CN114480509B

CN114480509B - Transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silk-secreting organs of silkworms and silkworm varieties thereof

Info

Publication number: CN114480509B
Application number: CN202210214552.7A
Authority: CN
Inventors: 徐汉福; 曾文慧; 刘荣鹏; 马艳; 罗琴; 欧瑶; 马静文; 唐艺芸; 胡杰; 向仲怀
Original assignee: Southwest University
Current assignee: Southwest University
Priority date: 2022-03-04
Filing date: 2022-03-04
Publication date: 2023-09-05
Anticipated expiration: 2042-03-04
Also published as: CN114480509A

Abstract

The invention provides a transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silk organs of silkworms and a silkworm variety thereof, which specifically up-regulates BmFMBP1, bmE93 and BmSdRFP genes in silk gland cells at the rear parts of silkworms through a modified GAL4/UAS efficient binary expression system, so that the silk organs at the rear parts of silkworms completely degenerate and disappear, and still can normally spin and cocoon. According to the invention, the BmFMBP1, bmE93 and BmSdRFP genes are specifically and over-expressed in the rear silk gland of the silkworm by using a GAL4/UAS binary expression system, and the rear silk gland of the double-fluorescence positive offspring is found to be completely degenerated, but has silk-spinning and cocoon-forming capacity, and the cocoons are pure sericin cocoons, and the offspring are fertile, so that a powerful material foundation is provided for novel biological functional materials.

Description

Transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silk-secreting organs of silkworms and silkworm varieties thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silk-secreting organs of silkworms and silkworm varieties thereof.

Background

Silkworm is an important economic insect and lepidopteran mode insect. Breakthrough of the transgenic technology of silkworms in 2000 and determination of the whole genome sequence of silkworms in 2004 mark that human researches on silkworms begin to enter genome era. In particular to the establishment of a transgenic technology, which provides a key technical support for analyzing silkworm genes and developing novel silkworm varieties on an individual level.

Silk gland is the only silk producing organ of silkworm, which determines the silk yield and quality. In recent years, researchers have identified a large number of expressed genes from silkworm silk glands by using a plurality of chemical means, and what kind of functions these genes play in silk gland organ development and fibroin synthesis have been the focus and hot spot of research at home and abroad. Meanwhile, genetic modification is carried out on silk glands by utilizing a transgenic technology and key genes, so that the creation of novel silk materials with different functions or purposes is also an important content of research in the field.

The existing transgenic method for modifying silk gland of home mainly connects target gene to downstream of specific promoter to make it expressed under control, and then reveals biological function of target gene or obtains corresponding silk gland modification material. However, none of the existing methods achieve complete degeneration and disappearance of silk gland organs by targeted engineering of the target genes. The technical strategy for identifying the key genes and realizing complete degeneration of the silk gland organs by using the key genes is beneficial to deeper analysis of the functions of the silk gland genes, and provides theoretical reference for organ development regulation and control research. In particular, the silkworm gland is genetically modified to be completely degenerated, so that a pure sericin cocoon silkworm variety which can be inherited stably is created, and the development and application of the fibroin in the fields of biological materials, daily chemicals and the like can be expanded.

Disclosure of Invention

Based on the technical problems in the prior art, the invention provides a transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silk-secreting organs of silkworms and silkworm varieties thereof.

According to the technical scheme of the invention, a transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silk organs of silkworms is provided, wherein BmFMBP1 (SEQ ID NO. 1), bmE93 (SEQ ID NO. 2) and BmSdRFP (SEQ ID NO. 3) genes are specifically up-regulated in silk gland cells at the rear parts of silkworms through a modified GAL4/UAS efficient binary expression system, so that the silk organs at the rear parts of silkworms completely degenerate and disappear, and still can normally spin cocoons.

Further, the transgenic method for preparing the pure sericin cocoons by inducing complete degeneration of silk-secreting organs of silkworms comprises the following steps:

step S1, GAL4/UAS expression vector construction;

s2, preparing GAL4/UAS transgenic silkworms;

step S3, morphological observation is carried out on five-age day 6 (5L 6D) silk glands of the 3 rear silk gland specific over-expressed GAL4/UAS transgenic silkworms, and a camera is used for taking pictures;

s4, morphological observation is carried out on cocoon shells of the 3 rear silk gland-specific GAL4/UAS transgenic silkworms, and a camera is used for taking pictures;

and S5, extracting DNA from five-year-old sixth silk glands of the 3 rear silk gland-specific GAL4/UAS transgenic silkworms, carrying out PCR amplification on the extracted DNA according to designed primers, and carrying out nucleic acid electrophoresis on the amplification result.

The GAL4/UAS expression vector construction step comprises constructing a silkworm rear silk gland specific activation GAL4 expression vector and connecting a target gene expression vector by UAS.

Preferably, the GAL4 vector consists essentially of: silk fibroin heavy chain fibH was used as promoter (SEQ ID NO 4) [ NCBI gene ID: NM-001113262.1 ], the gene sequence of the GAL4 protein binding domain is the target sequence, GAL4BD (SEQ ID NO. 5).

More preferably, the UAS vector mainly comprises a 10 XUAS sequence (SEQ ID NO 6) and downstream target gene sequences, namely BmFMBP1 (SEQ ID NO 1), bmE93 (SEQ ID NO 2) and BmSdRFP (SEQ ID NO 3).

Further, the production of GAL4/UAS transgenic silkworms comprises: the GAL4 transgenic silkworms with red fluorescence and UAS transgenic silkworms with cyan fluorescence are obtained through microinjection of the two expression vectors by silkworm embryos, and the two transgenic silkworms are hybridized pairwise to obtain the over-expression transgenic silkworms with red fluorescence and cyan fluorescence.

According to another aspect of the present invention, there is provided a silkworm variety obtained by a transgenic method for inducing complete degeneration of silk-secreting organs of silkworms, which is obtained by specifically up-regulating BmFMBP1 (SEQ ID NO. 1), bmE93 (SEQ ID NO. 2) and BmSdRFP (SEQ ID NO. 3) genes in rear silk gland cells of silkworms through a modified GAL4/UAS efficient binary expression system, resulting in complete degeneration and disappearance of rear silk gland organs, but still normal silk-laying and cocoon-forming, and the offspring are fertile.

Compared with the prior art, the transgenic method for preparing the pure sericin cocoons by inducing complete degeneration of silk-secreting organs of silkworms and the silkworm varieties thereof have the beneficial effects that:

1. the transgenic method for inducing complete degeneration of silk gland organs at the rear part of the silkworms by genetic modification and the method enrich the variety resource materials of the silkworms.

2. According to the invention, the GAL4/UAS binary expression system is used for specifically over-expressing BmFMBP1 (SEQ ID NO. 1), bmE93 (SEQ ID NO. 2) and BmSdRFP (SEQ ID NO. 3) genes in the rear silk gland of the silkworm, and the rear silk gland of the double-fluorescence positive offspring is found to be completely degenerated, but the silkworm has silk-spinning and cocoon-forming capabilities, the cocoons are pure sericin cocoons, and the offspring are fertile, so that a powerful material foundation is provided for novel biological functional materials.

Drawings

FIG. 1 is a graph showing the results of the prepared rear silk gland-specific GAL4/UAS transgenic silkworms;

FIG. 2 is a schematic diagram of the silk gland of a transgenic silkworm with the rear silk gland specificity GAL4/UAS over-expression BmSdRFP (SEQ ID NO. 3);

FIG. 3 is a schematic diagram of the cocoon shells of the rear silk gland-specific GAL4/UAS overexpressing BmSdRFP (SEQ ID NO. 3) transgenic silkworms;

FIG. 4 is a schematic diagram of the silk gland of a transgenic silkworm with the rear silk gland specificity GAL4/UAS over-expression BmFMBP1 (SEQ ID NO. 1);

FIG. 5 is a schematic diagram of the cocoon shells of a rear silk gland-specific GAL4/UAS overexpressing BmFMBP1 (SEQ ID NO. 1) transgenic silkworm;

FIG. 6 is a schematic diagram of the silk gland of a rear silk gland specific GAL4/UAS over-expressed BmE93 (SEQ ID NO. 2) transgenic silkworm;

FIG. 7 is a graph showing the result of genome identification of a transgenic silkworm with rear silk gland-specific GAL4/UAS over-expression BmSdRFP (SEQ ID NO. 3);

FIG. 8 is a graph showing the result of genome identification of a transgenic silkworm with rear silk gland-specific GAL4/UAS over-expression BmFMBP1 (SEQ ID NO. 1);

FIG. 9 is a graph showing the result of genome identification of a transgenic silkworm with rear silk gland-specific GAL4/UAS over-expression BmE93 (SEQ ID NO. 2).

