCR expands the attP- for obtaining 0.3kb
PBacR2 fragments, pSL { 3 × P3-EGFP-SV40 } carrier is connected into after SpeI and XhoI double digestions, pSL { attP-R2-3 are obtained
× P3-EGFP-SV40 } recombinant vector.
(2) amplimer, sense primer SV40-F-NotI are designed according to SV40 polyadenylic acids signal sequence：5’-
gactgcggccgcGACTCTAGATCATAATCAGCC-3 ' (SEQ ID No.7), underscore is NotI restriction enzyme sites；Draw in downstream
Thing SV40-R-SphI：5’-gactgcatgcTACGCGTATCGATAAGCTTTAAG-3 ' (SEQ ID No.8), underscore is
SphI restriction enzyme sites.Using above-mentioned amplimer, performing PCR amplification, amplification are entered by template of pBac { 3 × P3-DsRedaf } carriers
Condition：94 DEG C of 5min, [94 DEG C of 30sec, 58 DEG C of 30sec, 72 DEG C of 20sec] × 30 circulations, 72 DEG C of extension 8min.PCR is expanded
0.27kb SV40polyA fragments are obtained, pSLfa1180fa carriers are connected into after NotI and SphI double digestions, pSL- is obtained
SV40polyA recombinant vectors.
According to piggyBac transposase gene CDS sequences Design amplimers, sense primer PBase-F-SpeI：5’-
tataactagtATGGGTAGTTCTTTAGACG-3 ' (SEQ ID No.9), underscore is SpeI restriction enzyme sites；Anti-sense primer
PBase-R-NotI：5’-tatagcggccgCTAGAAACAACTTTGGCACATATC-3 ' (SEQ ID No.10), underscore is
NotI restriction enzyme sites.Using above-mentioned amplimer, performing PCR amplification, amplification condition are entered by template of pHA3PIG carriers：94℃
5min, [94 DEG C of 30sec, 60 DEG C of 30sec, 72 DEG C of 2min] × 30 circulations, 72 DEG C of extension 8min.PCR amplifications obtain 1.8kb's
PiggyBac transposase gene fragments (abbreviation PBase), are connected into pSL-SV40polyA carriers after SpeI and NotI double digestions,
Obtain pSL-PBase-SV40 recombinant vectors.
Amplimer, sense primer Hsp70-F-SphI/ are designed according to Drosophila melanogaster hsp70 gene promoter sequences
SpeI：5’-tataactagtGcatgcCTAGAATCCCAAAACAAACT-3 ' (SEQ ID No.11), underscore is SpeI enzymes
Enzyme site；Anti-sense primer Hsp70-R-SpeI：5’-ggacactagtTATTCAGAGTTCTCTTCTTGTAT-3’(SEQ ID
No.12), underscore is SpeI restriction enzyme sites.Using above-mentioned amplimer, performing PCR amplification is entered by template of pMLS104 carriers,
Amplification condition：94 DEG C of 5min, [94 DEG C of 30sec, 56 DEG C of 30sec, 72 DEG C of 30sec] × 30 circulations, 72 DEG C of extension 8min.PCR
Amplification obtains 0.48kb drosophila hsp70 promoter gene fragments (abbreviation Hsp70), and pSL- is connected into after SpeI single endonuclease digestions
PBase-SV40 carriers, obtain pSL { Hsp70-PBase-SV40 } recombinant vector.
(3) SphI single endonuclease digestions pSL { Hsp70-PBase-SV40 } recombinant vector is utilized, 2.32kb Hsp70- is reclaimed
PBase-SV40 fragments, then pSL { attP-R2-3 × P3-EGFP-SV40 } recombinant vector through identical digestion is inserted into, obtain
To pSL { attP-R2-3 × P3-EGFP-SV40-Hsp70-PBase-SV40 } recombinant vector.
(4) amplimer, sense primer are designed according to attP sites and pBac { 3 × P3-DsRedaf } carrier sequence
attP-L2-F-AscI：5’-tataggcgcgccCCCCCAACTGAGAGAACTCAAAGGTTACCCCAGTTGGGG
CCCTAGAAAGATAGTCTGCG-3 ' (SEQ ID No.13), single underscore is AscI restriction enzyme sites, and double underline is
Unilateral " TTAA " site of piggyBac transposon arm；Anti-sense primer L2-R-AscI：5’-
tataggcgcgccACGATATCTATAACAAGAAAAT-3 ' (SEQ ID No.14), underscore is AscI restriction enzyme sites.Using
Above-mentioned amplimer, performing PCR amplification, amplification condition are entered by template of pBac { 3 × P3-DsRedaf } carriers：94 DEG C of 5min, [94
DEG C 30sec, 60 DEG C of 30sec, 72 DEG C of 30sec] × 30 circulations, 72 DEG C of extension 8min.PCR amplifications obtain 0.37kb's
PBacL2-attP fragments, are connected into pBac { 3 × P3-DsRedaf }-R3 carriers after AscI single endonuclease digestions, obtain pBac R1-3 ×
P3-DsRed-SV40-L2-attP-FibH-EGFP-LBS-L1 } recombinant vector.
(5) carried using FseI single endonuclease digestions pSL { attP-R2-3 × P3-EGFP-SV40-Hsp70-PBase-SV40 } restructuring
Body, reclaims 4.23kb attP-R2-3 × P3-EGFP-SV40-Hsp70-PBase-SV40 fragments, then is inserted into through identical
PBac { R1-3 × P3-DsRed-SV40-L2-attP-FibH-EGFP-LBS-L1 } recombinant vector of digestion, that is, obtain compound
PiggyBac recombinant vectors PB-TP.
The correctness that the PCR primer and recombinant vector obtained in above steps is cloned by sequence verification.
2nd, stable, replaceable type high-efficient transgenic silkworm expression system is set up using compound piggyBac recombinant vectors
The plan of stable, replaceable type high-efficient transgenic silkworm expression system is set up using compound piggyBac recombinant vectors
Slightly schematic diagram is as shown in Figure 6.(i) the germ line transformation method of the diapause silkworm strain mediated by piggyBac transposon, by PB-
TP carriers (Fig. 6 A) and transposase expression vector pHA3PIG (Fig. 6 B) import the G0 of termination of diapause for silkworm seed jointly, pass through fluorescence
Mark phenotype and Molecular Identification are filtered out in genome inserted with single copy R1-L1 swivel bases minor structures and the efficient table in its silk
TS1-RgG silkworms up to EGFP albumen are individual (Fig. 6 C)；(ii) Heat thermostability (Heat shock treatment, HST) embryo
Or the non-diapause heterozygosis TS2-RgG silkworms of larvae development stage, in the case where HST induces the PBase effects produced, positioned at TS2-RgG
Transposition event (Fig. 6 D) again occurs for the transposons (R1-L2, R2-L1) of silkworm germ cells gene group transgenic structure both sides, leads
The unilateral transposons (R2-L1 or R1-L2) of cause or the transposons (R1-L2 and R2-L1) of both sides are in TS3-Rg, TS3-gG or TS3-
The deletion (Fig. 6 E-G) of g domestic silkworm gene groups, the TS3 silkworms for occurring again transposition event can be by the change of its fluorescence labeling phenotype
(being mainly missing from change) is identified.(iii) realize in the TS3-g silkworms that both sides transposons is deleted, its genome
Only contain by the FibH-EGFP-LBS expression cassettes (Fig. 6 G) of 2 attP being collectively aligned site grapplings.And only realize unilateral swivel base
The TS3-gG silkworms (Fig. 6 F) that son is deleted can be tested according to the heat-inducible of the above-mentioned wheel of strategy progress the 2nd, and final realize is owned
Transposon sequence and riddled basins sequence are deleted completely in its germ cells gene group, and then are screened behind in generation
Only contain in genome by the TS4-g silkworms of the FibH-EGFP-LBS expression cassette sequences of 2 attP being collectively aligned site grapplings
(Fig. 6 H).Stabilization of the transgenosis in silkworm genome is realized using the mediation of compound piggyBac recombinant vectors by above step
Integrate without after generation again transposition event, you can using 2 attP being collectively aligned sites, the RMCE mediated by phiC31
Reaction realizes that different foreign genes are (special referring to Publication No. CN103232977A China in the site-directed integration of identical integration site
Profit).
Specific method for building up is as follows：
1st, the G1 of screening transgenic high efficient expression is for transgenic bombyx mori
With the practical diapause silkworm strain 871 (white cocoon) of middle system as experimental animal material, parental generation silkworm seed is through low temperature (16 DEG C)
Incubating treatment is to release the diapause of filial generation silkworm seed；By recombinant vector PB-TP and auxiliary matter of the 5-10nL total concentrations for 450ng/ μ L
The G0 that grain pHA3PIG mixed liquor is injected to termination of diapause puts 25 DEG C, relative humidity for nontoxic glue sealing in silkworm seed, is used
Hastened the hatching of silkworms in 85% environment hatching, hatch the newly-hatched silkworm obtained and collected with mulberry leaf and raised to moth is changed, the G0 of acquisition passes through backcrossing for silkworm moth
G1 is produced for silkworm seed, is hatched, the G1 of acquisition is for larva is with the electronic macroscopical fluorescence microscopes of Olympus and identifies eyes and body
The different fluorescence that body is sent, the G1 of acquisition is individually raised in units of moth area for transgenic positive silkworm, that is, is realized and turned
The foundation of gene silkworm system (Transgenic strains, TSs).G1 is named as TS1 for TS, its offspring be named as successively TS2,
TS3 ... TSn (" n " is represented from generation to generation), the like.The screening statistical result of 2 independent injection experiments is shown in Table 1.
Table 1, PB-TP carriers are in injection the selection results of the 871 strain silkworm G0 for silkworm seed
As shown in table 1,2 independent injection experiments obtain 11 circle G1 and enclosed for transgenic positive silkworm seed, every 1 in silkworm seed altogether
At least containing 1 transgenic bombyx mori individual.In 2 independent injection experiments, obtain the G1 generations positive silkworm seed number of turns and account for all screenings
G1 is respectively 13.6% and 10.3% for the percentage of the silkworm seed number of turns.
Because PB-TP carriers contain 4 kinds of different potential transposons, therefore the TS1 containing the insertion of different transposons is for family
Silkworm larva shows different fluorescence phenotypes.TSn silkworms containing different fluorescence phenotypes, according to the difference of its fluorescence phenotype, such as 3
× P3-DsRed (R), FibH-EGFP (g) or 3 × P3-EGFP (G), are abbreviated as TSn-R, TSn-G or TSn-g respectively；For example,
If the transgenic bombyx mori individual from G1 generations is designated as " TS1-RgG " simultaneously containing 3 kinds of different fluorescence phenotypes.2 independences
The fluorescence phenotype analysis result of the TS1 silkworms from different G1 generations positive moth circle that obtains of injection experiment be shown in Table 2.Meanwhile, Fig. 2
Show fluorescence photos of the TS1 for silkworm larva of mesoderm growing early stage.