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the technical solutions, but not all embodiments. All other embodiments, which are obtained by a person skilled in the art without making any inventive effort, are within the scope of the present invention based on the embodiments of the present technical solution. In addition, the scope of the present invention should not be limited to the specific structures or components or the specific parameters described below.

The invention provides a silkworm variety of a transgenic method for inducing complete degeneration of silkworm silk-secreting organs, which specifically up-regulates BmFMBP1 (SEQ ID NO. 1), bmE93 (SEQ ID NO. 2) and BmSdRFP (SEQ ID NO. 3) genes in silkworm rear silk gland cells through a modified GAL4/UAS efficient binary expression system to cause complete degeneration and disappearance of rear silk gland organs, but still can normally spit silk cocoons, and cocoons are pure sericin cocoons, and offspring are fertile. The invention provides a new method and means for silkworm variety resources and provides a material foundation for diversified development and utilization of silk.

The GAL4/UAS binary expression system is a set of specific promoters for driving GAL4 (transcription activator), which can specifically recognize and bind to UAS sequences so as to activate transcription of downstream target genes. Silk glands are the only silk-spinners of silkworms, which determine the yield and quality of silk, and are an important functional organ. Silk is mainly composed of silk fibroin secreted by the posterior silk gland and sericin secreted by the middle silk gland.

The invention provides a transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silk-secreting organs of silkworms, which comprises the following steps:

step S1, GAL4/UAS expression vector construction:

constructing a silkworm rear silk gland specific activation expression GAL4 vector and an expression vector connected with a target gene by UAS. The GAL4 vector mainly comprises: silk fibroin heavy chain fibH was used as promoter (SEQ ID No. 4) [ NCBI gene ID: NM-001113262.1 ], the gene sequence of the GAL4 protein binding domain is the target sequence, GAL4BD (SEQ ID NO. 5); the UAS vector mainly comprises a 10 XUAS sequence (SEQ ID NO 6) and downstream target gene sequences, namely BmFMBP1 (SEQ ID NO. 1), bmE93 (SEQ ID NO. 2) and BmSdRFP (SEQ ID NO. 3).

Step S2, manufacturing GAL4/UAS transgenic silkworms:

the GAL4 transgenic silkworms with red fluorescence and UAS transgenic silkworms with cyan fluorescence are obtained through microinjection of the two expression vectors by silkworm embryos, and the two transgenic silkworms are hybridized pairwise to obtain the over-expression transgenic silkworms with red fluorescence and cyan fluorescence.

And S3, carrying out morphological observation on five-year-old sixth silk glands of the 3 rear silk gland-specific over-expressed GAL4/UAS transgenic silkworms, and taking pictures by using a camera.

Step S4, morphological observation is carried out on cocoon shells of the 3 rear silk gland-specific GAL4/UAS transgenic silkworms, and a photo is taken by a camera.

And S5, extracting DNA from five-year-old sixth silk glands of the 3 rear silk gland-specific GAL4/UAS transgenic silkworms, carrying out PCR amplification on the extracted DNA according to designed primers, and carrying out nucleic acid electrophoresis on the amplification result. According to the size of the designed primer and the amplified size, the success of the transgene is demonstrated.

Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The experimental methods for which specific conditions are not specified in the examples are generally conducted under conventional conditions or under conditions recommended by the manufacturer.

EXAMPLE 1 construction of silkworm rear-silk gland-specific GAL4/UAS expression vector

Step S1 construction of a posterior silk gland-specific GAL4 expression vector

Sequentially placing the silkworm fibH gene promoter sequence (SEQ ID NO. 4) [ NCBI gene ID: NM-001113262.1 ] forms a gene expression cassette of interest in tandem with GAL4BD gene sequence (SEQ ID NO. 5), protein domain sequence VP16 (SEQ ID NO. 7) activating gene expression and termination signal Ser1-poly A (SEQ ID NO. 8), by cleaving the backbone vector pBac [3 XP 3-DsRed ] and the gene expression cassette of interest using AscI, the backbone vector is completed by the steps of: first, a 3×P3-DsRed sequence (SEQ ID NO. 9) consisting of a 3-fold repeated P3 promoter (eye-and nerve-specific promoter) driven to express a red fluorescent protein (DsRed) sequence was assembled; the right piggyBac arm (SEQ ID NO. 10) and the left piggyBac arm (SEQ ID NO. 11) were then assembled at the 5 'and 3' ends of the 3 XP 3-DsRed sequence (SEQ ID NO. 9), respectively. Subsequently, the expression vector of the silkworm rear silk gland specific GAL4 was successfully constructed and named HG4 by linking with T4 ligase.

Step S2, constructing UAS transgenic expression vector taking BmFMBP1 as target gene

The UAS tandem over-expression BmFMBP1 (SEQ ID NO. 1) expression frame is as follows: 10 XUAS sequence (SEQ ID NO 6), bmFMBP1 (SEQ ID NO 1) as target gene, ser1-polyA as termination signal (SEQ ID NO 8), by using FseI and BgIII to cut the backbone vector pBac [3 XP 3-ECFP ] and target gene expression frame, the backbone vector is completed by the following steps: first, a 3 XP 3-ECFP sequence (SEQ ID NO. 12) consisting of a 3-fold repeated P3 promoter (eye-and nerve-specific promoter) driven to express a cyan fluorescent protein (ECFP) sequence was assembled; the right piggyBac arm (SEQ ID NO. 10) and the left piggyBac arm (SEQ ID NO. 11) were then assembled at the 5 'and 3' ends of the 3 XP 3-ECFP sequence (SEQ ID NO. 12), respectively. And then linking by T4 ligase to finally form the UAS over-expression BmFMBP1 (SEQ ID NO. 1) transgene expression vector.

Step S3, constructing a UAS transgenic expression vector taking BmE93 as a target gene

Unlike step S2 above, the target gene is BmE93 (SEQ ID NO. 2), i.e., UAS tandem over-expressed BmE93 (SEQ ID NO. 2) expression cassette is: 10 XUAS sequence (SEQ ID NO 6), bmE93 (SEQ ID NO 2) as the target gene, ser1-polyA (termination signal) (SEQ ID NO 8), and the backbone vector pBac [3 XP 3-ECFP ] and the target gene expression cassette were cut by using FseI and BgIII, and the backbone vector was completed by the steps of: first, a 3 XP 3-ECFP sequence (SEQ ID NO. 12) consisting of a 3-fold repeated P3 promoter (eye-and nerve-specific promoter) driven to express a cyan fluorescent protein (ECFP) sequence was assembled; and then respectively assembling a right piggyBac arm (SEQ ID NO. 10) and a left piggyBac arm (SEQ ID NO. 11) at the 5 'end and the 3' end of the 3 XP 3-ECFP sequence (SEQ ID NO. 12), and linking by a T4 ligase to finally form the UAS over-expression BmE93 (SEQ ID NO. 2) transgene expression vector.

S4, constructing UAS transgenic expression vector with BmSdRFP as target gene

Unlike step S2 above, the target gene is BmSdRFP (SEQ ID NO. 3), i.e., the UAS tandem overexpressed BmSdRFP (SEQ ID NO. 3) expression cassette is in sequence: 10 XUAS sequence (SEQ ID NO 6), bmSdRFP (SEQ ID NO 3) as the target gene, ser1-polyA as the termination signal (SEQ ID NO 8), and the backbone vector pBac [3 XP 3-ECFP ] and the target gene expression cassette were cut by using FseI and BgIII, and the backbone vector was completed by the steps of: first, a 3 XP 3-ECFP sequence (SEQ ID NO. 12) consisting of a 3-fold repeated P3 promoter (eye-and nerve-specific promoter) driven to express a cyan fluorescent protein (ECFP) sequence was assembled; and then respectively assembling a piggyBac right arm (SEQ ID NO. 10) and a piggyBac left arm (SEQ ID NO. 11) at the 5 'end and the 3' end of the 3 XP 3-ECFP sequence (SEQ ID NO. 12), and linking by a T4 ligase to finally form the UAS over-expression BmSdRFP (SEQ ID NO. 3) transgene expression vector.