Table 2, the fluorescence phenotype analysis result of TS1 silkworms from different G1 generations positive moth circle
As shown in table 2,4 have been screened altogether in G1 silkworm seed of 11 circles containing positive silkworm individual be respectively from 4 circles
The TS1-RgG silkworms of different silkworm seeds, are respectively designated as TS1-RgG1~TS1-RgG4.Due to the base of all TS1-RgG silkworms
Because containing FibH-EGFP expression cassettes (Fig. 3 A) in group, the cocoon shell from TS1-RgG1~TS1-RgG4 silkworms is shown very
Strong green fluorescence, illustrates to contain substantial amounts of restructuring EGFP albumen (Fig. 3 B) in their cocoon shell.Wherein come from TS1-
The fluorescence intensity that the cocoon shell of RgG2 silkworms is shown under identical time for exposure and identical excitating light strength is maximum (Fig. 3 B).
Detected respectively from TS1-RgG silkworms and the silkworm of wild type 871 using SDS-PAGE and Western blotting (GFP antibody)
Silk albumen.SDS-PAGE electrophoresis results are shown, in each track from TS1-RgG Cocoon silk-fibroins, are examined
Measure 1 treaty 57kDa single EGFP/H-chain fusion proteins band (Fig. 4 A).According to Western blotting inspection
Result (Fig. 4 B) is surveyed, is computed, pure EGFP albumen is distinguished in TS1-RgG1~TS1-RgG4 silkworm silk total proteins proportion
For 14.6%, 16.5%, 7.1% and 0.9% (table 3), the result and the cocoon shell fluorescence observed by fluorescence stereomicroscope
Intensity results are consistent.
Restructuring EGFP protein contents in table 3, difference TS1-RgG Cocoon shells
Detect R1-L1 transgenic structures in TS1-RgG1 and TS1-RgG2 domestic silkworm genes using Southern blotting
Insertion copy number in group, as a result shows, R1-L1 of the TS1-RgG1 and TS1-RgG2 domestic silkworm genes group inserted with single copy turns
Gene structure (Fig. 5).Detect R1-L1 transgenic structures in TS1-RgG1~TS1-RgG3 domestic silkworm genes using Inverse PCR
Insertion point in group, the results are shown in Table 4, insertion of the transgenosis in TS1-RgG1 and TS1-RgG2 domestic silkworm gene groups is heterozygosis
Form, insertion point of the R1-L1 transposons in TS1-RgG1 and TS1-RgG2 domestic silkworm gene groups be respectively positioned in No. 24 and
No. 18 chromosome.
The domestic silkworm gene group sequence of table 4, piggyBac transposon insertion point two ends 20bp
| Strain | Scaffold | Chromosome | 5'- genome sequences | 3'- genome sequences |
| TS1-RgG1 | nscansf2891 | 24 | AGCTCACTGTCCACGTGGTGTTAA | TTAAGTGCTTATGGGAGCCCATAG |
| TS1-RgG2 | nscaf2902 | 18 | AGTCAGTCAGTCAAACATATTTAA | TTAAGTATATTTGTTAATTTATAT |
| TS1-RgG3 | scaffold16066 | – | TGAAGAGTGACGTCAAAGTTTTAA | TTAATTGCATATTGCGTAGATTCT |
Thus, the present embodiment finally sets up the G1 of 2 heterozygosis for transgenosis system --- and TS1-RgG1 and TS1-RgG2, comes
R1-L1 transgenic structures from the silkworm genes of individuals group of this 2 strains containing single copy.Wherein TS1-RgG2 silkworms exist
The efficiency highest of expression restructuring EGFP albumen in its silk albumen, i.e. the present embodiment has screened 1 high efficient expression in silk
The transgenic bombyx mori system TS1-RgG2 of foreign protein.
2nd, initiative does not contain the transgenic bombyx mori of transposable element and riddled basins
It is female with the male moths of TS1-RgG2 of foregoing 1 heterozygosis filtered out and 1 wild type 871 according to the flow shown in Fig. 7
Moth backcrossing produces 1 and encloses G2 for silkworm seed；3 group (1 will be divided into for the silkworm seed of moth circle from same G2#、2#With 3#), handled and released with HCl
The diapause of each group silkworm seed, then, 1#Group is without Heat thermostability；2#Group carries out the Heat thermostability of embryonic development period：It will develop 3 days
G2 be placed in 1 for non-diapause silkworm seed and have in lid plastic culture dish, then culture dish is placed in artificial climate incubator, 42 DEG C of heat
The silkworm seed after processing silkworm seed 60min (humidity is maintained at 85%~90%), Heat thermostability is swashed then at 25 DEG C, humidity 85%~90%
Under the conditions of keep 6h, then repeat above-mentioned shock step, daily heat shock 3 times continues Heat thermostability 5 days, whole Heat thermostability is complete
Cheng Hou, silkworm seed is normally hastened the hatching of silkworms in 25 DEG C until hatching, the larva after hatching no longer carries out Heat thermostability；3#Group carries out larva hair
Educate the Heat thermostability of phase：G2 is normally hastened the hatching of silkworms for non-diapause silkworm seed in 25 DEG C until hatching, the G2 after hatching is normally raised for larva
Support to 3 ages and sleep, silkworm from 4 ages is placed in 1 carton, then carton is placed in artificial climate incubator, 42 DEG C of Heat thermostability childrens
Larva after worm 60min (humidity is maintained at 75%~80%), Heat thermostability protects under the conditions of 25 DEG C, humidity 75%~80%
Hold 6h and feed with new fresh mulberry leaf, then repeat above-mentioned shock step, daily heat shock 3 times continues Heat thermostability 3 days, whole heat shock
After the completion of processing, larva is fed under the conditions of 25 DEG C and normally raised with mulberry leaf；As a result from from 1#、2#With 3#The G2 of group is for silkworm
It is middle to have screened 54,41 and 51 respectively and survive TS2-RgG2 silkworm moths, these silkworm moths and the silkworm moth of wild type 871 are returned and produced
Raw G3 comes from TS3 larva fluorescence phenotypes of each group G3 for moth circle for moth circle, detection.Screen at least containing 1 TS3-Rg,
The G3 of TS3-gG or TS3-g larvas is named as the positive moth circle of Rg, gG or g respectively for moth circle, finally from from 2#37 of group
G3 is for the positive moth circles of 6 g have been screened in moth circle, from from 3#45 G3 of group are for having screened the positive moth of 1 g in moth circle
Circle, g positive moth circles are 2#Group and 3#The G3 of group is respectively 16.22% and 2.22%, Rg, gG and g positive moth for the ratio in moth circle
Circle sum is 2#Group and 3#The G3 of group is respectively 62.16% and 15.56% (table 5) for the ratio in moth circle.Fig. 8 shows TS3 generations
Larva expresses the picture of DsRed and EGFP gene.
The TS3 silkworm quantity statisticses of deletion event after piggyBac transposon is integrated occur in table 5, genome
Note：aG3 at least containing 1 TS3-Rg2, TS3-gG2 or TS3-g2 larva is for moth number of turns amount.
In order to further identify that the TS3 as caused by piggyBac swivel bases again turns for both sides contained in silkworm genes of individuals group
The deletion event of stand (R1-L2 and/or R2-L1), extracts genomes of the different TS3 for silkworm moth and the silkworm moth of wild type 871, uses
After XhoI digestion, Southern blotting analyses are carried out with EGFP probes and DsRed probes respectively.As a result such as Figure 10 A institutes
Show, using EGFP probes, hybridization has obtained 1 from the swimming lane from TS3-RgG2 and TS3-gG2 domestic silkworm gene group samples
2.3kb and 1 1.3kb signal strips band, it is then only miscellaneous from the swimming lane from TS3-Rg2 and TS3-g2 domestic silkworm gene group samples
Friendship has obtained 1 size identical signal strips band, and does not hybridize from the swimming lane from the domestic silkworm gene group sample of wild type 871
Obtain any signal strips band；Using DsRed probes from the swimming lane from TS3-RgG2 and TS3-Rg2 domestic silkworm gene group samples
Hybridization has obtained 1 size identical signal strips band, and from from TS3-gG2, TS3-g2 and the domestic silkworm gene group sample of wild type 871
Do not hybridize then in the swimming lane of product and obtain any signal strips band.The TS3 of the above results and variant type (schemes for domestic silkworm gene group
9) expection hybridizing band pattern result is consistent.
Then, it is as follows according to the domestic silkworm gene group sequence near transgenic insert locus and the design of the transgenic sequence of insertion
Primer：pBm2902-5′：5’-TACACACATTTATGTATATCACAAAAAGCG-3’(SEQ ID No.15)；pBm2902-
3′：5 '-TACCGATTGATTGCATCTACG-3 ' (SEQ ID No.16), by Genomic PCR to TS3 in domestic silkworm gene group
Contained transgenic structure is identified.As a result as shown in Figure 10 B, from each different TS3 for being expanded in domestic silkworm gene group
It is big for domestic silkworm gene group (Fig. 9) amplified band that the PCR primer band arrived deletes reacted each TS3 with the generation transposons predicted
It is small consistent.Therefore, the result of Genomic PCR reaction confirms R2-L1 deletion, TS3-gG2 family in TS3-Rg2 domestic silkworm gene groups
Deleted in silkworm genome in R1-L2 deletion and TS3-g2 domestic silkworm gene groups while R2-L1 and R1-L2.Meanwhile, when with
TS3-g2 domestic silkworm genes group is template, when carrying out pcr amplification reaction with primer pair pBm2902-3 '/pBm2902-5 ', due to turning
Gene structure in the TS3-g2 silkworms screened is existed with hetero forms, therefore amplification has obtained including for 1 3893bp
Wild type 871 is come from by the PCR primer band of the FibH-EGFP expression cassette sequences of attP sites grappling and 1 358bp
The PCR primer band of silkworm chromosomal DNA is (with primer pair pBm2902-3 '/pBm2902-5 ' from the domestic silkworm gene group of wild type 871
It is only capable of expanding the PCR primer band for obtaining 1 358bp).3893bp to coming from all TS3-g2 silkworms genes of individuals groups
PCR primer band carries out sequencing analysis, as a result shows, in all TS3-g2 silkworms genes of individuals groups, either contained turn
Gene structure in itself or its insertion point near genomic DNA, phenomenon of not undergoing mutation and by mutation caused by
Structural change, it is any that the result illustrates that piggyBac transposition event again does not leave in " TTAA " site of excision
" footprint ", this is consistent with expected results.Figure 11 is shown in TS3-g2 domestic silkworm gene groups by the FibH- of attP sites grappling
3 ' ends of EGFP expression cassettes and the sequencing result and the genome of wild type 871 of 5 ' terminal sequences (turn in identical genomic locus
Gene insertion site) sequencing result.
3rd, screening initiative does not contain the optimal Heat thermostability condition of the transgenic bombyx mori of transposable element and riddled basins
According to the flow shown in Figure 12, with wild different from 3 of the male moths of the TS3-gG2 of foregoing 1 heterozygosis filtered out
The female moth of type 871 (a, b and c) backcrossing produces 3 different G4 for moth circle (a, b and c), and each G4 is divided into again for the silkworm seed of moth circle
3 group (1#、2#With 3#), the diapause for releasing each group silkworm seed is handled with HCl, then by method same as before, 1#Group without heat shock at
Reason, 2#Group carries out the Heat thermostability of embryonic development period, 3#Group carries out the Heat thermostability of larvae development phase, then from G4 for a, b and c moth
50 are filtered out in each group of circle respectively and survives TS4-gG2 silkworm moths, these silkworm moths and the backcrossing of the silkworm moth of wild type 871 are produced into G5 generations
Moth circle, is finally detected to the G5 from each group for the larva fluorescence phenotype of a, b and c moth circle.6 are the results are shown in Table, from 1#
Group, 2#Group and 3#The G5 of group in moth circle, the ratios of the positive moth circles of the g containing TS5-g2 silkworms is respectively 0%~2%, 70%~
80% and 10%~14%.It is computed, Heat thermostability is carried out in embryonic development period and realizes that the efficiency of R2-L1 deletions is significantly higher than
The larvae development phase carries out Heat thermostability, and Heat thermostability is carried out in the larvae development phase and realizes that the efficiency of R2-L1 deletions is significantly high
In without Heat thermostability (Figure 13).Therefore, in transgenic bombyx mori Embryonic Stages, carry out continuing and repeatedly many using 42 DEG C
Secondary Heat thermostability, is to realize transposon sequence behind for the most effectual way deleted in domestic silkworm gene group.