EXAMPLE 2 production of GAL4/UAS transgenic silkworms

Step S1 transgenic injection and fluorescence screening

After the GAL4/UAS transgenic expression vector is obtained, the GAL4/UAS transgenic expression vector is mixed with auxiliary plasmid (A4 Helper) 1:1 respectively at the concentration of 450 ng/mu L (nanogram/microliter), the mixture is injected by an Eppendorf microinjection instrument, a plurality of silkworm Nistari (a plurality of batches of silkworm materials can be fed in one year) is used as an injection receptor, silkworm moth mating for 6 hours before injection, the mixture is placed for one day at the temperature of 4 ℃, the mixture is taken out for spawning at room temperature, embryo which is just spawned for one hour is taken, the embryo is stuck on a glass sheet by paste, the mixture is injected by an Eppendorf microinjection instrument, the mixture is sealed by nontoxic glue, and is sterilized by 35% formaldehyde steam for 5 minutes and then placed in an environment with the relative humidity of 85%, the mixture is hatched in the environment of 25 ℃, the hatched G0 generation (the first generation after injection) silkworm is fed to the silkworm moth, the obtained G0 generation (the first generation after injection) silkworm moth is subjected to selfing or backcrossing to obtain the G1 generation (the second generation of egg silkworm), the fluorescent gene is screened by using an Opendorf microscope, and the fluorescent gene of the silkworm with the fluorescent gene of SEQ ID 2 and the fluorescent gene of the GAmL 4 (SEQ ID) is obtained by transferring the fluorescent gene of the egg 1 and the fluorescent gene of the silkworm (GAmL 2, and the fluorescent gene of the egg transgenic expression vector of the silkworm (BmBmBmID). And the seeds are normally kept after the first generation of breeding.

Step S2, preparation of transgenic silkworms with BmFMBP1 overexpression

The screened eye and nerve red fluorescence GAL4 transgenic silkworms are named HG4 and are bred to chemical moth, then the screened eye and nerve cyan fluorescence UAS transgenic silkworms are named BmFMBP1 (SEQ ID NO. 1) and hybridized pairwise, after spawning eggs, the spawned offspring are hatched in an environment with the temperature of 25 ℃ and the relative humidity of 85%, the hatched offspring are bred to four ages, and the screened silkworms are bred to obtain the specific expressed blue fluorescence GAL4/UAS transgenic silkworms in the eyes of the transgenic silkworms, and the result is shown in the attached figure 1, and the result shows that the transgenic silkworms with the over-expressed BmFMBP1 (SEQ ID NO. 1) are successfully produced and then are bred normally to the material-drawing stage.

Step S3, preparation of BmE93 transgenic silkworms

The GAL4 transgenic silkworms which emit red fluorescence through the selected eyes and nerves are named HG4 and are bred to chemical moths, then the cross breeding is carried out with the UAS transgenic silkworms which emit cyan fluorescence through the selected eyes and nerves, named BmE93 (SEQ ID NO. 2), after spawning, the spawning is carried out in an environment with the temperature of 25 ℃ and the relative humidity of 85%, the hatching offspring are bred to four ages, and the GAL4/UAS transgenic silkworms which emit both blue fluorescence and red fluorescence and are specifically expressed in the eyes of the transgenic silkworms are obtained through the screening, and the result is shown in the attached figure 1, and the result shows that the transgenic silkworms which overexpress BmE93 (SEQ ID NO. 2) are successfully produced and then are bred to the material-drawing stage normally.

Step S4, preparation of over-expressed BmSdRFP transgenic silkworms

The GAL4 transgenic silkworms which emit red fluorescence through the selected eyes and nerves are named HG4 and are bred to chemical moths, then the cross breeding is carried out with the UAS transgenic silkworms which emit cyan fluorescence through the selected eyes and nerves, named BmSdRFP (SEQ ID NO. 3), after spawning, the offspring are hatched in an environment with the temperature of 25 ℃ and the relative humidity of 85 percent, the offspring are bred to four ages, and the transgenic silkworms which emit both blue fluorescence and red fluorescence which are specifically expressed in the eyes of the transgenic silkworms are obtained through the screening, and the result is shown in the attached figure 1, and the transgenic silkworms which overexpress BmSdRFP (SEQ ID NO. 3) are proved to be successfully produced and then are bred to the material-drawing stage normally.

Example 3 silk gland phenotype observations of transgenic silkworms overexpressing BmFMBP1

Step S1 raising wild type silkworms Nistari and over-expressed BmFMBP1 (SEQ ID NO. 1) transgenic silkworms, namely GAL4/UAS transgenic silkworms which emit both blue fluorescence and red fluorescence specifically expressed in the eyes of silkworms, to five ages, dissecting and observing five ages of the wild type silkworms Nistari and over-expressed BmFMBP1 (SEQ ID NO. 1) transgenic silkworms in a buffer solution of 1 XPBS (phosphate buffer solution), and photographing, and the result is that the rear silk gland of the over-expressed BmFMBP1 (SEQ ID NO. 1) transgenic silkworms is completely degenerated compared with the rear silk gland of the wild type silkworms Nistari, as shown in FIG. 2.

Example 4 cocoon phenotype observations of transgenic silkworms overexpressing BmFMBP1

Step S1, raising wild silkworm Nistari and over-expressed BmFMBP1 (SEQ ID NO. 1), namely GAL4/UAS transgenic silkworms which are specifically expressed in eyes of silkworms and emit blue fluorescence and red fluorescence, to cocooning frames, then observing the cocoon shells of the wild silkworm Nistari and over-expressed BmFMBP1 (SEQ ID NO. 1), photographing, and compared with the wild silkworm Nistari cocoon shells, over-expressing BmFMBP1 (SEQ ID NO. 1) is pure sericin cocoons.

Example 5 Silk gland phenotype observation of transgenic silkworms overexpressing BmE93

Step S1, wild type silkworms Nistari and over-expressed BmE93 (SEQ ID NO. 2) transgenic silkworms, namely GAL4/UAS transgenic silkworms which emit blue fluorescence and red fluorescence specifically expressed in eyes of silkworms, were bred to five ages, and the rear silk glands of the wild type silkworms Nistari and over-expressed BmE93 (SEQ ID NO. 2) transgenic silkworms were completely degenerated as compared with the rear silk glands of the wild type silkworms Nistari by dissecting and observing the five ages of the six days silk glands of the wild type silkworms Nistari and over-expressed BmE93 (SEQ ID NO. 2) transgenic silkworms in a buffer solution of 1 XPBS, and photographed, as a result shown in FIG. 4.

Example 6 Silk gland phenotype observation of transgenic silkworms overexpressing BmSdRFP

Step S1, wild type silkworms Nistari and over-expressed BmSdRFP (SEQ ID NO. 3) transgenic silkworms, namely GAL4/UAS transgenic silkworms which emit blue fluorescence and red fluorescence specifically expressed in eyes of silkworms, are bred to five ages, and the wild type silkworms Nistari and the over-expressed BmSdRFP (SEQ ID NO. 3) transgenic silkworms five ages six days old silk glands are dissected and observed in a buffer solution of 1 XPBS, and photographed, and the result is that the rear silk glands of the over-expressed BmSdRFP (SEQ ID NO. 3) transgenic silkworms are completely degenerated compared with the rear silk glands of the wild type silkworms Nistari as shown in the attached FIG. 5.

Example 7 cocoon phenotype observations of transgenic silkworms overexpressing BmSdRFP

Step S1, raising wild silkworm Nistari and over-expressed BmSdRFP (SEQ ID NO. 3), namely, specifically expressed GAL4/UAS transgenic silkworms which emit blue fluorescence and red fluorescence in the eyes of the silkworms, up-mounting, observing the cocoon shells of the wild silkworm Nistari and over-expressed BmSdRFP (SEQ ID NO. 3), photographing, and compared with the wild silkworm Nistari cocoon shells, over-expressing BmSdRFP (SEQ ID NO. 3) is pure sericin cocoons.

Example 8 molecular characterization of transgenic silkworms overexpressing BmFMBP1

Step S1 wild silkworm Nistari and PSG were dissected for specific overexpression of BmFMBP1 (SEQ ID NO. 1) transgenic silkworms for the fifth day of age silk gland and collected by 1.5mL centrifuge tubes.

Step S2, extracting genome from the dissected and collected silk glands, wherein the extraction method comprises the following steps:

(1) Cleaning the mortar and the grinding rod, and sterilizing in an oven at 180 ℃ for 2-3 hours. Before the grinding operation is carried out, the silk gland, the mortar and the grinding rod are required to be subjected to liquid nitrogen precooling treatment. After precooling, the silk gland is ground to powder and then transferred into a centrifuge tube with the volume of 1.5mL, and the silk gland is stored in liquid nitrogen or at the temperature of minus 80 ℃ for standby.

(2) 1mL of DNA extraction Buffer (Buffer) was added to the centrifuge tube and vortexed at 3000rpm (revolutions per minute) to mix well. RNase was added at a working concentration of 100. Mu.L/mL (microliter/milliliter), and the mixture was placed in a thermostatic waterbath at 37℃for digestion for 1 hour, then proteinase K was added thereto, and the mixture was digested in a waterbath at 55℃overnight.

(3) After adding an equal volume of Tris-saturated phenol to the centrifuge tube, shaking thoroughly for 10min, followed by centrifugation at 13400rpm for 10min at 4℃and taking 600. Mu.L of the supernatant to a new centrifuge tube.

(4) 600. Mu.L of Tris phenol/chloroform was thoroughly spun and shaken for 10min, then centrifuged at 13400rpm at 4℃for 10min, and the supernatant was transferred to a new centrifuge tube.

(5) The supernatant was subjected to shaking with sufficient rotation for 10min in chloroform of the same volume as the supernatant, and then centrifuged at 13400rpm for 10min at 4℃to collect the supernatant.

(6) Adding absolute ethyl alcohol precooled at 4 ℃ into a centrifuge tube in an equal volume, slightly reversing the solution until uniform white flocculent precipitate appears, and standing for 5min.

(7) The pellet was carefully picked up with a sterile gun head and transferred to a new 1.5mL centrifuge tube, washed 1-2 times with pre-chilled 75% ethanol at 4℃and centrifuged at 13400rpm for 10min at 4℃and the supernatant discarded.

(8) The centrifuge tube lid was opened, and left at room temperature until ethanol was evaporated, and 30-50. Mu.L of EB buffer was added to dissolve DNA pellet.

(9) Detecting DNA purity and concentration by using a spectrophotometer, and performing gel electrophoresis detection on the agarose gel, and then placing the obtained product at-80 ℃ for long-term storage for standby.

Step S3 genome PCR:

(1) The Primer of BmFMBP1 (SEQ ID NO. 1) is designed by using Primer5 software, and is synthesized by Huada genes, and after the Primer is synthesized, ultrapure water is added for dissolving and diluting, and then the Primer is stored at 4 ℃.

(2) PCR amplification of target fragment is carried out by taking the extracted genome as a template, and the reaction system is as follows:

1. Mu.L of genomic DNA;

dNTP (deoxyribonucleoside triphosphate) 0.8. Mu.L;

HiFi Taq enzyme 0.1. Mu.L;

forward and reverse primers were each 0.2 μl;

buffer I1. Mu.L;

double distilled water 6.7 mu L;

a total of 10. Mu.L of the system;

(3) The PCR amplification conditions were as follows:

pre-denaturation at 94℃for 5min;

denaturation at 94℃for 30s;

annealing at 50 ℃ for 30s;

extending at 72 ℃ for 30s;

repeat 35 cycles;

72℃10min；

after the reaction, 1% agarose gel was prepared, and 5. Mu.L of PCR amplification product was taken for electrophoresis detection. The detection result is shown in figure 7. The result proves that the transgenic silkworm with the over-expression BmFMBP1 (SEQ ID NO. 1) is successfully produced.

Example 9 molecular characterization of transgenic silkworms overexpressing BmE93

Step S1 wild silkworm Nistable and PSG were dissected for specific overexpression of BmE93 (SEQ ID NO. 2) transgenic silkworms for the fifth day of age silk gland and collected by 1.5mL centrifuge tubes.

(2) 1mL of DNA extraction Buffer was added to the centrifuge tube and vortexed at 3000 rpm. RNase was added at a working concentration of 100. Mu.L/mL, and the mixture was digested in a thermostatic waterbath at 37℃for 1 hour, then proteinase K was added thereto, and the mixture was digested in a waterbath at 55℃overnight.

(8) The centrifuge tube lid was opened, allowed to stand at room temperature until ethanol was evaporated, and 30-50. Mu.L of TE buffer was added to dissolve DNA precipitate.

Step S3 genome PCR:

(1) The Primer5 software is used for designing BmE93 (SEQ ID NO. 2) Primer, the Primer is synthesized by Huada genes, and the Primer is dissolved and diluted by ultrapure water and then stored at 4 ℃.

1. Mu.L of genomic DNA;

dNTP (deoxyribonucleoside triphosphate) 0.8. Mu.L;

HiFi Taq enzyme 0.1. Mu.L;

forward and reverse primers were each 0.2 μl;

buffer I1. Mu.L;

double distilled water 6.7 mu L;

a total of 10. Mu.L of the system;

(3) The PCR amplification conditions were as follows:

pre-denaturation at 94℃for 5min;

denaturation at 94℃for 30s;

annealing at 50 ℃ for 30s;

extending at 72 ℃ for 30s;

repeat 35 cycles;

72℃10min；

after the reaction, 1% agarose gel was prepared, and 5. Mu.L of PCR amplification product was taken for electrophoresis detection. The detection result is shown in figure 8. The result proves that the transgenic silkworm with the over-expression BmE93 (SEQ ID NO. 2) is successfully produced.

Example 10 molecular characterization of transgenic silkworms overexpressing BmSdRFP

Step S1 wild silkworm Nistari and PSG were dissected for specific overexpression of BmSdRFP (SEQ ID NO. 3) transgenic silkworms for the fifth day of age silk gland and collected by 1.5mL centrifuge tubes.

Step S3 genome PCR:

(1) The Primer5 software is used for designing a BmSdRFP (SEQ ID NO. 3) Primer, the Primer is synthesized by Huada genes, and after the Primer is synthesized, ultrapure water is added for dissolving and diluting, and then the Primer is stored at 4 ℃.

1. Mu.L of genomic DNA;

dNTP (deoxyribonucleoside triphosphate) 0.8. Mu.L;

HiFi Taq enzyme 0.1. Mu.L;

forward and reverse primers were each 0.2 μl;

buffer I1. Mu.L;

double distilled water 6.7 mu L;

a total of 10. Mu.L of the system;

(3) The PCR amplification conditions were as follows:

pre-denaturation at 94℃for 5min;

denaturation at 94℃for 30s;

annealing at 50 ℃ for 30s;

extending at 72 ℃ for 30s;

repeat 35 cycles;

72℃10min。

after the reaction, 1% agarose gel was prepared, and 5. Mu.L of PCR amplification product was taken for electrophoresis detection. The detection result is shown in figure 9. The result proves that the transgenic silkworms with the over-expressed BmSdRFP (SEQ ID NO. 3) are successfully produced.

SEQ ID NO.1 BmFMBP1 gene sequence:

atgggtgatttaagtcaagcagatagttcttggaagaaaatggttatagctaaaacaaacaatgagtggaaatcatctgtcggtgaagatgcgaatgcagctagtaacactacacactttagattaagtgatgaatgcatacaatacgataacattaaaaaagaaattgaggaaattgatgaacaagagacactcaataccgtcgagccggtcgatatgatacaagaaatggacccactatcattgttggagcctaaagcgcgtagacgaaggaaaggctcaggaccaaagagtgaaacatcagaagagagagccgcacggctagccaagatgtctgcatatgcagcacagaggctggcaaatgagtcaccggaacagcgcgccactagactgaagcgtatgtccgaatatgcagctaaaagactttcatcagagacgagagaacagagagcgattaggttggcaagaatgtctgcatatgcagcccgtcgacttgctaatgagaccccagcacaaaggcaagctagactattgaggatgtcggcatatgctgcgaaaaggcaggctagcaagaagtctcttagtacagtgaacgatagcttgaattacagtattatgccgaatcaaagtagagcaactaatcatccattcactggtaagcctatccctaaccctctcctcggtctcgattctacgtaa

SEQ ID NO.2 BmE93 Gene sequence

atgggtagaagaaaatggaaactatatcaggacgcgttaataccaaagcgaaacgaacaggacgattcagacgattcgatgccatccaccgacccgcccccggcgctcaagatcaaaaccatcgaggaaatcaacgcgccagaagacgagaggcccagggtcgagagcgatggaaacggccaagagtcgaagacgtcacggccggagacgatcctggagagtctgatcaagaggccggcgacgcagccgaaagtggaagtcctagaggaaccagcggattggaagccgccagacaagtgctacttctgcgtagatggtgagcccagggctacagctgaagctgctcaacccgtcggcgctaccagtcccgcgtcagagtccgatagcagttctgtgtccggcacgaacagtccagctgcggctcctccactgctgcagcatctcctgcagctccaagcgcagaacccacagactatagcacagttccagcagatgatagcggcgttgacggcgctgggcacggggctggtgcctccaccgctcacgcaggcctggatgatgcagaggttcgcgcagcagcgacaccaggccgacaggttgtctgaaagcgataaagcggcggccccttcgtctccaagtcctgtagaacagccgttagacctgagcgccaagtccacgtccagcaccagcggtacgcctccgcctgaccccaaattcttggatagcagattaagacgaacagctttagatggagcatcgaatagcacggggcggcgcacttacacggaagacgagctgcagtcagccctgcgcgacatccagtcggggcggctcggcacgcgacgggctgccgtgctttacggcatcccacgctccaccctacggaacaaggtcaacaagttcggcctcgtcgcggataaccacgactccgaccccgacagcgaccaggaccgcgccgagtctccgccttctgtcatactcaagataccgaccttccctccccccgatgacaagagcccgtcaccagcgacgccagtcactacgccgatcacccccctcacgccgctcatctcccagccgccagctggttcccaacacatttttacgtcgttgaatgacgttatagcgaaaagcataagtcagaaattccagcagccgctcgacaggacacaccaagcggacctttccttcatgagagcgccggacgctcgacacgtgtcagtcatcaagagccaatctgacaaccaaaggaactacgcgatgccgagcaattccaaggtgcctacgaacaataacggccaagccgccgctggaggcaagggcactagacccaagaggggtaaatataggaactacgatcgagacagcctcgttgaggcggtgaaagcagtccagcgaggagagatgtccgtgcaccgcgccggctcttattacggtgtcccccactcaacgctcgaatacaaagtcaaggaaagacatttaatgcggcctaggaagcgcgaaccaaaacctcctccacaagatacgaagccgcagcctcctaagccgctcccaccgaagccgccgggcaagccattctcaaacaaactccgtccgcggaacggcacccccgcgcccagcccgccccccgcgccgcctgaccgcgccgactacaaggacgacgacgacaagtag