Deletion efficiency after integration of the R2-L1 that table 6, different heat shock strategies are realized in TS3-gG2 silkworm offsprings
Note：aThe percentage of (G5 is for the positive moth number of turns/screening G5 of g for the moth number of turns).
b(G5 that each G5 contains for TS5-g2 silkworms number/G5 that the positive moth circles of g contain for the positive moth circles of g is total for silkworm
Head number) percentage.Each G5 contains 450~550 G5 for silkworm for the positive moth circles of g.
cG5 with g fluorescence phenotypes includes TS5-gG2 and TS5-g2 silkworms for silkworm.Each G5 contains 450 for moth circle~
550 G5 are for silkworm.
4th, genetic stability of the detection FibH-EGFP expression cassettes in TS3 silkworm offspring's genomes
In order to detect and assess stabilization of the FibH-EGFP expression cassettes in TS3-g2 silkworm offspring's genomes of foregoing acquisition
Property, TS4-g2 (+/-, represent heterozygote) or TS4-g2 (+/+, represent homozygote) silkworm moth is passed through just with the silkworm moth of wild type 871
The mode of reciprocal cross mates the production of hybrid seeds, 16 G5 is obtained for moth circle, then to coming from larva fluorescence phenotypes of these G5 for moth circle
Detected.7 and table 8 are the results are shown in Table, TS5-g2 silkworms are obtained in TS4-g2 (+/-) silkworm moths and the silkworm moth reciprocal cross of wild type 871
8 G5 obtained are for proportion in moth circle (amounting to 4081 G5 for silkworm) nearly all for 50% (if g fluorescence phenotypes are stable
, then in these G5 in moth circle, the theoretical value 50% of the silkworm containing g fluorescence phenotypes)；TS5-g2 silkworms are in TS4-g2
(+/+) 8 G5 obtaining of silkworm moth and the silkworm moth reciprocal cross of wild type 871 are for proportion in moth circle (amounting to 4059 G5 for silkworm)
All for 100% (if g fluorescence phenotypes are stable, in these G5 in moth circle, the theory of the silkworm containing g fluorescence phenotypes
It is worth for 100%).Result above confirms FibH-EGFP expression cassettes in PBase TS3-g2 silkworm offspring's genomes are not contained
Stability.
The G5 that table 7, TS4-g2 (+/-) silkworm moths and the silkworm moth reciprocal cross of wild type 871 are obtained is for TS5-g2 silkworms institute in moth circle
Accounting example
The G5 that table 8, TS4-g2 (+/+) silkworm moth and the silkworm moth reciprocal cross of wild type 871 are obtained is for TS5-g2 silkworms institute in moth circle
Accounting example
Data are understood with reference to shown in table 6, the FibH- containing heterozygosis in the TS4-gG2 silkworm moth genomes of all screenings
EGFP expression cassettes.The data of table 6 also show that screen each G5 obtained is for the ratio of the TS5-g2 silkworms contained in the positive moth circles of g
1.53%~25.78%, the result illustrate R2-L1 be at least 1.53% for the transposition efficiency again in the positive moth circles of g in each G5~
25.78%.But by detecting 150 G5 from each experimental group, for the discovery of moth circle, (each experimental group contains to amount to and exceeded
75000 G5 are for silkworm), the G5 containing g fluorescence phenotypes (including TS5-gG2 and TS5-g2 silkworms) accounts for the moth for silkworm number of individuals
The ratio for enclosing silkworm total individual number is nearly all 50%, and the result is consistent with theoretical value (Figure 14).Result above is confirmed
FibH-EGFP expression cassettes in vivo containing PBase TS4-gG2 silkworms individual genome in can not occur transposition event again.
In addition, detecting EGFP albumen in TS7-g2 Silkworm, Bombyx moris and silk with the electronic macroscopical fluorescence microscopes of Olympus
In expression.As a result as shown in fig. 15, EGFP albumen in the sericterium of TS7-g2 silkworms there is specific efficient to express, and energy
It is secreted into its silk.In order to further confirm that integration of the FibH-EGFP expression cassettes in TS3-g2 silkworm offspring's genomes is steady
It is qualitative, TS3-g2 (+/-), TS4-g2 (+/-), the genome of TS4-g2 (+/+) and TS7-g2 (+/+) silkworm are extracted, it is sharp respectively
Identified with primer pair pBm2902-3 '/pBm2902-5 ' and pBm2902-3 '/FibH-MR by Genomic PCR.As a result
As shown in fig. 15b, using primer pair pBm2902-3 '/pBm2902-5 ', from TS3-g2 (+/-), TS4-g2 (+/-), TS4-g2
(+/+) and the genome of TS7-g2 (+/+) silkworm in amplification obtained 1 3893bp PCR primer band, from wild type
871 (WT, -/-, represent non-transgenic), expand in the genome of TS3-g2 (+/-) and TS4-g2 (+/-) silkworm and obtained 1
Bar 358bp PCR primer band；Using primer pair pBm2902-3 '/FibH-MR from TS3-g2 (+/-), TS4-g2 (+/-),
Amplification has obtained 1 612bp PCR primer band in the genome of TS4-g2 (+/+) and TS7-g2 (+/+) silkworm.These
The size of PCR primer band is all consistent with desired value.More than it is all as a result, it was confirmed that no matter whether containing in transgenic bombyx mori body
There is PBsae, FibH-EGFP expression cassettes are in the integration of TS3 silkworm offspring's genomes and EGFP albumen in TS3 silkworm offspring's bodies
And the expression in silk is respectively provided with stability.
Finally illustrate, preferred embodiment above is merely illustrative of the technical solution of the present invention and unrestricted, although logical
Cross above preferred embodiment the present invention is described in detail, it is to be understood by those skilled in the art that can be
Various changes are made to it in form and in details, without departing from claims of the present invention limited range.
Claims (8)
1. compound piggyBac recombinant vectors, it is characterised in that in interleaving for wild type piggyBac transposon arm R1 and L1
External source destination gene expression frame, riddled basins expression cassette I and II, the piggyBac swivel bases regulated and controled by heat-inducible promoter are entered
Expression of enzymes frame and truncated-type piggyBac transposon arm L2 and R2；The anchored ends of the external source destination gene expression frame have 2
The individual phiC31 being collectively aligned integrates enzyme recognition site i.e. attP sites, forms attP- external source destination gene expression frame-attP sequences
Row；The truncated-type piggyBac transposon arm L2 forward directions are arranged in the 5 ' of attP- external source destination gene expression frame-attP sequences
End；The truncated-type piggyBac transposon arm R2 reversed arrangements in attP- external source destination gene expression frame-attP sequences 3 '
End；The riddled basins expression cassette I is located at wild type piggyBac transposon arm R1 and truncated-type piggyBac transposon
Between arm L2；The riddled basins expression cassette II is located at truncated-type piggyBac transposon arm R2 and wild type piggyBac
Between transposons arm L1；The piggyBac transposases expression cassette is arranged in after riddled basins expression cassette II, same position
Between transposons arm R2 and L1；The sequence of the wild type piggyBac transposon arm R1 is wild as shown in SEQ ID No.1
Type piggyBac transposon arm L1 sequence is as shown in SEQ ID No.2, and truncated-type piggyBac transposon arm L2 sequence is such as
Shown in SEQ ID No.3, truncated-type piggyBac transposon arm R2 sequence is as shown in SEQ ID No.4, truncated-type
Also contain TTAA sites respectively in 3 ' ends of piggyBac transposon arm L2 and R2 sequence；The external source destination gene expression frame be with
The eGFP expression cassette that bombyx mori silk fibroin heavy chain promoter starts；The riddled basins expression cassette I is with eye
The red fluorescent protein expression cassette that 3 × P3 of promoter starts is expressed with neural specific；The riddled basins expression cassette II is
The eGFP expression cassette started with 3 × P3 promoters.
2. compound piggyBac recombinant vectors according to claim 1, it is characterised in that the heat-inducible promoter is black
Abdomen drosophila hsp70 gene promoters.
3. the preparation method of the compound piggyBac recombinant vectors described in claim 1 or 2, it is characterised in that including following
Step：
A. sense primer attP-R2-F-SpeI and anti-sense primer R2-R-XhoI is used, is carried with pBac { 3 × P3-DsRedaf }
Body is that template enters performing PCR amplification, obtains attP-pBacR2 fragments, pSL { 3 × P3- are connected into after SpeI and XhoI double digestions
EGFP-SV40 } carrier, obtain pSL { attP-R2-3 × P3-EGFP-SV40 } recombinant vector；The sense primer attP-R2-
F-SpeI sequence is as shown in SEQ ID No.5, and anti-sense primer R2-R-XhoI sequence is as shown in SEQ ID No.6；
B. sense primer SV40-F-NotI and anti-sense primer SV40-R-SphI is used, with pBac { 3 × P3-DsRedaf } carrier
Enter performing PCR amplification for template, obtain SV40 polyA fragments, pSLfa1180fa carriers are connected into after NotI and SphI double digestions,
Obtain pSL-SV40 polyA recombinant vectors；The sequence of the sense primer SV40-F-NotI as shown in SEQ ID No.7, under
Primer SV40-R-SphI sequence is swum as shown in SEQ ID No.8；
Using sense primer PBase-F-SpeI and anti-sense primer PBase-R-NotI, performing PCR is entered using pHA3PIG carriers as template
Amplification, obtains PBase genetic fragments, pSL-SV40 polyA carriers is connected into after SpeI and NotI double digestions, pSL- is obtained
PBase-SV40 recombinant vectors；The sequence of the sense primer PBase-F-SpeI is as shown in SEQ ID No.9, anti-sense primer
PBase-R-NotI sequence is as shown in SEQ ID No.10；
Using sense primer Hsp70-F-SphI/SpeI and anti-sense primer Hsp70-R-SpeI, entered using pMLS104 carriers as template
Performing PCR is expanded, and obtains hsp70 promoter gene fragments, pSL-PBase-SV40 carriers are connected into after SpeI single endonuclease digestions, are obtained
PSL { Hsp70-PBase-SV40 } recombinant vector；The sequence of the sense primer Hsp70-F-SphI/SpeI such as SEQ ID
Shown in No.11, anti-sense primer Hsp70-R-SpeI sequence is as shown in SEQ ID No.12；
C. SphI single endonuclease digestions pSL { Hsp70-PBase-SV40 } recombinant vector is utilized, Hsp70-PBase-SV40 fragments are reclaimed,
PSL { attP-R2-3 × P3-EGFP-SV40 } recombinant vector through identical digestion is inserted into again, obtains pSL { attP-R2-3
× P3- EGFP-SV40-Hsp70-PBase-SV40 } recombinant vector；
D. sense primer attP-L2-F-AscI and anti-sense primer L2-R-AscI is used, is carried with pBac { 3 × P3-DsRedaf }
Body is that template enters performing PCR amplification, obtains pBacL2-attP fragments, pBac { 3 × P3- are connected into after AscI single endonuclease digestions
DsRedaf }-R3 carriers, obtain pBac { R1-3 × P3-DsRed-SV40-L2-attP-FibH-EGFP-LBS-L1 } restructuring loads
Body；The sequence of the sense primer attP-L2-F-AscI is as shown in SEQ ID No.13, anti-sense primer L2-R-AscI sequence
As shown in SEQ ID No.14；
E. FseI single endonuclease digestions pSL { attP-R2-3 × P3-EGFP-SV40-Hsp70-PBase-SV40 } recombinant vector is utilized, is returned
AttP-R2-3 × P3-EGFP-SV40-Hsp70-PBase-SV40 fragments are received, then are inserted into the pBac { R1- through identical digestion
3 × P3-DsRed-SV40-L2-attP-FibH-EGFP-LBS-L1 } recombinant vector, that is, obtain compound piggyBac restructuring and carry
Body.