SEQ ID NO.3 BmSdRFP Gene sequence

Atgtcggcggcggacgcggagggcgtctggagtcccgacatcgaacagagcttccaagaggcgctggcgatatacccgccctgtggacgacgcaaaattattctctccgacgagggcaagatgtacggaaggaacgagttaatagcgaggtatattaaactaaggacaggcaaaacgcgtacgagaaaacaagtctcgtcacacatacaggtgctagctaggcgaaaactacgagaaattcaagccaaacttaaagtgcaattttggcagccaggcctacaagccggcacatcacaggatgtgaagcctttccccggtgcgggctacaaaggcgtccccggtgtcggaggcgtcggagtgccgagcggcaccgacgtggcgccgccgccgccctgggagggacgcgccatcgccacacacaaactgagactcgtagagttctccgccttcgtcgagcatccccgggatcctgatacgtacccaccgagcacggcgccggcgcaacatctcttcgttcacataggcggtacggtcacatacgcggatcctttattagagtcagtagacgttcagcagataaacgacaaattccctgagaagaagggcggtctgaaggaactgtacgagaaaggtccgaggaacgccttcttcctggtcaagttctgggcggatctcaacacgaacaacctcgacgaccccggcgccttctacggcgtcacaagtgtatacgaaagtaatgagaacatgacgataacgtgtagcacgaaagtgtgttcgttcgggaagcaggtggtcgaaaaggtggaaactgaatacgcccggttcgagggcggtcgcttcgtgtaccgcatccacaggtcgccgatgtgcgagtacatggtcaacttcatacacaaactgaaacatctgcccgagaagtacatgatgaacagcgtactagaaaacttcactatactacaggtagtttcaaaccgagacacgcaagagacattactgtgcgccgcgttcgtatttgaagtgtcgaacagtgagcacggggcgcagcatcacatctacaggctcgtcaaagatatggtgcgctcctccaagaacgtcatcaaggagttcatgcgcttcaaggtgcgcatggagggcaccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggccacaacaccgtgaagctgaaggtgaccaagggcggccccctgcccttcgcctgggacatcctgtccccccagttccagtacggctccaaggtgtacgtgaagcaccccgccgacatccccgactacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggctgcttcatctacaaggtgaagttcatcggcgtgaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggcgagatccacaaggccctgaagctgaaggacggcggccactacctggtggagttcaagtccatctacatggccaagaagcccgtgcagctgcccggctactactacgtggactccaagctggacatcacctcccacaacgaggactacaccatcgtggagcagtacgagcgcaccgagggccgccaccacctgttcctgtag

SEQ ID NO.4 silkworm fibH gene promoter sequence

cctgcgtgatcaggaaaaatgtggaaagcttaacgattttgtcacattttacttatcacaacttgtttttataataattcgcttaaatgagcagctattacttaatctcgtagtggtttttgacaaaatcagcttctttagaactaaaatatcatttttttcgtaatttttttaatgaaaaatgctctagtgttatacctttccaaaatcaccattaattaggtagtgtttaagcttgttgtacaaaactgccacacgcatttttttctccactgtaggttgtagttacgcgaaaacaaaatcgttctgtgaaaattcaaacaaaaatattttttcgtaaaaacacttatcaatgagtaaagtaacaattcatgaataatttcatgtaaaaaaaaaatactagaaaaggaatttttcattacgagatgcttaaaaatctgtttcaaggtagagatttttcgatatttcggaaaattttgtaaaactgtaaatccgtaaaattttgctaaacatatattgtgttgttttggtaagtattgacccaagctatcacctcctgcagtatgtcgtgctaattactggacacattgtataacagttccactgtattgacaataataaaacctcttcattgacttgagaatgtctggacagatttggctttgtatttttgatttacaaatgtttttttggtgatttacccatccaaggcattctccaggatggttgtggcatcacgccgattggcaaacaaaaactaaaatgaaactaaaaagaaacagtttccgctgtcccgttcctctagtgggagaaagcatgaagtaagttctttaaatattacaaaaaaattgaacgatattataaaattctttaaaatattaaaagtaagaacaataagatcaattaaatcataattaatcacattgttcatgatcacaatttaatttacttcatacgttgtattgttatgttaaataaaaagattaatttctatgtaattgtatctgtacaatacaatgtgtagatgtttattctatcgaaagtaaatacgtcaaaactcgaaaattttcagtataaaaaggttcaactttttcaaatcagcatcagttcggttccaactctcaag

SEQ ID NO.5 GAL4BD gene sequence

atgaaactgctctcatcaatcgaacaggcctgtgacatttgtagactcaaaaaactcaaatgctccaaggagaaacccaaatgtgccaaatgcctgaaaaacaactgggagtgccggtactctcctaaaaccaaacggagccctctcacacgggcccatctcactgaagtggaatctcgactcgaacggctcgaacagctctttctgctcatctttcctagagaggatctcgacatgatcctgaaaatggatagcctccaggacatcaaagccctgctcactggactgtttgtccaggataacgtgaacaaggacgccgtgaccgataggctggcatccgtggaaaccgatatgccactcacactgagacagcaccggattagtgccacatcttcttccgaggagtcatccaataagggacagcgacagctcaccgtgtca

SEQ ID NO.6 10 XUAS sequence

cggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggaagcttgcatgcctgcaggtcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagactctagcgagcgccggagtataaatagaggcgcttcgtctacggagcgacaattcaattcaaacaagcaaagtgaacacgtcgctaagcgaaagctaagcaaataaacaagcgcagctgaacaagctaaacaatctgcagtaaagtgcaagttaaagtgaatcaattaaaagtaaccagcaaccaagtaaatcaactgcaactactgaaatctgccaagaagtaattattgaatacaagaagagaactctgaatagggaattgg

SEQ ID NO.7 protein activation domain VP16 sequence

tgcaccgcccctattaccgatgtgtctctgggcgacgaactccggctggatggcgaggaagtcgatatgacccctgccgacgctctcgacgatttcgacctggaaatgctgggagatgtcgaatctccttctcctggcatgacacacgatcccgtgtcttacggagcactggatgtgtaa

SEQ ID NO.8 termination signal Ser1-poly A sequence

tacaactaaacacgacttggagtattccttgtagtgtttaagattttaaatcttacttaatgacttcgaacgattttaacgataactttctctttgtttaactttaatcagcatacataaaaagccccggttttgtatcgggaagaaaaaaaatgtaattgtgttgcctagataataaacgtattatcaaagtgtgtggttttcctttaccaaagacccctttaagatgggcctaatgggcttaagtcgagtcctttccgatgtgttaaatacacatttattacactgatgcgtcgaatgtacacttttaataggatagctccactaaaaattattttatttatttaatttgttgcaccaaaactgatacattgacgaa

SEQ ID NO. 93 XP 3-DsRed sequence

gcaaagtgaacacgtcgctaagcgaaagctaagcaaataaacaagcgcagctgaacaagctaaacaatcggggtaccgctagagtcgacggtaccgcgggcccgggatccaccggtcgccaccatggtgcgctcctccaagaacgtcatcaaggagttcatgcgcttcaaggtgcgcatggagggcaccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggccacaacaccgtgaagctgaaggtgaccaagggcggccccctgcccttcgcctgggacatcctgtccccccagttccagtacggctccaaggtgtacgtgaagcaccccgccgacatccccgactacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggctgcttcatctacaaggtgaagttcatcggcgtgaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggcgagatccacaaggccctgaagctgaaggacggcggccactacctggtggagttcaagtccatctacatggccaagaagcccgtgcagctgcccggctactactacgtggactccaagctggacatcacctcccacaacgaggactacaccatcgtggagcagtacgagcgcaccgagggccgccaccacctgttcctgtagtcataatcagccataccacatttgtag