4. the compound piggyBac recombinant vectors described in claim 1 or 2 are preparing stable, replaceable type high-efficient transgenic man
Application in silkworm expression system.
5. prepare stable, replaceable type high-efficient transgenic using the compound piggyBac recombinant vectors described in claim 1 or 2
The method of silkworm expression system, it is characterised in that comprise the following steps：
A., compound piggyBac recombinant vectors and transposase expression vector are imported to the G0 of termination of diapause jointly for silkworm seed, screening
Go out the heterozygosis G1 inserted with single R1-L1 swivel bases minor structures copied and high efficient expression foreign protein in genome for transgenosis man
Silkworm；
B. the heterozygosis G1 that acquisition is screened in step a is returned for transgenic bombyx mori and wild type silkworm and produces G2 for silkworm seed, use HCl
Processing releases diapause of the G2 for silkworm seed, and Heat thermostability is carried out to embryo or 4 instar larvaes, then by the G2 after Heat thermostability for transgenosis
Silkworm obtains G3 for transgenic bombyx mori with the backcrossing of wild type silkworm, filters out the transposons of transgenic structure both sides in genome i.e.
The G3 that R1-L2 and R2-L1 are deleted is for transgenic bombyx mori, and the G3 in the genome of transgenic bombyx mori for only containing by 2
The external source destination gene expression frame sequence for the attP sites grappling being collectively aligned, that is, obtain stabilization, replaceable type and efficiently turn base
Because of silkworm expression system.
6. according to claim 5 efficiently turn base using compound piggyBac recombinant vectors preparation stabilization, replaceable type
Because of the method for silkworm expression system, it is characterised in that the Heat thermostability method is daily heat shock 3 times, and 42 DEG C of heat shocks 1 are small every time
When, continuous heat shock 3 ~ 5 days.
7. prepare stable, replaceable type high-efficient transgenic using the compound piggyBac recombinant vectors described in claim 1 or 2
The method of silkworm expression system, it is characterised in that comprise the following steps：
A., compound piggyBac recombinant vectors and transposase expression vector are imported to the G0 of termination of diapause jointly for silkworm seed, screening
Go out the heterozygosis G1 inserted with single R1-L1 swivel bases minor structures copied and high efficient expression foreign protein in genome for transgenosis man
Silkworm；
B. the heterozygosis G1 that acquisition is screened in step a is returned for transgenic bombyx mori and wild type silkworm and produces G2 for silkworm seed, use HCl
Processing releases diapause of the G2 for silkworm seed, and Heat thermostability is carried out to embryo or 4 instar larvaes, then by the G2 after Heat thermostability for transgenosis
Silkworm obtains G3 for transgenic bombyx mori with the backcrossing of wild type silkworm, filters out transgenic structure one side R1-L2 swivel bases in genome
Son occurs to delete and retain the G3 of R2-L1 transposons for transgenic bombyx mori；
C. the G3 that unilateral R1-L2 transposons step b obtained occurs to delete and retain R2-L1 transposons is pressed for transgenic bombyx mori
The 2nd is carried out according to step b and takes turns heat-inducible, and the transposons i.e. R1-L2 and R2-L1 for filtering out genome transgenic structure both sides are sent out
The raw G4 deleted for transgenic bombyx mori, the G4 in the genome of transgenic bombyx mori only containing the attP positions being collectively aligned by 2
The external source destination gene expression frame sequence of point grappling, that is, obtain stabilization, replaceable type high-efficient transgenic silkworm expression system.