SEQ ID NO.10 piggyBac right arm

ccctagaaagataatcatattgtgacgtacgttaaagataatcatgcgtaaaattgacgcatgtgttttatcggtctgtatatcgaggtttatttattaatttgaatagatattaagttttattatatttacacttacatactaataataaattcaacaaacaatttatttatgtttatttatttattaaaaaaaaacaaaaactcaaaatttcttctataaagtaacaaaacttttaaacattctctcttttacaaaaataaacttattttgtactttaaaaacagtcatgttgtattataaaataagtaattagcttaacttatacataatagaaacaaattatacttattagtcagtcagaaacaactttggcacatatcaatattatgctctcgacaaataacttttttgcattttttgcacgatgcatttgcctttcgccttattttagaggggcagtaagtacagtaagtacgttttttcattactggctcttcagtactgtcatctgatgtaccaggcacttcatttggcaaaatattagagatattatcgcgcaaatatctcttcaaagtaggagcttctaaacgcttacgcataaacgatgacgtcaggctcatgtaaaggtttctcataaattttttgcgactttggaccttttctcccttgctactgacattatggctgtatataataaaagaatttatgcaggcaatgtttatcattccgtacaataatgccataggccacctattcgtcttcctactgcaggtcatcacagaacacatttggtctagcgtgtccactccgcctttagtttgattataatacataaccatttgcggtttaccggtactttcgttgatagaagcatcctcatcacaagatgataataagtataccatcttagctggcttcggtttatatgagacgagagtaaggggtccgtcaaaacaaaacatcgatgttcccactggcctggagcgactgtttttcagtacttccggtatctcgcgtttgtttgatcgcacggttcccacaatggttt

SEQ ID NO.11 piggyBac left arm

agatctgacaatgttcagtgcagagactcggctacgcctcgtggactttgaagttgaccaacaatgtttattcttacctctaatagtcctctgtggcaaggtcaagattctgttagaagccaatgaagaacctggttgttcaataacattttgttcgtctaatatttcactaccgcttgacgttggctgcacttcatgtacctcatctataaacgcttcttctgtatcgctctggacgtcatcttcacttacgtgatctgatatttcactgtcagaatcctcaccaacaagctcgtcatcgctttgcagaagagcagagaggatatgctcatcgtctaaagaactacccattttattatatattagtcacgatatctataacaagaaaatatatatataataagttatcacgtaagtagaacatgaaataacaatataattatcgtatgagttaaatcttaaaagtcacgtaaaagataatcatgcgtcattttgactcacgcggtcgttatagttcaaaatcagtgacacttaccgcattgacaagcacgcctcacgggagctccaagcggcgactgagatgtcctaaatgcacagcgacggattcgcgctatttagaaagagagagcaatatttcaagaatgcatgcgtcaattttacgcagactatctttctaggg

SEQ ID NO.12 3 XP 3-ECFP sequence

gcaaagtgaacacgtcgctaagcgaaagctaagcaaataaacaagcgcagctgaacaagctaaacaatcggggtaccgctagagtcgacggtacgatccaccggtcgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaactctagatcataatcagccataccacatttgtag

The present invention is not limited to the above-mentioned embodiments, and any changes or substitutions that can be easily understood by those skilled in the art within the technical scope of the present invention are intended to be included in the scope of the present invention.

Sequence listing

<110> university of southwest

<120> a transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silk-secreting organs of silkworms and silkworm varieties thereof

<141> 2022-03-04

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 699

<212> DNA

<213> silkworm (Bombyx mori)

<400> 1

atgggtgatt taagtcaagc agatagttct tggaagaaaa tggttatagc taaaacaaac 60

aatgagtgga aatcatctgt cggtgaagat gcgaatgcag ctagtaacac tacacacttt 120

agattaagtg atgaatgcat acaatacgat aacattaaaa aagaaattga ggaaattgat 180

gaacaagaga cactcaatac cgtcgagccg gtcgatatga tacaagaaat ggacccacta 240

tcattgttgg agcctaaagc gcgtagacga aggaaaggct caggaccaaa gagtgaaaca 300

tcagaagaga gagccgcacg gctagccaag atgtctgcat atgcagcaca gaggctggca 360

aatgagtcac cggaacagcg cgccactaga ctgaagcgta tgtccgaata tgcagctaaa 420

agactttcat cagagacgag agaacagaga gcgattaggt tggcaagaat gtctgcatat 480

gcagcccgtc gacttgctaa tgagacccca gcacaaaggc aagctagact attgaggatg 540

tcggcatatg ctgcgaaaag gcaggctagc aagaagtctc ttagtacagt gaacgatagc 600

ttgaattaca gtattatgcc gaatcaaagt agagcaacta atcatccatt cactggtaag 660

cctatcccta accctctcct cggtctcgat tctacgtaa 699

<210> 2

<211> 1674

<212> DNA

<213> silkworm (Bombyx mori)

<400> 2

atgggtagaa gaaaatggaa actatatcag gacgcgttaa taccaaagcg aaacgaacag 60

gacgattcag acgattcgat gccatccacc gacccgcccc cggcgctcaa gatcaaaacc 120

atcgaggaaa tcaacgcgcc agaagacgag aggcccaggg tcgagagcga tggaaacggc 180

caagagtcga agacgtcacg gccggagacg atcctggaga gtctgatcaa gaggccggcg 240

acgcagccga aagtggaagt cctagaggaa ccagcggatt ggaagccgcc agacaagtgc 300

tacttctgcg tagatggtga gcccagggct acagctgaag ctgctcaacc cgtcggcgct 360

accagtcccg cgtcagagtc cgatagcagt tctgtgtccg gcacgaacag tccagctgcg 420

gctcctccac tgctgcagca tctcctgcag ctccaagcgc agaacccaca gactatagca 480

cagttccagc agatgatagc ggcgttgacg gcgctgggca cggggctggt gcctccaccg 540

ctcacgcagg cctggatgat gcagaggttc gcgcagcagc gacaccaggc cgacaggttg 600

tctgaaagcg ataaagcggc ggccccttcg tctccaagtc ctgtagaaca gccgttagac 660

ctgagcgcca agtccacgtc cagcaccagc ggtacgcctc cgcctgaccc caaattcttg 720

gatagcagat taagacgaac agctttagat ggagcatcga atagcacggg gcggcgcact 780

tacacggaag acgagctgca gtcagccctg cgcgacatcc agtcggggcg gctcggcacg 840

cgacgggctg ccgtgcttta cggcatccca cgctccaccc tacggaacaa ggtcaacaag 900

ttcggcctcg tcgcggataa ccacgactcc gaccccgaca gcgaccagga ccgcgccgag 960

tctccgcctt ctgtcatact caagataccg accttccctc cccccgatga caagagcccg 1020

tcaccagcga cgccagtcac tacgccgatc acccccctca cgccgctcat ctcccagccg 1080

ccagctggtt cccaacacat ttttacgtcg ttgaatgacg ttatagcgaa aagcataagt 1140

cagaaattcc agcagccgct cgacaggaca caccaagcgg acctttcctt catgagagcg 1200

ccggacgctc gacacgtgtc agtcatcaag agccaatctg acaaccaaag gaactacgcg 1260

atgccgagca attccaaggt gcctacgaac aataacggcc aagccgccgc tggaggcaag 1320

ggcactagac ccaagagggg taaatatagg aactacgatc gagacagcct cgttgaggcg 1380

gtgaaagcag tccagcgagg agagatgtcc gtgcaccgcg ccggctctta ttacggtgtc 1440

ccccactcaa cgctcgaata caaagtcaag gaaagacatt taatgcggcc taggaagcgc 1500

gaaccaaaac ctcctccaca agatacgaag ccgcagcctc ctaagccgct cccaccgaag 1560

ccgccgggca agccattctc aaacaaactc cgtccgcgga acggcacccc cgcgcccagc 1620

ccgccccccg cgccgcctga ccgcgccgac tacaaggacg acgacgacaa gtag 1674

<210> 3

<211> 1752

<212> DNA

<213> silkworm (Bombyx mori)

<400> 3

atgtcggcgg cggacgcgga gggcgtctgg agtcccgaca tcgaacagag cttccaagag 60

gcgctggcga tatacccgcc ctgtggacga cgcaaaatta ttctctccga cgagggcaag 120

atgtacggaa ggaacgagtt aatagcgagg tatattaaac taaggacagg caaaacgcgt 180

acgagaaaac aagtctcgtc acacatacag gtgctagcta ggcgaaaact acgagaaatt 240

caagccaaac ttaaagtgca attttggcag ccaggcctac aagccggcac atcacaggat 300

gtgaagcctt tccccggtgc gggctacaaa ggcgtccccg gtgtcggagg cgtcggagtg 360

ccgagcggca ccgacgtggc gccgccgccg ccctgggagg gacgcgccat cgccacacac 420

aaactgagac tcgtagagtt ctccgccttc gtcgagcatc cccgggatcc tgatacgtac 480

ccaccgagca cggcgccggc gcaacatctc ttcgttcaca taggcggtac ggtcacatac 540

gcggatcctt tattagagtc agtagacgtt cagcagataa acgacaaatt ccctgagaag 600

aagggcggtc tgaaggaact gtacgagaaa ggtccgagga acgccttctt cctggtcaag 660

ttctgggcgg atctcaacac gaacaacctc gacgaccccg gcgccttcta cggcgtcaca 720

agtgtatacg aaagtaatga gaacatgacg ataacgtgta gcacgaaagt gtgttcgttc 780

gggaagcagg tggtcgaaaa ggtggaaact gaatacgccc ggttcgaggg cggtcgcttc 840

gtgtaccgca tccacaggtc gccgatgtgc gagtacatgg tcaacttcat acacaaactg 900

aaacatctgc ccgagaagta catgatgaac agcgtactag aaaacttcac tatactacag 960

gtagtttcaa accgagacac gcaagagaca ttactgtgcg ccgcgttcgt atttgaagtg 1020

tcgaacagtg agcacggggc gcagcatcac atctacaggc tcgtcaaaga tatggtgcgc 1080

tcctccaaga acgtcatcaa ggagttcatg cgcttcaagg tgcgcatgga gggcaccgtg 1140

aacggccacg agttcgagat cgagggcgag ggcgagggcc gcccctacga gggccacaac 1200

accgtgaagc tgaaggtgac caagggcggc cccctgccct tcgcctggga catcctgtcc 1260

ccccagttcc agtacggctc caaggtgtac gtgaagcacc ccgccgacat ccccgactac 1320

aagaagctgt ccttccccga gggcttcaag tgggagcgcg tgatgaactt cgaggacggc 1380

ggcgtggtga ccgtgaccca ggactcctcc ctgcaggacg gctgcttcat ctacaaggtg 1440

aagttcatcg gcgtgaactt cccctccgac ggccccgtaa tgcagaagaa gaccatgggc 1500

tgggaggcct ccaccgagcg cctgtacccc cgcgacggcg tgctgaaggg cgagatccac 1560

aaggccctga agctgaagga cggcggccac tacctggtgg agttcaagtc catctacatg 1620

gccaagaagc ccgtgcagct gcccggctac tactacgtgg actccaagct ggacatcacc 1680

tcccacaacg aggactacac catcgtggag cagtacgagc gcaccgaggg ccgccaccac 1740

ctgttcctgt ag 1752

<210> 4

<211> 1126

<212> DNA

<213> silkworm (Bombyx mori)

<400> 4

cctgcgtgat caggaaaaat gtggaaagct taacgatttt gtcacatttt acttatcaca 60

acttgttttt ataataattc gcttaaatga gcagctatta cttaatctcg tagtggtttt 120

tgacaaaatc agcttcttta gaactaaaat atcatttttt tcgtaatttt tttaatgaaa 180

aatgctctag tgttatacct ttccaaaatc accattaatt aggtagtgtt taagcttgtt 240

gtacaaaact gccacacgca tttttttctc cactgtaggt tgtagttacg cgaaaacaaa 300

atcgttctgt gaaaattcaa acaaaaatat tttttcgtaa aaacacttat caatgagtaa 360

agtaacaatt catgaataat ttcatgtaaa aaaaaaatac tagaaaagga atttttcatt 420

acgagatgct taaaaatctg tttcaaggta gagatttttc gatatttcgg aaaattttgt 480

aaaactgtaa atccgtaaaa ttttgctaaa catatattgt gttgttttgg taagtattga 540

cccaagctat cacctcctgc agtatgtcgt gctaattact ggacacattg tataacagtt 600

ccactgtatt gacaataata aaacctcttc attgacttga gaatgtctgg acagatttgg 660

ctttgtattt ttgatttaca aatgtttttt tggtgattta cccatccaag gcattctcca 720

ggatggttgt ggcatcacgc cgattggcaa acaaaaacta aaatgaaact aaaaagaaac 780

agtttccgct gtcccgttcc tctagtggga gaaagcatga agtaagttct ttaaatatta 840

caaaaaaatt gaacgatatt ataaaattct ttaaaatatt aaaagtaaga acaataagat 900

caattaaatc ataattaatc acattgttca tgatcacaat ttaatttact tcatacgttg 960

tattgttatg ttaaataaaa agattaattt ctatgtaatt gtatctgtac aatacaatgt 1020

gtagatgttt attctatcga aagtaaatac gtcaaaactc gaaaattttc agtataaaaa 1080

ggttcaactt tttcaaatca gcatcagttc ggttccaact ctcaag 1126

<210> 5

<211> 441

<212> DNA

<213> Yeast (Saccharomyces cerevisiae)

<400> 5

atgaaactgc tctcatcaat cgaacaggcc tgtgacattt gtagactcaa aaaactcaaa 60

tgctccaagg agaaacccaa atgtgccaaa tgcctgaaaa acaactggga gtgccggtac 120

tctcctaaaa ccaaacggag ccctctcaca cgggcccatc tcactgaagt ggaatctcga 180

ctcgaacggc tcgaacagct ctttctgctc atctttccta gagaggatct cgacatgatc 240

ctgaaaatgg atagcctcca ggacatcaaa gccctgctca ctggactgtt tgtccaggat 300

aacgtgaaca aggacgccgt gaccgatagg ctggcatccg tggaaaccga tatgccactc 360

acactgagac agcaccggat tagtgccaca tcttcttccg aggagtcatc caataaggga 420

cagcgacagc tcaccgtgtc a 441

<210> 6

<211> 483

<212> DNA

<213> Yeast (Saccharomyces cerevisiae)

<400> 6

cggagtactg tcctccgagc ggagtactgt cctccgagcg gagtactgtc ctccgagcgg 60

agtactgtcc tccgagcgga gtactgtcct ccgagcggaa gcttgcatgc ctgcaggtcg 120

gagtactgtc ctccgagcgg agtactgtcc tccgagcgga gtactgtcct ccgagcggag 180

tactgtcctc cgagcggagt actgtcctcc gagcggagac tctagcgagc gccggagtat 240

aaatagaggc gcttcgtcta cggagcgaca attcaattca aacaagcaaa gtgaacacgt 300

cgctaagcga aagctaagca aataaacaag cgcagctgaa caagctaaac aatctgcagt 360

aaagtgcaag ttaaagtgaa tcaattaaaa gtaaccagca accaagtaaa tcaactgcaa 420

ctactgaaat ctgccaagaa gtaattattg aatacaagaa gagaactctg aatagggaat 480

tgg 483

<210> 7

<211> 180

<212> DNA

<213> human herpesvirus 2 strain (human herpesvirus 2)

<400> 7

tgcaccgccc ctattaccga tgtgtctctg ggcgacgaac tccggctgga tggcgaggaa 60

gtcgatatga cccctgccga cgctctcgac gatttcgacc tggaaatgct gggagatgtc 120

gaatctcctt ctcctggcat gacacacgat cccgtgtctt acggagcact ggatgtgtaa 180

<210> 8

<211> 379

<212> DNA

<213> silkworm (Bombyx mori)

<400> 8

tacaactaaa cacgacttgg agtattcctt gtagtgttta agattttaaa tcttacttaa 60

tgacttcgaa cgattttaac gataactttc tctttgttta actttaatca gcatacataa 120

aaagccccgg ttttgtatcg ggaagaaaaa aaatgtaatt gtgttgccta gataataaac 180

gtattatcaa agtgtgtggt tttcctttac caaagacccc tttaagatgg gcctaatggg 240

cttaagtcga gtcctttccg atgtgttaaa tacacattta ttacactgat gcgtcgaatg 300

tacactttta ataggatagc tccactaaaa attattttat ttatttaatt tgttgcacca 360

aaactgatac attgacgaa 379

<210> 9

<211> 831

<212> DNA

<213> Lentinus edodes coral (Discosoma sp)

<400> 9

gcaaagtgaa cacgtcgcta agcgaaagct aagcaaataa acaagcgcag ctgaacaagc 60

taaacaatcg gggtaccgct agagtcgacg gtaccgcggg cccgggatcc accggtcgcc 120

accatggtgc gctcctccaa gaacgtcatc aaggagttca tgcgcttcaa ggtgcgcatg 180

gagggcaccg tgaacggcca cgagttcgag atcgagggcg agggcgaggg ccgcccctac 240

gagggccaca acaccgtgaa gctgaaggtg accaagggcg gccccctgcc cttcgcctgg 300

gacatcctgt ccccccagtt ccagtacggc tccaaggtgt acgtgaagca ccccgccgac 360

atccccgact acaagaagct gtccttcccc gagggcttca agtgggagcg cgtgatgaac 420

ttcgaggacg gcggcgtggt gaccgtgacc caggactcct ccctgcagga cggctgcttc 480

atctacaagg tgaagttcat cggcgtgaac ttcccctccg acggccccgt aatgcagaag 540

aagaccatgg gctgggaggc ctccaccgag cgcctgtacc cccgcgacgg cgtgctgaag 600

ggcgagatcc acaaggccct gaagctgaag gacggcggcc actacctggt ggagttcaag 660

tccatctaca tggccaagaa gcccgtgcag ctgcccggct actactacgt ggactccaag 720

ctggacatca cctcccacaa cgaggactac accatcgtgg agcagtacga gcgcaccgag 780

ggccgccacc acctgttcct gtagtcataa tcagccatac cacatttgta g 831

<210> 10

<211> 1051

<212> DNA

<213> Trichoplusia ni (Trichoplusia ni)

<400> 10

ccctagaaag ataatcatat tgtgacgtac gttaaagata atcatgcgta aaattgacgc 60

atgtgtttta tcggtctgta tatcgaggtt tatttattaa tttgaataga tattaagttt 120

tattatattt acacttacat actaataata aattcaacaa acaatttatt tatgtttatt 180

tatttattaa aaaaaaacaa aaactcaaaa tttcttctat aaagtaacaa aacttttaaa 240

cattctctct tttacaaaaa taaacttatt ttgtacttta aaaacagtca tgttgtatta 300

taaaataagt aattagctta acttatacat aatagaaaca aattatactt attagtcagt 360

cagaaacaac tttggcacat atcaatatta tgctctcgac aaataacttt tttgcatttt 420

ttgcacgatg catttgcctt tcgccttatt ttagaggggc agtaagtaca gtaagtacgt 480

tttttcatta ctggctcttc agtactgtca tctgatgtac caggcacttc atttggcaaa 540

atattagaga tattatcgcg caaatatctc ttcaaagtag gagcttctaa acgcttacgc 600

ataaacgatg acgtcaggct catgtaaagg tttctcataa attttttgcg actttggacc 660

ttttctccct tgctactgac attatggctg tatataataa aagaatttat gcaggcaatg 720

tttatcattc cgtacaataa tgccataggc cacctattcg tcttcctact gcaggtcatc 780

acagaacaca tttggtctag cgtgtccact ccgcctttag tttgattata atacataacc 840

atttgcggtt taccggtact ttcgttgata gaagcatcct catcacaaga tgataataag 900

tataccatct tagctggctt cggtttatat gagacgagag taaggggtcc gtcaaaacaa 960

aacatcgatg ttcccactgg cctggagcga ctgtttttca gtacttccgg tatctcgcgt 1020

ttgtttgatc gcacggttcc cacaatggtt t 1051

<210> 11

<211> 679

<212> DNA

<213> Trichoplusia ni (Trichoplusia ni)

<400> 11

agatctgaca atgttcagtg cagagactcg gctacgcctc gtggactttg aagttgacca 60

acaatgttta ttcttacctc taatagtcct ctgtggcaag gtcaagattc tgttagaagc 120

caatgaagaa cctggttgtt caataacatt ttgttcgtct aatatttcac taccgcttga 180

cgttggctgc acttcatgta cctcatctat aaacgcttct tctgtatcgc tctggacgtc 240

atcttcactt acgtgatctg atatttcact gtcagaatcc tcaccaacaa gctcgtcatc 300

gctttgcaga agagcagaga ggatatgctc atcgtctaaa gaactaccca ttttattata 360

tattagtcac gatatctata acaagaaaat atatatataa taagttatca cgtaagtaga 420

acatgaaata acaatataat tatcgtatga gttaaatctt aaaagtcacg taaaagataa 480

tcatgcgtca ttttgactca cgcggtcgtt atagttcaaa atcagtgaca cttaccgcat 540

tgacaagcac gcctcacggg agctccaagc ggcgactgag atgtcctaaa tgcacagcga 600

cggattcgcg ctatttagaa agagagagca atatttcaag aatgcatgcg tcaattttac 660

gcagactatc tttctaggg 679

<210> 12

<211> 867

<212> DNA

<213> Victoria jellyfish (Aequorea victoria)

<400> 12

gcaaagtgaa cacgtcgcta agcgaaagct aagcaaataa acaagcgcag ctgaacaagc 60

taaacaatcg gggtaccgct agagtcgacg gtacgatcca ccggtcgcca ccatggtgag 120

caagggcgag gagctgttca ccggggtggt gcccatcctg gtcgagctgg acggcgacgt 180

aaacggccac aagttcagcg tgtccggcga gggcgagggc gatgccacct acggcaagct 240

gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg ccctggccca ccctcgtgac 300

caccctgacc tggggcgtgc agtgcttcag ccgctacccc gaccacatga agcagcacga 360

cttcttcaag tccgccatgc ccgaaggcta cgtccaggag cgcaccatct tcttcaagga 420

cgacggcaac tacaagaccc gcgccgaggt gaagttcgag ggcgacaccc tggtgaaccg 480

catcgagctg aagggcatcg acttcaagga ggacggcaac atcctggggc acaagctgga 540

gtacaactac atcagccaca acgtctatat caccgccgac aagcagaaga acggcatcaa 600

ggccaacttc aagatccgcc acaacatcga ggacggcagc gtgcagctcg ccgaccacta 660

ccagcagaac acccccatcg gcgacggccc cgtgctgctg cccgacaacc actacctgag 720

cacccagtcc gccctgagca aagaccccaa cgagaagcgc gatcacatgg tcctgctgga 780

gttcgtgacc gccgccggga tcactctcgg catggacgag ctgtacaagt aaactctaga 840

tcataatcag ccataccaca tttgtag 867

Claims

1. A transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silk-secreting organs of silkworms is characterized by specifically up-regulating the silk gland cells at the rear parts of the silkworms through a modified GAL4/UAS high-efficiency binary expression systemBmFMBP1（SEQ ID NO .1）、BmE93(SEQ ID NO. 2) andBmSdRFPthe (SEQ ID NO. 3) gene leads to complete degeneration and disappearance of posterior silk gland organs, but can still normally spit silk and cocoon;

wherein the GAL4 vector comprises: heavy chain of silk fibroinfibHIs a promoter, and the nucleotide sequence of the promoter is SEQ ID NO. 4; the gene sequence of GAL4 protein binding domain is target sequence, and its nucleotide sequence is SEQ ID NO. 5;

the UAS vector comprises a 10 XUAS sequence and a downstream target gene sequence, wherein the nucleotide sequence of the 10 XUAS sequence is SEQ ID NO. 6.

2. The transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silk-secreting organs of silkworms according to claim 1, characterized in that it comprises the steps of:

step S1, GAL4/UAS expression vector construction;

s2, preparing GAL4/UAS transgenic silkworms;

step S3, morphological observation is carried out on five-age day 6 silk glands of 3 rear silk gland specific over-expressed GAL4/UAS transgenic silkworms, and a camera is used for shooting pictures;

and S5, extracting DNA from the silk glands of the five-year-old 6 th silkworms of the 3 rear silk gland-specific GAL4/UAS transgenic silkworms, carrying out PCR amplification on the extracted DNA according to the designed primers, and carrying out nucleic acid electrophoresis on the amplification result.

3. The transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silk-secreting organs of silkworms according to claim 2, wherein the step of constructing a GAL4/UAS expression vector comprises constructing a vector for expressing GAL4 by the posterior silk gland specific activation of silkworms and an expression vector for linking a target gene with UAS.

4. The transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silk-secreting organs of silkworms according to claim 1, characterized in that the production of GAL4/UAS transgenic silkworms comprises: through microinjection of the two expression vectors into silkworm embryos, GAL4 transgenic silkworms with red fluorescence on eyes and UAS knockout transgenic silkworms with green fluorescence on eyes are obtained, and the two transgenic silkworms are hybridized pairwise to obtain over-expression transgenic silkworms with red fluorescence on eyes and green fluorescence on eyes.