8. according to claim 7 efficiently turn base using compound piggyBac recombinant vectors preparation stabilization, replaceable type
Because of the method for silkworm expression system, it is characterised in that the Heat thermostability method is daily heat shock 3 times, and 42 DEG C of heat shocks 1 are small every time
When, continuous heat shock 3 ~ 5 days.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510055652.XA CN104673815B (en) | 2015-02-03 | 2015-02-03 | Compound piggyBac recombinant vectors and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510055652.XA CN104673815B (en) | 2015-02-03 | 2015-02-03 | Compound piggyBac recombinant vectors and its preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104673815A CN104673815A (en) | 2015-06-03 |
| CN104673815B true CN104673815B (en) | 2017-10-20 |
Family
ID=53309405
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510055652.XA Expired - Fee Related CN104673815B (en) | 2015-02-03 | 2015-02-03 | Compound piggyBac recombinant vectors and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104673815B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105154473B (en) * | 2015-09-30 | 2019-03-01 | 上海细胞治疗研究院 | A kind of transposon integration system of highly effective and safe and application thereof |
| CN108477082B (en) * | 2018-03-09 | 2019-12-17 | 北京中农富通园艺有限公司 | Method for instantly relieving diapause by heat shock of silkworms and delaying incubation by refrigeration |
| CN111534543A (en) * | 2020-05-07 | 2020-08-14 | 西南大学 | Eukaryotic CRISPR/Cas9 knockout system, basic vector, vector and cell line |
| CN111471714A (en) * | 2020-05-07 | 2020-07-31 | 西南大学 | Eukaryotic transgenic cell line mediated by Minos transposon system and construction method |
| CN111534542A (en) * | 2020-05-07 | 2020-08-14 | 西南大学 | PiggyBac transposon system mediated eukaryotic transgenic cell line and construction method thereof |
| CN114317588B (en) * | 2020-09-29 | 2023-06-27 | 中国农业科学院生物技术研究所 | Accurate methylation regulation and control return circuit of crop high temperature response formula genome |
| CN112852871A (en) * | 2021-01-15 | 2021-05-28 | 西南大学 | Cas9 system for efficiently editing silkworm genome and application thereof |
| CN114525305B (en) * | 2022-02-28 | 2023-10-24 | 西南大学 | Recombinant expression vector for automatically deleting exogenous DNA of first generation germ cells of transgenic silkworms and preparation method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103232977A (en) * | 2013-05-16 | 2013-08-07 | 西南大学 | Application of phiC31 recombinase system and piggyBac transposon and fixed point transgenetic system of silkworm and preparation method of fixed point transgenetic system |
-
2015
- 2015-02-03 CN CN201510055652.XA patent/CN104673815B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103232977A (en) * | 2013-05-16 | 2013-08-07 | 西南大学 | Application of phiC31 recombinase system and piggyBac transposon and fixed point transgenetic system of silkworm and preparation method of fixed point transgenetic system |
Non-Patent Citations (5)
| Title |
|---|
| Efficient strategies for changing the diapause character of silkworm eggs and for the germline transformation of diapause silkworm strains;Ai-Chun Zhao，et al;《Insect Science》;20121231;第19卷;172-182 * |
| FLP Recombinase-Mediated Site-Specific Recombination in Silkworm, Bombyx mori;Ding-Pei Long，et al;《PLOS ONE》;20120629;第7卷(第6期);e40150 * |
| Site-specific genomic targeting in Drosophila;Carsten Horn，et al;《PNAS》;20050830;第102卷(第35期);12483-12488 * |
| Transposon-free insertions for insect genetic engineering;Tarig H Dafa’alla,et al;《Nature Biotechnology》;20060731;第24卷(第7期);820-821 * |
| 基于位点特异性重组和piggyBac 转座系统的家蚕定点转基因体系的建立及应用;龙定沛等;《中国蚕学会第八届青年学术研讨会论文集》;20140831;74-75 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104673815A (en) | 2015-06-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104673815B (en) | Compound piggyBac recombinant vectors and its preparation method and application | |
| CN1860235B (en) | Expression systems for insect pest control | |
| CN101297031B (en) | PiggyBac used as genetic operation and analysis tool of vertebrate | |
| Handler et al. | Prospects for gene transformation in insects | |
| US7459599B2 (en) | Methods for producing proteins using silkworm middle silk gland-specific gene expression system | |
| CN107426986A (en) | A kind of method for cultivating male sterility culex | |
| US20150101541A1 (en) | Methods of producing new types of hybrid silk and hemp fibers | |
| CN110117617A (en) | A kind of method preparing the lethal silkworm strain of female embryo and in-between strain and construct | |
| CN110117613B (en) | Method for preparing male sterile lepidoptera insect and nucleic acid construct thereof | |
| CN103232977B (en) | Application of phiC31 recombinase system and piggyBac transposon and fixed point transgenetic system of silkworm and preparation method of fixed point transgenetic system | |
| CN106521638A (en) | Resource library of rat with gene mutation and preparation method thereof | |
| CN105400817A (en) | Method for simultaneously synthesizing and secreting black widow spider dragline silk protein 1 and protein 2 through bombyx mori | |
| CN106978416A (en) | A kind of assignment of genes gene mapping integrant expression system and its application | |
| CN103468741B (en) | The genes of individuals mutation method transposon-mediated by PiggyBac improved | |
| CN112553250B (en) | Method for preparing female sterile lepidopteran insects and nucleic acid construct thereof | |
| CN105969801A (en) | Bombyx mori middle silkgland bioreactor universal plasmid for expressing T4 ligase as well as application and method of universal plasmid | |
| JP4431739B2 (en) | Use of DNA encoding the silkworm kynurenine oxidase gene | |
| CN1234871C (en) | Construction method using detoxiase gene as stable expression system in silkworm | |
| CN114150016B (en) | Cultivation method of special silkworm variety for golden silk floss | |
| CN111849977B (en) | Method for preparing transgenic animals by sperm vector, sgRNA for preparing short and small transgenic chickens and preparation method | |
| CN114480509B (en) | Transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silk-secreting organs of silkworms and silkworm varieties thereof | |
| CN114525305B (en) | Recombinant expression vector for automatically deleting exogenous DNA of first generation germ cells of transgenic silkworms and preparation method and application thereof | |
| Hongjiu et al. | Efficient and stable generation of transgenic silkworm, Bombyx mori with the lepi-dopteran derived transposon piggyBac | |
| JP2003088274A (en) | Method for introducing polynucleotide to silkworm producing dormant egg | |
| CN114317613B (en) | Method for constructing lepidopteran insect female sterile line by utilizing genome editing technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20171020 Termination date: 20220203 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |