CN114480509A

CN114480509A - Transgenic method for preparing pure sericin cocoon by inducing complete degradation of silkworm silk secretion organs and silkworm variety

Info

Publication number: CN114480509A
Application number: CN202210214552.7A
Authority: CN
Inventors: 徐汉福; 曾文慧; 刘荣鹏; 马艳; 罗琴; 欧瑶; 马静文; 唐艺芸; 胡杰; 向仲怀
Original assignee: Southwest University
Current assignee: Southwest University
Priority date: 2022-03-04
Filing date: 2022-03-04
Publication date: 2022-05-13
Anticipated expiration: 2042-03-04
Also published as: CN114480509B

Abstract

The invention provides a transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silkworm silk-secreting organs and a silkworm variety thereof, wherein BmFMBP1, BmE93 and BmSdRFP genes are specifically up-regulated in rear silk gland cells of silkworms through a modified GAL4/UAS efficient binary expression system, so that the rear silk gland organs are completely degenerated and disappear, and the silkworms can still normally spin and cocoons. According to the invention, by using a GAL4/UAS binary expression system, BmFMBP1, BmE93 and BmSdRFP genes are specifically overexpressed in the rear silk gland of the silkworm, the rear silk gland of a double-fluorescence positive offspring is found to be completely degenerated, but the double-fluorescence positive offspring also has the capacity of spinning and cocooning, the cocooning is pure sericin cocoon, and the offspring is fertile, so that a powerful material basis is provided for a novel biological functional material.

Description

Transgenic method for preparing pure sericin cocoon by inducing complete degradation of silkworm silk secretion organs and silkworm variety

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a transgenic method for preparing pure sericin cocoons by inducing complete degradation of silkworm silk secretion organs and a silkworm variety thereof.

Background

Silkworm is an important economic insect and lepidoptera model insect. The breakthrough of silkworm transgenic technology in 2000 and the determination of silkworm whole genome sequence in 2004 marked that human research on silkworms began to enter the genome era. Particularly, the establishment of a transgenic technology provides key technical support for analyzing silkworm genes and developing novel silkworm varieties on an individual level.

The silk gland is the only silk producing organ of silkworm, and determines the yield and quality of silk. In recent years, researchers have identified a large number of expression genes from silkworm silk glands by utilizing a multiomic means, and the functions of the genes in silk gland organ development and fibroin synthesis are always important and hot spots of domestic and overseas research. Meanwhile, genetic modification of silk glands by using a transgenic technology and key genes to create novel silk materials with different functions or purposes also becomes the key content of research in the field.

The existing transgenic method for modifying the silk gland of the silkworm is mainly to connect a target gene to the downstream of a specific promoter so as to control the expression of the target gene, and further reveal the biological function of the target gene or obtain a corresponding silk gland modification material. However, the existing methods can not realize complete degeneration and disappearance of the silk gland organ through targeted modification of the target gene. The key gene is identified and the technical strategy of realizing the complete degeneration of the silk gland organ is utilized, which is beneficial to analyzing the functions of the silk gland gene more deeply and provides theoretical reference for the research of organ development regulation and control. Particularly, silkworm silk glands are genetically modified to be completely degenerated, so that a pure silk glue cocoon silkworm variety capable of being stably inherited is created, and development and application of fibroin in the fields of biological materials, daily chemical products and the like can be expanded.

Disclosure of Invention

Based on the technical problems in the prior art, the invention provides a transgenic method for preparing pure sericin cocoons by inducing the complete degeneration of silkworm silkorgans and a silkworm variety thereof.

According to the technical scheme, the invention provides a transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silkworm silk-secreting organs, which specifically up-regulates BmFMBP1(SEQ ID No.1), BmE93(SEQ ID No.2) and BmSdRFP (SEQ ID No.3) genes in rear silk gland cells of silkworms to cause complete degeneration of rear silk gland organs to disappear but can still normally spin and cocoon through a modified GAL4/UAS high-efficiency binary expression system.

Further, the transgenic method for preparing pure sericin cocoons by inducing the complete degeneration of silkworm silk-secreting organs comprises the following steps:

step S1, GAL4/UAS expression vector construction;

step S2, making GAL4/UAS transgenic silkworm;

step S3, morphological observation is carried out on the silk glands of the five-year-old 6-day (5L6D) silkworms of the GAL4/UAS transgenic silkworms with the 3 posterior silk gland specific overexpression, and a picture is taken by a camera;

step S4, morphologically observing cocoon shells of the 3 types of GAL4/UAS transgenic silkworms with specific posterior silk glands, and taking pictures by using a camera;

and step S5, extracting DNA from the fifth-age sixth-day silk glands of the 3 posterior silk gland-specific GAL4/UAS transgenic silkworms, carrying out PCR amplification on the successfully extracted DNA according to designed primers, and carrying out nucleic acid electrophoresis on the amplification result.

Wherein, the GAL4/UAS expression vector construction step comprises the construction of a vector for the specific activation expression of GAL4 of the posterior silk gland of the silkworm and an expression vector for connecting a target gene by UAS.

Preferably, the GAL4 vector consists essentially of: the fibroin heavy chain fibH is used as a promoter (SEQ ID NO4) [ NCBI gene ID: NM-001113262.1 ], the gene sequence of GAL4 protein binding domain is the target sequence, GAL4BD (SEQ ID NO. 5).

More preferably, the UAS vector consists essentially of 10 × UAS sequence (SEQ ID NO. 6) and downstream gene sequences of interest, i.e., BmFMBP1(SEQ ID NO.1), BmE93(SEQ ID NO.2), and BmSdRFP (SEQ ID NO.3).

Further, the GAL4/UAS transgenic silkworm is produced by: GAL4 transgenic silkworms with eyes emitting red fluorescence and UAS transgenic silkworms with eyes emitting cyan fluorescence are obtained by microinjecting the two expression vectors through silkworm embryos, and the two transgenic silkworms are crossed pairwise to obtain the over-expression transgenic silkworms with eyes emitting red fluorescence and cyan fluorescence.

According to another aspect of the present invention, there is provided a silkworm variety obtained by a transgenic method for inducing complete degeneration of silkworm silk organs, wherein the modified GAL4/UAS high-efficiency binary expression system specifically up-regulates BmFMBP1(SEQ ID No.1), BmE93(SEQ ID No.2) and BmSdRFP (SEQ ID No.3) genes in silkworm posterior silk gland cells, so that the complete degeneration of posterior silk gland organs disappears, but normal silk spinning and cocooning can still be achieved, and offspring can be bred.

Compared with the prior art, the transgenic method for preparing pure sericin cocoons by inducing the complete degeneration of silkworm silk-secreting organs and the silkworm variety thereof have the beneficial effects that:

1. the invention relates to a transgenic method for inducing the complete degeneration of silk gland organs at the back of silkworms by gene modification and enriches the source materials of silkworm varieties.

2. According to the invention, by using a GAL4/UAS binary expression system, genes BmFMBP1(SEQ ID NO.1), BmE93(SEQ ID NO.2) and BmSdRFP (SEQ ID NO.3) are specifically overexpressed in the rear silk gland of a silkworm, the rear silk gland of a double-fluorescence positive offspring is found to be completely degenerated, but the double-fluorescence positive offspring also has the silk spinning and cocooning capabilities, the cocoons are pure silk sericin cocoons, the offspring can be bred, and a powerful material basis is provided for a novel biological functional material.

Drawings

FIG. 1 is a diagram showing the result of the prepared transgenic silkworm with GAL4/UAS gene specific to the posterior silk gland;

FIG. 2 is a schematic representation of the silk gland of a posterior silk gland-specific GAL4/UAS overexpressing BmSdRFP (SEQ ID NO.3) transgenic silkworm;

FIG. 3 is a schematic representation of cocoon shells of transgenic silkworms overexpressing BmSdRFP (SEQ ID NO.3) by GAL4/UAS specific for the posterior silk gland;

FIG. 4 is a schematic representation of the silk gland of a posterior silk gland-specific GAL4/UAS overexpressing BmFMBP1(SEQ ID NO.1) transgenic silkworm;

FIG. 5 is a schematic representation of cocoon shells of transgenic silkworms with GAL4/UAS overexpression BmFMBP1(SEQ ID NO.1) specific for posterior silk glands;

FIG. 6 is a schematic representation of the silk gland of a posterior silk gland-specific GAL4/UAS overexpressing BmE93(SEQ ID NO.2) transgenic silkworm;

FIG. 7 is a graph showing the genomic identification of a transgenic silkworm with rear silk gland-specific GAL4/UAS overexpressing BmSdRFP (SEQ ID NO. 3);

FIG. 8 is a diagram showing the result of genome identification of transgenic silkworms overexpressing BmFMBP1(SEQ ID NO.1) by GAL4/UAS specific for posterior silk glands;

FIG. 9 is a diagram showing the result of genome identification of transgenic silkworms overexpressing BmE93(SEQ ID NO.2) by GAL4/UAS specific for posterior silk glands.

Detailed Description

The technical solutions in the embodiments of the present invention will be described clearly and completely with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only some embodiments, not all embodiments, of the technical solutions. All other embodiments obtained by a person skilled in the art based on the embodiments of the present technical solution without creative efforts shall fall within the protection scope of the present invention. In addition, the scope of the present invention should not be limited to the particular structures or components or the specific parameters set forth below.

The invention provides a silkworm variety of a transgenic method for inducing complete degeneration of silkworm silk secretion organs, which specifically up-regulates genes of BmFMBP1(SEQ ID NO.1), BmE93(SEQ ID NO.2) and BmSdRFP (SEQ ID NO.3) in rear silk gland cells of silkworms to cause complete degeneration and disappearance of rear silk gland organs through a modified GAL4/UAS high-efficiency binary expression system, but can still normally spin and form cocoons, the cocoons are pure silk cocoons, and descendants can be bred. The invention provides a new method and means for silkworm variety resources and provides a material basis for diversified development and utilization of silk.

Among them, the GAL4/UAS binary expression system is a set of GAL4 (transcription activator) driven by specific promoter, which can specifically recognize and bind to UAS sequence to activate the transcription of downstream target gene. The silk gland is the only organ for silkworms to spin, determines the yield and quality of silk, and is an important functional organ. Silk is mainly composed of silk fibroin secreted by posterior silk glands and sericin secreted by middle silk glands.

The invention provides a transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silkworm silk-secreting organs, which comprises the following steps:

step S1, GAL4/UAS expression vector construction:

constructs the carrier of the specific activation expression GAL4 of the posterior silk gland of the silkworm and the expression carrier of the UAS connected with the target gene. The GAL4 vector consists essentially of: the fibroin heavy chain fibH is used as a promoter (SEQ ID NO.4) [ NCBI gene ID: NM-001113262.1 ], the gene sequence of GAL4 protein binding domain is the target sequence, i.e., GAL4BD (SEQ ID NO. 5); the UAS vector mainly comprises a 10 XUAS sequence (SEQ ID NO. 6) and downstream target gene sequences, namely BmFMBP1(SEQ ID NO.1), BmE93(SEQ ID NO.2) and BmSdRFP (SEQ ID NO.3).

Step S2, GAL4/UAS transgenic silkworm preparation:

GAL4 transgenic silkworms with eyes emitting red fluorescence and UAS transgenic silkworms with eyes emitting cyan fluorescence are obtained by microinjecting the two expression vectors through silkworm embryos, and the two transgenic silkworms are crossed pairwise to obtain the over-expression transgenic silkworms with eyes emitting red fluorescence and cyan fluorescence.

Step S3, morphological observation is carried out on the silk glands of the fifth-instar sixth day of the GAL4/UAS transgenic silkworms with the 3 posterior silk gland specific overexpression types, and a picture is taken by a camera.

In step S4, the morphological observation was performed on the cocoon shells of the 3 posterior silk gland-specific GAL4/UAS transgenic silkworms described above, and photographs were taken with a camera.

And step S5, extracting DNA from the fifth-age sixth-day silk glands of the 3 posterior silk gland-specific GAL4/UAS transgenic silkworms, carrying out PCR amplification on the successfully extracted DNA according to designed primers, and carrying out nucleic acid electrophoresis on the amplification result. The success of the transgene is demonstrated by the fact that the size of the designed primer is consistent with the amplified size.

Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The experimental procedures, in which specific conditions are not specified in the examples, are generally carried out under conventional conditions or conditions recommended by the manufacturers.

Example 1 construction of Bombyx mori posterior Silk gland-specific GAL4/UAS expression vector

Step S1 construction of GAL4 expression vector specific for posterior silk gland

Sequentially adding a bombyx mori fibH gene promoter sequence (SEQ ID NO.4) [ NCBI gene ID: NM-001113262.1 ] was concatenated with GAL4BD gene sequence (SEQ ID NO.5), protein domain sequence VP16(SEQ ID NO.7) activating gene expression and termination signal Ser1-poly A (SEQ ID NO.8) to form a desired gene expression cassette, by cleaving the backbone vector pBac [3 XP 3-DsRed ] and the desired gene expression cassette using AscI, the backbone vector was completed by: firstly, assembling a 3 XP 3-DsRed sequence (SEQ ID NO.9), wherein the sequence consists of a 3-fold repeated P3 promoter (eye and nerve specific promoter) driven and expressed red fluorescent protein (DsRed) sequence; the right (SEQ ID NO.10) and left (SEQ ID NO.11) piggyBac arms were then assembled at the 5 'and 3' ends, respectively, of the 3 XP 3-DsRed sequence (SEQ ID NO. 9). And then linked by T4 ligase to successfully construct an expression vector of the bombyx mori posterior silk gland-specific GAL4, which is named HG 4.

Step S2 construction of UAS transgenic expression vector using BmFMBP1 as target gene

The expression boxes of UAS tandem overexpression BmFMBP1(SEQ ID NO.1) are as follows: 10 × UAS sequence (SEQ ID NO. 6), BmFMBP1(SEQ ID NO.1) as the target gene and Ser1-polyA as the termination signal (SEQ ID NO.8), by using FseI and BgIII to cut open the backbone vector pBac [3 × P3-ECFP ] and the target gene expression cassette, the backbone vector was completed by the following steps: firstly, assembling a 3 XP 3-ECFP sequence (SEQ ID NO.12), wherein the sequence consists of a cyan fluorescent protein (ECFP) sequence which is driven and expressed by a 3-fold repeated P3 promoter (eye and nerve specific promoter); the right (SEQ ID NO.10) and left (SEQ ID NO.11) piggyBac arms were then assembled at the 5 'and 3' ends, respectively, of the 3 XP 3-ECFP sequence (SEQ ID NO. 12). Then linked by T4 link enzyme to finally form UAS overexpression BmFMBP1(SEQ ID NO.1) transgenic expression vector.

Step S3 construction of UAS transgenic expression vector using BmE93 as target gene

Unlike the above step S2, the objective gene is BmE93(SEQ ID NO.2), i.e., the UAS-tandem overexpression BmE93(SEQ ID NO.2) expression cassettes are: 10 × UAS sequence (SEQ ID NO6), BmE93(SEQ ID NO.2) as the target gene, Ser1-polyA (termination signal) (SEQ ID NO.8), by using FseI and BgIII to cut open the backbone vector pBac [3 × P3-ECFP ] and the target gene expression cassette, the backbone vector is completed by the following steps: firstly, assembling a 3 XP 3-ECFP sequence (SEQ ID NO.12), wherein the sequence consists of a cyan fluorescent protein (ECFP) sequence which is driven and expressed by a 3-fold repeated P3 promoter (eye and nerve specific promoter); then a piggyBac right arm (SEQ ID NO.10) and a piggyBac left arm (SEQ ID NO.11) are assembled at the 5 'end and the 3' end of the 3 XP 3-ECFP sequence (SEQ ID NO.12) respectively, and are linked through a T4 ligase, and finally, a UAS overexpression BmE93(SEQ ID NO.2) transgenic expression vector is formed.

Step S4 construction of UAS transgenic expression vector using BmSdRFP as target gene

Unlike step S2 above, the objective gene is BmSdRFP (SEQ ID NO.3), i.e., UAS tandem overexpression BmSdRFP (SEQ ID NO.3) expression boxes are sequentially: 10 × UAS sequence (SEQ ID NO. 6), BmSdRFP (SEQ ID NO.3) as the target gene and Ser1-polyA as the termination signal (SEQ ID NO.8), by cutting open the backbone vector pBac [3 × P3-ECFP ] and the target gene expression cassette using FseI and BgIII, the backbone vector was completed by the following steps: firstly, assembling a 3 XP 3-ECFP sequence (SEQ ID NO.12), wherein the sequence consists of a cyan fluorescent protein (ECFP) sequence which is driven and expressed by a 3-fold repeated P3 promoter (eye and nerve specific promoter); then the right arm (SEQ ID NO.10) and the left arm (SEQ ID NO.11) of piggyBac are assembled at the 5 'end and the 3' end of the 3 XP 3-ECFP sequence (SEQ ID NO.12), respectively, and linked through T4 ligase to finally form the UAS overexpression BmSdRFP (SEQ ID NO.3) transgenic expression vector.

Example 2 preparation of GAL4/UAS transgenic silkworms

Step S1 transgene injection and fluorescence screening

After the GAL4/UAS transgenic expression vector is obtained, the GAL4/UAS transgenic expression vector and an auxiliary plasmid (A4Helper)1:1 are respectively mixed at the concentration of 450 ng/microliter, injected by an Eppendorf microinjector, a diversification silkworm Nistar (a material capable of raising multiple batches of silkworm eggs in one year) is used as an injection receptor, the silkworm moth needs to be mated for 6 hours before injection, laid at 4 ℃ for one day and taken out to lay eggs at room temperature, an embryo which just laid for one hour is taken out and stuck on a glass sheet by paste, the embryo is injected by the Eppendorf microinjector, sealed by nontoxic glue, sterilized by 35% formaldehyde steam for 5 minutes and placed in an environment with the relative humidity of 25 ℃ and the relative humidity of 85 percent to hatch, the hatched G0 (the first generation after injection) silkworm is bred by self-crossing with mulberry leaves to the silkworm moth, the obtained G0 generation (the first generation after injection) silkworm moth is obtained, and the G1 generation (the second generation after injection) silkworm egg is obtained by backcrossing or backcrossing, screening by an Olympus fluorescence microscope to obtain blue fluorescence UAS overexpression BmFMBP1(SEQ ID NO.1), BmE93(SEQ ID NO.2) and BmSdRFP (SEQ ID NO.3) transgenic silkworms and red fluorescence GAL4 transgenic positive silkworms. And normally preserving the seeds after breeding for one generation.

Step S2 preparation of transgenic silkworm overexpressing BmFMBP1

The screened eye and nerve red fluorescence GAL4 transgenic silkworm is named HG4 and raised to moth, then the screened eye and nerve red fluorescence UAS transgenic silkworm is named BmFMBP1(SEQ ID NO.1) are crossed in pairs, after laying eggs, the screened eye and nerve red fluorescence UAS transgenic silkworm is placed in an environment with the temperature of 25 ℃ and the relative humidity of 85% for hatching, the hatched offspring is raised to four ages, and the GAL4/UAS transgenic silkworm which is specifically expressed in the eye of the transgenic silkworm and emits blue fluorescence and red fluorescence GAL 3625 is obtained by screening, and the result is shown in figure 1, and the over-expressed BmFMBP1(SEQ ID NO.1) transgenic silkworm is proved to be successfully manufactured and then normally raised to the material obtaining stage.

Step S3 preparation of transgenic bombyx mori with overexpression BmE93

The screened eye and nerve red fluorescence GAL4 transgenic silkworm is named HG4 and raised to moth, then the screened eye and nerve red fluorescence UAS transgenic silkworm is named BmE93(SEQ ID NO.2) are crossed in pairs, after laying eggs, the screened eye and nerve red fluorescence UAS transgenic silkworm is placed in an environment with the temperature of 25 ℃ and the relative humidity of 85% for hatching, the hatched offspring is raised to four ages, and the GAL4/UAS transgenic silkworm which is specifically expressed in the eye of the transgenic silkworm and emits blue fluorescence and red fluorescence is obtained through screening, the result is shown in figure 1, the over-expressed BmE93(SEQ ID NO.2) transgenic silkworm is proved to be successfully manufactured, and then the silkworm is normally raised to the material drawing stage.

Step S4 preparation of transgenic silkworm overexpressing BmSdRFP

The screened transgenic bombyx mori with eyes and nerve red and fluorescent GAL4 is named as HG4 and bred to moth, then the bombyx mori is crossed with the screened transgenic bombyx mori with eyes and nerve blue and fluorescent UAS named as BmSdRFP (SEQ ID NO.3) in pairs, after eggs are laid, the bombyx mori is placed in an environment with the temperature of 25 ℃ and the relative humidity of 85% to hatch the offspring and bred to four ages, and the transgenic bombyx mori which specifically expresses in the eyes of the transgenic bombyx mori and emits green and red fluorescent GAL4/UAS is obtained through screening, and the result is shown in figure 1, which proves that the transgenic bombyx mori which over expresses the BmSdRFP (SEQ ID NO.3) is successfully manufactured and then normally bred to the material drawing stage.

Example 3 observation of the Silk gland phenotype of transgenic silkworms overexpressing BmFMBP1

Step S1 feeding wild type silkworm Nistar and overexpression BmFMBP1(SEQ ID NO.1) transgenic silkworms, namely GAL4/UAS transgenic silkworms which emit green fluorescence and red fluorescence and are specifically expressed in the eyes of the silkworms to five ages, dissecting and observing the fifth day silk glands of the wild type silkworm Nistar and the overexpression BmFMBP1(SEQ ID NO.1) transgenic silkworms in a buffer solution of 1 XPBS (phosphate buffered saline solution), photographing, and finally completely degenerating the rear silk glands of the overexpression BmFMBP1(SEQ ID NO.1) transgenic silkworms compared with the rear silk glands of the wild type silkworm Nistar as shown in the attached figure 2.

Example 4 cocoon shell phenotype observations of transgenic silkworms overexpressing BmFMBP1

Step S1 feeding wild silkworm Nistari and transgenic silkworm overexpressing BmFMBP1(SEQ ID NO.1), namely GAL4/UAS transgenic silkworm which is specifically expressed in silkworm eyes and emits both green fluorescence and red fluorescence to upper cluster, observing cocoon shells of the Nistari and transgenic silkworm overexpressing BmFMBP1(SEQ ID NO.1), and photographing, wherein the overexpression of BmFMBP1(SEQ ID NO.1) is pure sericin cocoon compared with the wild silkworm Nistari cocoon shell as shown in figure 3.

Example 5 observation of the Silk gland phenotype of transgenic silkworms overexpressing BmE93

Step S1 breeding wild silkworm Nistar and over-expression BmE93(SEQ ID NO.2) transgenic silkworms, namely GAL4/UAS transgenic silkworms which emit green fluorescence and red fluorescence and are specifically expressed in the eyes of silkworms, to five-year-old, dissecting and observing silk glands of the wild silkworm Nistar and the over-expression BmE93(SEQ ID NO.2) transgenic silkworms on the sixth day of five-year-old in a buffer solution of 1 XPBS, photographing, and obtaining the result as shown in figure 4, compared with the rear silk glands of the wild silkworm Nistar, the rear silk glands of the over-expression BmE93(SEQ ID NO.2) transgenic silkworms are completely degenerated.

Example 6 Silk gland phenotype visualization of transgenic Bombyx mori overexpressing BmSdRFP

Step S1 feeding wild type bombyx mori and transgenic bombyx mori overexpressing bmsdrp (SEQ ID No.3), namely GAL4/UAS transgenic bombyx mori expressing specifically in bombyx mori eyes and emitting both green and red fluorescence, to five instars, by dissecting and observing five-instar sixth-day silk glands of the wild type bombyx mori and transgenic bombyx mori overexpressing bmsdrp (SEQ ID No.3) transgenic bombyx mori in a buffer of 1 × PBS and photographing, the results are shown in fig. 5, and the posterior silk glands of the transgenic bombyx mori overexpressing bmsdrp (SEQ ID No.3) are completely degenerated compared to the posterior silk glands of wild type bombyx mori.

Example 7 cocoon shell phenotype visualization of transgenic silkworms overexpressing BmSdRFP

Step S1 feeding wild silkworm Nistari and transgenic silkworm overexpressing BmSdRFP (SEQ ID NO.3), namely GAL4/UAS transgenic silkworm expressing both green fluorescence and red fluorescence specifically in silkworm eyes to upper cocooning, observing cocoon shells of Nistari and transgenic silkworm overexpressing BmSdRFP (SEQ ID NO.3), and photographing, wherein the overexpression of BmSdRFP (SEQ ID NO.3) is pure silk glue cocoon compared with the wild silkworm Nistari cocoon as shown in figure 6.

Example 8 molecular characterization of transgenic Bombyx mori overexpressing BmFMBP1

Step S1 dissects the silk gland of the wild silkworm Nistari and PSG specific overexpression BmFMBP1(SEQ ID NO.1) in the fifth-instar of the transgenic silkworm, and collects the silk gland through a 1.5mL centrifuge tube.

Step S2, extracting the genome of the silk gland which is dissected and collected by the complaint, wherein the extraction method comprises the following steps:

(1) cleaning the mortar and the grinding rod, and placing the cleaned mortar and the grinding rod in an oven for high-temperature sterilization at 180 ℃ for 2-3 hours. Before the grinding operation, liquid nitrogen precooling treatment needs to be carried out on the silk gland, the mortar and the grinding rod. After precooling, the silk gland is ground into powder and then transferred into a centrifugal tube of 1.5mL, and the powder is stored in liquid nitrogen or at the temperature of minus 80 ℃ for standby.

(2) Add 1mL of DNA extraction Buffer to the centrifuge tube and vortex at 3000rpm (rpm) to mix. RNase was added at a working concentration of 100. mu.L/mL (microliters/mL), digested in a 37 ℃ constant temperature water bath for 1 hour, then proteinase K was added, and digested in a 55 ℃ water bath overnight.

(3) Equal volume of Tris saturated phenol was added to the centrifuge tube and vortexed thoroughly for 10min, followed by centrifugation at 13400rpm for 10min at 4 ℃ and 600. mu.L of supernatant was taken to a new centrifuge tube.

(4) mu.L Tris phenol/chloroform, fully rotating and shaking for 10min, then, 4 ℃, 13400rpm centrifugation for 10min, then the supernatant is transferred to a new centrifuge tube.

(5) The supernatant was collected by thoroughly rotating and shaking chloroform in an equal volume for 10min, followed by centrifugation at 13400rpm for 10min at 4 ℃.

(6) Adding anhydrous ethanol precooled at 4 ℃ into a centrifuge tube in equal volume, slightly turning upside down until uniform white flocculent precipitate appears, and standing for 5 min.

(7) Carefully picking out the precipitate with a sterile tip, transferring to a new 1.5mL centrifuge tube, adding pre-cooled 75% ethanol at 4 deg.C, washing for 1-2 times, centrifuging at 13400rpm for 10min at 4 deg.C, and discarding the supernatant.

(8) The centrifuge tube was opened, allowed to stand at room temperature until the ethanol was evaporated, and 30-50. mu.L of EB buffer was added to dissolve the DNA precipitate.

(9) Detecting DNA purity and concentration by using a spectrophotometer, carrying out agarose gel electrophoresis detection, and storing at-80 ℃ for a long time for later use.

Step S3 genomic PCR:

(1) the Primer BmFMBP1(SEQ ID NO.1) is designed by utilizing Primer5 software, the Primer is synthesized by a Huada gene, and the Primer is dissolved and diluted by adding ultrapure water after being synthesized and then is stored at 4 ℃.

(2) And (3) carrying out PCR amplification on a target fragment by taking the extracted genome as a template, wherein the reaction system comprises the following steps:

1 μ L of genomic DNA;

dNTP (deoxyribonucleoside triphosphate) 0.8. mu.L;

0.1 mu L of HiFi Taq enzyme;

forward and reverse primers are 0.2 mu L respectively;

1 mu L of buffer solution I;

6.7 mu L of double distilled water;

total system 10 μ L;

(3) the PCR amplification conditions were as follows:

pre-denaturation at 94 ℃ for 5 min;

denaturation at 94 ℃ for 30 s;

annealing at 50 ℃ for 30 s;

extension at 72 ℃ for 30 s;

repeat 35 cycles;

72℃10min；

after the reaction was completed, 1% agarose gel was prepared, and 5. mu.L of PCR amplification product was subjected to electrophoresis. The detection results are shown in FIG. 7. The result proves that the transgenic silkworm over-expressing BmFMBP1(SEQ ID NO.1) is successfully made.

Example 9 molecular characterization of transgenic silkworms overexpressing BmE93

Step S1 dissects the silk gland of the wild silkworm Nistari and PSG specific overexpression BmE93(SEQ ID NO.2) in the sixth day of the five-instar of the transgenic silkworms, and collects the silk gland through a 1.5mL centrifuge tube.

(2) Add 1mL of DNA extraction Buffer to the centrifuge tube and vortex at 3000rpm to mix. Adding RNA enzyme according to the working concentration of 100 mu L/mL, placing the mixture in a constant-temperature water bath kettle at 37 ℃ for digestion for 1 hour, adding proteinase K, and digesting the mixture in a water bath at 55 ℃ overnight.

(8) The centrifuge tube was opened, allowed to stand at room temperature until ethanol was evaporated, and 30-50. mu.L of TE buffer was added to dissolve the DNA precipitate.

Step S3 genomic PCR:

(1) primer5 software is used to design BmE93(SEQ ID NO.2) Primer, which is synthesized from Huada gene, and after the Primer is synthesized, ultrapure water is added for dissolving and diluting, and then the Primer is stored at 4 ℃.

1 μ L of genomic DNA;

dNTP (deoxyribonucleoside triphosphate) 0.8. mu.L;

0.1 mu L of HiFi Taq enzyme;

forward and reverse primers are 0.2 mu L respectively;

1 mu L of buffer solution I;

6.7 mu L of double distilled water;

total system 10 μ L;

(3) the PCR amplification conditions were as follows:

pre-denaturation at 94 ℃ for 5 min;

denaturation at 94 ℃ for 30 s;

annealing at 50 ℃ for 30 s;

extension at 72 ℃ for 30 s;

repeat 35 cycles;

72℃10min；

after the reaction was completed, 1% agarose gel was prepared, and 5. mu.L of PCR amplification product was subjected to electrophoresis. The detection results are shown in FIG. 8. The result proves that the transgenic silkworm over-expressing BmE93(SEQ ID NO.2) is successfully made.

Example 10 molecular identification of transgenic Bombyx mori overexpressing BmSdRFP

Step S1 Silk glands of wild type silkworms Nistari and PSG specifically overexpressing BmSdRFP (SEQ ID NO.3) on day six of the five-instar of transgenic silkworms were dissected and collected by a 1.5mL centrifuge tube.

Step S3 genomic PCR:

(1) the Primer of BmSdRFP (SEQ ID NO.3) is designed by using Primer5 software, the Primer is synthesized by Huada gene, and the Primer is dissolved and diluted by adding ultrapure water after being synthesized and then stored at 4 ℃.

1 μ L of genomic DNA;

dNTP (deoxyribonucleoside triphosphate) 0.8. mu.L;

0.1 mu L of HiFi Taq enzyme;

forward and reverse primers are 0.2 mu L respectively;

1 mu L of buffer solution I;

6.7 mu L of double distilled water;

total system 10 μ L;

(3) the PCR amplification conditions were as follows:

pre-denaturation at 94 deg.C for 5 min;

denaturation at 94 ℃ for 30 s;

annealing at 50 ℃ for 30 s;

extension at 72 ℃ for 30 s;

repeat 35 cycles;

72℃10min。

after the reaction was completed, 1% agarose gel was prepared, and 5. mu.L of PCR amplification product was subjected to electrophoresis. The detection results are shown in FIG. 9. The result proves that the transgenic silkworm over-expressing BmSdRFP (SEQ ID NO.3) is successfully made.

SEQ ID NO.1 BmFMBP1 gene sequence:

atgggtgatttaagtcaagcagatagttcttggaagaaaatggttatagctaaaacaaacaatgagtggaaatcatctgtcggtgaagatgcgaatgcagctagtaacactacacactttagattaagtgatgaatgcatacaatacgataacattaaaaaagaaattgaggaaattgatgaacaagagacactcaataccgtcgagccggtcgatatgatacaagaaatggacccactatcattgttggagcctaaagcgcgtagacgaaggaaaggctcaggaccaaagagtgaaacatcagaagagagagccgcacggctagccaagatgtctgcatatgcagcacagaggctggcaaatgagtcaccggaacagcgcgccactagactgaagcgtatgtccgaatatgcagctaaaagactttcatcagagacgagagaacagagagcgattaggttggcaagaatgtctgcatatgcagcccgtcgacttgctaatgagaccccagcacaaaggcaagctagactattgaggatgtcggcatatgctgcgaaaaggcaggctagcaagaagtctcttagtacagtgaacgatagcttgaattacagtattatgccgaatcaaagtagagcaactaatcatccattcactggtaagcctatccctaaccctctcctcggtctcgattctacgtaa

SEQ ID NO.2 BmE93 gene sequence

atgggtagaagaaaatggaaactatatcaggacgcgttaataccaaagcgaaacgaacaggacgattcagacgattcgatgccatccaccgacccgcccccggcgctcaagatcaaaaccatcgaggaaatcaacgcgccagaagacgagaggcccagggtcgagagcgatggaaacggccaagagtcgaagacgtcacggccggagacgatcctggagagtctgatcaagaggccggcgacgcagccgaaagtggaagtcctagaggaaccagcggattggaagccgccagacaagtgctacttctgcgtagatggtgagcccagggctacagctgaagctgctcaacccgtcggcgctaccagtcccgcgtcagagtccgatagcagttctgtgtccggcacgaacagtccagctgcggctcctccactgctgcagcatctcctgcagctccaagcgcagaacccacagactatagcacagttccagcagatgatagcggcgttgacggcgctgggcacggggctggtgcctccaccgctcacgcaggcctggatgatgcagaggttcgcgcagcagcgacaccaggccgacaggttgtctgaaagcgataaagcggcggccccttcgtctccaagtcctgtagaacagccgttagacctgagcgccaagtccacgtccagcaccagcggtacgcctccgcctgaccccaaattcttggatagcagattaagacgaacagctttagatggagcatcgaatagcacggggcggcgcacttacacggaagacgagctgcagtcagccctgcgcgacatccagtcggggcggctcggcacgcgacgggctgccgtgctttacggcatcccacgctccaccctacggaacaaggtcaacaagttcggcctcgtcgcggataaccacgactccgaccccgacagcgaccaggaccgcgccgagtctccgccttctgtcatactcaagataccgaccttccctccccccgatgacaagagcccgtcaccagcgacgccagtcactacgccgatcacccccctcacgccgctcatctcccagccgccagctggttcccaacacatttttacgtcgttgaatgacgttatagcgaaaagcataagtcagaaattccagcagccgctcgacaggacacaccaagcggacctttccttcatgagagcgccggacgctcgacacgtgtcagtcatcaagagccaatctgacaaccaaaggaactacgcgatgccgagcaattccaaggtgcctacgaacaataacggccaagccgccgctggaggcaagggcactagacccaagaggggtaaatataggaactacgatcgagacagcctcgttgaggcggtgaaagcagtccagcgaggagagatgtccgtgcaccgcgccggctcttattacggtgtcccccactcaacgctcgaatacaaagtcaaggaaagacatttaatgcggcctaggaagcgcgaaccaaaacctcctccacaagatacgaagccgcagcctcctaagccgctcccaccgaagccgccgggcaagccattctcaaacaaactccgtccgcggaacggcacccccgcgcccagcccgccccccgcgccgcctgaccgcgccgactacaaggacgacgacgacaagtag

SEQ ID NO.3 BmSdRFP gene sequence

Atgtcggcggcggacgcggagggcgtctggagtcccgacatcgaacagagcttccaagaggcgctggcgatatacccgccctgtggacgacgcaaaattattctctccgacgagggcaagatgtacggaaggaacgagttaatagcgaggtatattaaactaaggacaggcaaaacgcgtacgagaaaacaagtctcgtcacacatacaggtgctagctaggcgaaaactacgagaaattcaagccaaacttaaagtgcaattttggcagccaggcctacaagccggcacatcacaggatgtgaagcctttccccggtgcgggctacaaaggcgtccccggtgtcggaggcgtcggagtgccgagcggcaccgacgtggcgccgccgccgccctgggagggacgcgccatcgccacacacaaactgagactcgtagagttctccgccttcgtcgagcatccccgggatcctgatacgtacccaccgagcacggcgccggcgcaacatctcttcgttcacataggcggtacggtcacatacgcggatcctttattagagtcagtagacgttcagcagataaacgacaaattccctgagaagaagggcggtctgaaggaactgtacgagaaaggtccgaggaacgccttcttcctggtcaagttctgggcggatctcaacacgaacaacctcgacgaccccggcgccttctacggcgtcacaagtgtatacgaaagtaatgagaacatgacgataacgtgtagcacgaaagtgtgttcgttcgggaagcaggtggtcgaaaaggtggaaactgaatacgcccggttcgagggcggtcgcttcgtgtaccgcatccacaggtcgccgatgtgcgagtacatggtcaacttcatacacaaactgaaacatctgcccgagaagtacatgatgaacagcgtactagaaaacttcactatactacaggtagtttcaaaccgagacacgcaagagacattactgtgcgccgcgttcgtatttgaagtgtcgaacagtgagcacggggcgcagcatcacatctacaggctcgtcaaagatatggtgcgctcctccaagaacgtcatcaaggagttcatgcgcttcaaggtgcgcatggagggcaccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggccacaacaccgtgaagctgaaggtgaccaagggcggccccctgcccttcgcctgggacatcctgtccccccagttccagtacggctccaaggtgtacgtgaagcaccccgccgacatccccgactacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggctgcttcatctacaaggtgaagttcatcggcgtgaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggcgagatccacaaggccctgaagctgaaggacggcggccactacctggtggagttcaagtccatctacatggccaagaagcccgtgcagctgcccggctactactacgtggactccaagctggacatcacctcccacaacgaggactacaccatcgtggagcagtacgagcgcaccgagggccgccaccacctgttcctgtag

SEQ ID NO.4 bombyx mori fibH gene promoter sequence

cctgcgtgatcaggaaaaatgtggaaagcttaacgattttgtcacattttacttatcacaacttgtttttataataattcgcttaaatgagcagctattacttaatctcgtagtggtttttgacaaaatcagcttctttagaactaaaatatcatttttttcgtaatttttttaatgaaaaatgctctagtgttatacctttccaaaatcaccattaattaggtagtgtttaagcttgttgtacaaaactgccacacgcatttttttctccactgtaggttgtagttacgcgaaaacaaaatcgttctgtgaaaattcaaacaaaaatattttttcgtaaaaacacttatcaatgagtaaagtaacaattcatgaataatttcatgtaaaaaaaaaatactagaaaaggaatttttcattacgagatgcttaaaaatctgtttcaaggtagagatttttcgatatttcggaaaattttgtaaaactgtaaatccgtaaaattttgctaaacatatattgtgttgttttggtaagtattgacccaagctatcacctcctgcagtatgtcgtgctaattactggacacattgtataacagttccactgtattgacaataataaaacctcttcattgacttgagaatgtctggacagatttggctttgtatttttgatttacaaatgtttttttggtgatttacccatccaaggcattctccaggatggttgtggcatcacgccgattggcaaacaaaaactaaaatgaaactaaaaagaaacagtttccgctgtcccgttcctctagtgggagaaagcatgaagtaagttctttaaatattacaaaaaaattgaacgatattataaaattctttaaaatattaaaagtaagaacaataagatcaattaaatcataattaatcacattgttcatgatcacaatttaatttacttcatacgttgtattgttatgttaaataaaaagattaatttctatgtaattgtatctgtacaatacaatgtgtagatgtttattctatcgaaagtaaatacgtcaaaactcgaaaattttcagtataaaaaggttcaactttttcaaatcagcatcagttcggttccaactctcaag

SEQ ID NO.5 GAL4BD gene sequence

atgaaactgctctcatcaatcgaacaggcctgtgacatttgtagactcaaaaaactcaaatgctccaaggagaaacccaaatgtgccaaatgcctgaaaaacaactgggagtgccggtactctcctaaaaccaaacggagccctctcacacgggcccatctcactgaagtggaatctcgactcgaacggctcgaacagctctttctgctcatctttcctagagaggatctcgacatgatcctgaaaatggatagcctccaggacatcaaagccctgctcactggactgtttgtccaggataacgtgaacaaggacgccgtgaccgataggctggcatccgtggaaaccgatatgccactcacactgagacagcaccggattagtgccacatcttcttccgaggagtcatccaataagggacagcgacagctcaccgtgtca

SEQ ID NO. 610 XUAS sequence

cggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggaagcttgcatgcctgcaggtcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagactctagcgagcgccggagtataaatagaggcgcttcgtctacggagcgacaattcaattcaaacaagcaaagtgaacacgtcgctaagcgaaagctaagcaaataaacaagcgcagctgaacaagctaaacaatctgcagtaaagtgcaagttaaagtgaatcaattaaaagtaaccagcaaccaagtaaatcaactgcaactactgaaatctgccaagaagtaattattgaatacaagaagagaactctgaatagggaattgg

SEQ ID NO.7 protein activation domain VP16 sequence

tgcaccgcccctattaccgatgtgtctctgggcgacgaactccggctggatggcgaggaagtcgatatgacccctgccgacgctctcgacgatttcgacctggaaatgctgggagatgtcgaatctccttctcctggcatgacacacgatcccgtgtcttacggagcactggatgtgtaa

SEQ ID NO.8 termination signal Ser1-poly A sequence

tacaactaaacacgacttggagtattccttgtagtgtttaagattttaaatcttacttaatgacttcgaacgattttaacgataactttctctttgtttaactttaatcagcatacataaaaagccccggttttgtatcgggaagaaaaaaaatgtaattgtgttgcctagataataaacgtattatcaaagtgtgtggttttcctttaccaaagacccctttaagatgggcctaatgggcttaagtcgagtcctttccgatgtgttaaatacacatttattacactgatgcgtcgaatgtacacttttaataggatagctccactaaaaattattttatttatttaatttgttgcaccaaaactgatacattgacgaa

SEQ ID NO. 93 XP 3-DsRed sequence

gcaaagtgaacacgtcgctaagcgaaagctaagcaaataaacaagcgcagctgaacaagctaaacaatcggggtaccgctagagtcgacggtaccgcgggcccgggatccaccggtcgccaccatggtgcgctcctccaagaacgtcatcaaggagttcatgcgcttcaaggtgcgcatggagggcaccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggccacaacaccgtgaagctgaaggtgaccaagggcggccccctgcccttcgcctgggacatcctgtccccccagttccagtacggctccaaggtgtacgtgaagcaccccgccgacatccccgactacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggctgcttcatctacaaggtgaagttcatcggcgtgaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggcgagatccacaaggccctgaagctgaaggacggcggccactacctggtggagttcaagtccatctacatggccaagaagcccgtgcagctgcccggctactactacgtggactccaagctggacatcacctcccacaacgaggactacaccatcgtggagcagtacgagcgcaccgagggccgccaccacctgttcctgtagtcataatcagccataccacatttgtag

SEQ ID NO.10 piggyBac right arm

ccctagaaagataatcatattgtgacgtacgttaaagataatcatgcgtaaaattgacgcatgtgttttatcggtctgtatatcgaggtttatttattaatttgaatagatattaagttttattatatttacacttacatactaataataaattcaacaaacaatttatttatgtttatttatttattaaaaaaaaacaaaaactcaaaatttcttctataaagtaacaaaacttttaaacattctctcttttacaaaaataaacttattttgtactttaaaaacagtcatgttgtattataaaataagtaattagcttaacttatacataatagaaacaaattatacttattagtcagtcagaaacaactttggcacatatcaatattatgctctcgacaaataacttttttgcattttttgcacgatgcatttgcctttcgccttattttagaggggcagtaagtacagtaagtacgttttttcattactggctcttcagtactgtcatctgatgtaccaggcacttcatttggcaaaatattagagatattatcgcgcaaatatctcttcaaagtaggagcttctaaacgcttacgcataaacgatgacgtcaggctcatgtaaaggtttctcataaattttttgcgactttggaccttttctcccttgctactgacattatggctgtatataataaaagaatttatgcaggcaatgtttatcattccgtacaataatgccataggccacctattcgtcttcctactgcaggtcatcacagaacacatttggtctagcgtgtccactccgcctttagtttgattataatacataaccatttgcggtttaccggtactttcgttgatagaagcatcctcatcacaagatgataataagtataccatcttagctggcttcggtttatatgagacgagagtaaggggtccgtcaaaacaaaacatcgatgttcccactggcctggagcgactgtttttcagtacttccggtatctcgcgtttgtttgatcgcacggttcccacaatggttt

SEQ ID NO.11 piggyBac left arm

agatctgacaatgttcagtgcagagactcggctacgcctcgtggactttgaagttgaccaacaatgtttattcttacctctaatagtcctctgtggcaaggtcaagattctgttagaagccaatgaagaacctggttgttcaataacattttgttcgtctaatatttcactaccgcttgacgttggctgcacttcatgtacctcatctataaacgcttcttctgtatcgctctggacgtcatcttcacttacgtgatctgatatttcactgtcagaatcctcaccaacaagctcgtcatcgctttgcagaagagcagagaggatatgctcatcgtctaaagaactacccattttattatatattagtcacgatatctataacaagaaaatatatatataataagttatcacgtaagtagaacatgaaataacaatataattatcgtatgagttaaatcttaaaagtcacgtaaaagataatcatgcgtcattttgactcacgcggtcgttatagttcaaaatcagtgacacttaccgcattgacaagcacgcctcacgggagctccaagcggcgactgagatgtcctaaatgcacagcgacggattcgcgctatttagaaagagagagcaatatttcaagaatgcatgcgtcaattttacgcagactatctttctaggg

SEQ ID NO. 123 XP 3-ECFP sequence

gcaaagtgaacacgtcgctaagcgaaagctaagcaaataaacaagcgcagctgaacaagctaaacaatcggggtaccgctagagtcgacggtacgatccaccggtcgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaactctagatcataatcagccataccacatttgtag

While the invention has been described with reference to specific preferred embodiments, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention as defined in the following claims.

Sequence listing

<110> university of southwest

<120> a transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silkworm silk-secreting organs and silkworm varieties thereof

<141> 2022-03-04

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 699

<212> DNA

<213> silkworm (Bombyx mori)

<400> 1

atgggtgatt taagtcaagc agatagttct tggaagaaaa tggttatagc taaaacaaac 60

aatgagtgga aatcatctgt cggtgaagat gcgaatgcag ctagtaacac tacacacttt 120

agattaagtg atgaatgcat acaatacgat aacattaaaa aagaaattga ggaaattgat 180

gaacaagaga cactcaatac cgtcgagccg gtcgatatga tacaagaaat ggacccacta 240

tcattgttgg agcctaaagc gcgtagacga aggaaaggct caggaccaaa gagtgaaaca 300

tcagaagaga gagccgcacg gctagccaag atgtctgcat atgcagcaca gaggctggca 360

aatgagtcac cggaacagcg cgccactaga ctgaagcgta tgtccgaata tgcagctaaa 420

agactttcat cagagacgag agaacagaga gcgattaggt tggcaagaat gtctgcatat 480

gcagcccgtc gacttgctaa tgagacccca gcacaaaggc aagctagact attgaggatg 540

tcggcatatg ctgcgaaaag gcaggctagc aagaagtctc ttagtacagt gaacgatagc 600

ttgaattaca gtattatgcc gaatcaaagt agagcaacta atcatccatt cactggtaag 660

cctatcccta accctctcct cggtctcgat tctacgtaa 699

<210> 2

<211> 1674

<212> DNA

<213> silkworm (Bombyx mori)

<400> 2

atgggtagaa gaaaatggaa actatatcag gacgcgttaa taccaaagcg aaacgaacag 60

gacgattcag acgattcgat gccatccacc gacccgcccc cggcgctcaa gatcaaaacc 120

atcgaggaaa tcaacgcgcc agaagacgag aggcccaggg tcgagagcga tggaaacggc 180

caagagtcga agacgtcacg gccggagacg atcctggaga gtctgatcaa gaggccggcg 240

acgcagccga aagtggaagt cctagaggaa ccagcggatt ggaagccgcc agacaagtgc 300

tacttctgcg tagatggtga gcccagggct acagctgaag ctgctcaacc cgtcggcgct 360

accagtcccg cgtcagagtc cgatagcagt tctgtgtccg gcacgaacag tccagctgcg 420

gctcctccac tgctgcagca tctcctgcag ctccaagcgc agaacccaca gactatagca 480

cagttccagc agatgatagc ggcgttgacg gcgctgggca cggggctggt gcctccaccg 540

ctcacgcagg cctggatgat gcagaggttc gcgcagcagc gacaccaggc cgacaggttg 600

tctgaaagcg ataaagcggc ggccccttcg tctccaagtc ctgtagaaca gccgttagac 660

ctgagcgcca agtccacgtc cagcaccagc ggtacgcctc cgcctgaccc caaattcttg 720

gatagcagat taagacgaac agctttagat ggagcatcga atagcacggg gcggcgcact 780

tacacggaag acgagctgca gtcagccctg cgcgacatcc agtcggggcg gctcggcacg 840

cgacgggctg ccgtgcttta cggcatccca cgctccaccc tacggaacaa ggtcaacaag 900

ttcggcctcg tcgcggataa ccacgactcc gaccccgaca gcgaccagga ccgcgccgag 960

tctccgcctt ctgtcatact caagataccg accttccctc cccccgatga caagagcccg 1020

tcaccagcga cgccagtcac tacgccgatc acccccctca cgccgctcat ctcccagccg 1080

ccagctggtt cccaacacat ttttacgtcg ttgaatgacg ttatagcgaa aagcataagt 1140

cagaaattcc agcagccgct cgacaggaca caccaagcgg acctttcctt catgagagcg 1200

ccggacgctc gacacgtgtc agtcatcaag agccaatctg acaaccaaag gaactacgcg 1260

atgccgagca attccaaggt gcctacgaac aataacggcc aagccgccgc tggaggcaag 1320

ggcactagac ccaagagggg taaatatagg aactacgatc gagacagcct cgttgaggcg 1380

gtgaaagcag tccagcgagg agagatgtcc gtgcaccgcg ccggctctta ttacggtgtc 1440

ccccactcaa cgctcgaata caaagtcaag gaaagacatt taatgcggcc taggaagcgc 1500

gaaccaaaac ctcctccaca agatacgaag ccgcagcctc ctaagccgct cccaccgaag 1560

ccgccgggca agccattctc aaacaaactc cgtccgcgga acggcacccc cgcgcccagc 1620

ccgccccccg cgccgcctga ccgcgccgac tacaaggacg acgacgacaa gtag 1674

<210> 3

<211> 1752

<212> DNA

<213> Bombyx mori (Bombyx mori)

<400> 3

atgtcggcgg cggacgcgga gggcgtctgg agtcccgaca tcgaacagag cttccaagag 60

gcgctggcga tatacccgcc ctgtggacga cgcaaaatta ttctctccga cgagggcaag 120

atgtacggaa ggaacgagtt aatagcgagg tatattaaac taaggacagg caaaacgcgt 180

acgagaaaac aagtctcgtc acacatacag gtgctagcta ggcgaaaact acgagaaatt 240

caagccaaac ttaaagtgca attttggcag ccaggcctac aagccggcac atcacaggat 300

gtgaagcctt tccccggtgc gggctacaaa ggcgtccccg gtgtcggagg cgtcggagtg 360

ccgagcggca ccgacgtggc gccgccgccg ccctgggagg gacgcgccat cgccacacac 420

aaactgagac tcgtagagtt ctccgccttc gtcgagcatc cccgggatcc tgatacgtac 480

ccaccgagca cggcgccggc gcaacatctc ttcgttcaca taggcggtac ggtcacatac 540

gcggatcctt tattagagtc agtagacgtt cagcagataa acgacaaatt ccctgagaag 600

aagggcggtc tgaaggaact gtacgagaaa ggtccgagga acgccttctt cctggtcaag 660

ttctgggcgg atctcaacac gaacaacctc gacgaccccg gcgccttcta cggcgtcaca 720

agtgtatacg aaagtaatga gaacatgacg ataacgtgta gcacgaaagt gtgttcgttc 780

gggaagcagg tggtcgaaaa ggtggaaact gaatacgccc ggttcgaggg cggtcgcttc 840

gtgtaccgca tccacaggtc gccgatgtgc gagtacatgg tcaacttcat acacaaactg 900

aaacatctgc ccgagaagta catgatgaac agcgtactag aaaacttcac tatactacag 960

gtagtttcaa accgagacac gcaagagaca ttactgtgcg ccgcgttcgt atttgaagtg 1020

tcgaacagtg agcacggggc gcagcatcac atctacaggc tcgtcaaaga tatggtgcgc 1080

tcctccaaga acgtcatcaa ggagttcatg cgcttcaagg tgcgcatgga gggcaccgtg 1140

aacggccacg agttcgagat cgagggcgag ggcgagggcc gcccctacga gggccacaac 1200

accgtgaagc tgaaggtgac caagggcggc cccctgccct tcgcctggga catcctgtcc 1260

ccccagttcc agtacggctc caaggtgtac gtgaagcacc ccgccgacat ccccgactac 1320

aagaagctgt ccttccccga gggcttcaag tgggagcgcg tgatgaactt cgaggacggc 1380

ggcgtggtga ccgtgaccca ggactcctcc ctgcaggacg gctgcttcat ctacaaggtg 1440

aagttcatcg gcgtgaactt cccctccgac ggccccgtaa tgcagaagaa gaccatgggc 1500

tgggaggcct ccaccgagcg cctgtacccc cgcgacggcg tgctgaaggg cgagatccac 1560

aaggccctga agctgaagga cggcggccac tacctggtgg agttcaagtc catctacatg 1620

gccaagaagc ccgtgcagct gcccggctac tactacgtgg actccaagct ggacatcacc 1680

tcccacaacg aggactacac catcgtggag cagtacgagc gcaccgaggg ccgccaccac 1740

ctgttcctgt ag 1752

<210> 4

<211> 1126

<212> DNA

<213> silkworm (Bombyx mori)

<400> 4

cctgcgtgat caggaaaaat gtggaaagct taacgatttt gtcacatttt acttatcaca 60

acttgttttt ataataattc gcttaaatga gcagctatta cttaatctcg tagtggtttt 120

tgacaaaatc agcttcttta gaactaaaat atcatttttt tcgtaatttt tttaatgaaa 180

aatgctctag tgttatacct ttccaaaatc accattaatt aggtagtgtt taagcttgtt 240

gtacaaaact gccacacgca tttttttctc cactgtaggt tgtagttacg cgaaaacaaa 300

atcgttctgt gaaaattcaa acaaaaatat tttttcgtaa aaacacttat caatgagtaa 360

agtaacaatt catgaataat ttcatgtaaa aaaaaaatac tagaaaagga atttttcatt 420

acgagatgct taaaaatctg tttcaaggta gagatttttc gatatttcgg aaaattttgt 480

aaaactgtaa atccgtaaaa ttttgctaaa catatattgt gttgttttgg taagtattga 540

cccaagctat cacctcctgc agtatgtcgt gctaattact ggacacattg tataacagtt 600

ccactgtatt gacaataata aaacctcttc attgacttga gaatgtctgg acagatttgg 660

ctttgtattt ttgatttaca aatgtttttt tggtgattta cccatccaag gcattctcca 720

ggatggttgt ggcatcacgc cgattggcaa acaaaaacta aaatgaaact aaaaagaaac 780

agtttccgct gtcccgttcc tctagtggga gaaagcatga agtaagttct ttaaatatta 840

caaaaaaatt gaacgatatt ataaaattct ttaaaatatt aaaagtaaga acaataagat 900

caattaaatc ataattaatc acattgttca tgatcacaat ttaatttact tcatacgttg 960

tattgttatg ttaaataaaa agattaattt ctatgtaatt gtatctgtac aatacaatgt 1020

gtagatgttt attctatcga aagtaaatac gtcaaaactc gaaaattttc agtataaaaa 1080

ggttcaactt tttcaaatca gcatcagttc ggttccaact ctcaag 1126

<210> 5

<211> 441

<212> DNA

<213> Yeast (Saccharomyces cerevisiae)

<400> 5

atgaaactgc tctcatcaat cgaacaggcc tgtgacattt gtagactcaa aaaactcaaa 60

tgctccaagg agaaacccaa atgtgccaaa tgcctgaaaa acaactggga gtgccggtac 120

tctcctaaaa ccaaacggag ccctctcaca cgggcccatc tcactgaagt ggaatctcga 180

ctcgaacggc tcgaacagct ctttctgctc atctttccta gagaggatct cgacatgatc 240

ctgaaaatgg atagcctcca ggacatcaaa gccctgctca ctggactgtt tgtccaggat 300

aacgtgaaca aggacgccgt gaccgatagg ctggcatccg tggaaaccga tatgccactc 360

acactgagac agcaccggat tagtgccaca tcttcttccg aggagtcatc caataaggga 420

cagcgacagc tcaccgtgtc a 441

<210> 6

<211> 483

<212> DNA

<213> Yeast (Saccharomyces cerevisiae)

<400> 6

cggagtactg tcctccgagc ggagtactgt cctccgagcg gagtactgtc ctccgagcgg 60

agtactgtcc tccgagcgga gtactgtcct ccgagcggaa gcttgcatgc ctgcaggtcg 120

gagtactgtc ctccgagcgg agtactgtcc tccgagcgga gtactgtcct ccgagcggag 180

tactgtcctc cgagcggagt actgtcctcc gagcggagac tctagcgagc gccggagtat 240

aaatagaggc gcttcgtcta cggagcgaca attcaattca aacaagcaaa gtgaacacgt 300

cgctaagcga aagctaagca aataaacaag cgcagctgaa caagctaaac aatctgcagt 360

aaagtgcaag ttaaagtgaa tcaattaaaa gtaaccagca accaagtaaa tcaactgcaa 420

ctactgaaat ctgccaagaa gtaattattg aatacaagaa gagaactctg aatagggaat 480

tgg 483

<210> 7

<211> 180

<212> DNA

<213> human herpesvirus 2 Strain (human herpesvirus 2)

<400> 7

tgcaccgccc ctattaccga tgtgtctctg ggcgacgaac tccggctgga tggcgaggaa 60

gtcgatatga cccctgccga cgctctcgac gatttcgacc tggaaatgct gggagatgtc 120

gaatctcctt ctcctggcat gacacacgat cccgtgtctt acggagcact ggatgtgtaa 180

<210> 8

<211> 379

<212> DNA

<213> silkworm (Bombyx mori)

<400> 8

tacaactaaa cacgacttgg agtattcctt gtagtgttta agattttaaa tcttacttaa 60

tgacttcgaa cgattttaac gataactttc tctttgttta actttaatca gcatacataa 120

aaagccccgg ttttgtatcg ggaagaaaaa aaatgtaatt gtgttgccta gataataaac 180

gtattatcaa agtgtgtggt tttcctttac caaagacccc tttaagatgg gcctaatggg 240

cttaagtcga gtcctttccg atgtgttaaa tacacattta ttacactgat gcgtcgaatg 300

tacactttta ataggatagc tccactaaaa attattttat ttatttaatt tgttgcacca 360

aaactgatac attgacgaa 379

<210> 9

<211> 831

<212> DNA

<213> Mushroom coral (Discosoma sp)

<400> 9

gcaaagtgaa cacgtcgcta agcgaaagct aagcaaataa acaagcgcag ctgaacaagc 60

taaacaatcg gggtaccgct agagtcgacg gtaccgcggg cccgggatcc accggtcgcc 120

accatggtgc gctcctccaa gaacgtcatc aaggagttca tgcgcttcaa ggtgcgcatg 180

gagggcaccg tgaacggcca cgagttcgag atcgagggcg agggcgaggg ccgcccctac 240

gagggccaca acaccgtgaa gctgaaggtg accaagggcg gccccctgcc cttcgcctgg 300

gacatcctgt ccccccagtt ccagtacggc tccaaggtgt acgtgaagca ccccgccgac 360

atccccgact acaagaagct gtccttcccc gagggcttca agtgggagcg cgtgatgaac 420

ttcgaggacg gcggcgtggt gaccgtgacc caggactcct ccctgcagga cggctgcttc 480

atctacaagg tgaagttcat cggcgtgaac ttcccctccg acggccccgt aatgcagaag 540

aagaccatgg gctgggaggc ctccaccgag cgcctgtacc cccgcgacgg cgtgctgaag 600

ggcgagatcc acaaggccct gaagctgaag gacggcggcc actacctggt ggagttcaag 660

tccatctaca tggccaagaa gcccgtgcag ctgcccggct actactacgt ggactccaag 720

ctggacatca cctcccacaa cgaggactac accatcgtgg agcagtacga gcgcaccgag 780

ggccgccacc acctgttcct gtagtcataa tcagccatac cacatttgta g 831

<210> 10

<211> 1051

<212> DNA

<213> Trichoplusia ni (Trichoplusia ni)

<400> 10

ccctagaaag ataatcatat tgtgacgtac gttaaagata atcatgcgta aaattgacgc 60

atgtgtttta tcggtctgta tatcgaggtt tatttattaa tttgaataga tattaagttt 120

tattatattt acacttacat actaataata aattcaacaa acaatttatt tatgtttatt 180

tatttattaa aaaaaaacaa aaactcaaaa tttcttctat aaagtaacaa aacttttaaa 240

cattctctct tttacaaaaa taaacttatt ttgtacttta aaaacagtca tgttgtatta 300

taaaataagt aattagctta acttatacat aatagaaaca aattatactt attagtcagt 360

cagaaacaac tttggcacat atcaatatta tgctctcgac aaataacttt tttgcatttt 420

ttgcacgatg catttgcctt tcgccttatt ttagaggggc agtaagtaca gtaagtacgt 480

tttttcatta ctggctcttc agtactgtca tctgatgtac caggcacttc atttggcaaa 540

atattagaga tattatcgcg caaatatctc ttcaaagtag gagcttctaa acgcttacgc 600

ataaacgatg acgtcaggct catgtaaagg tttctcataa attttttgcg actttggacc 660

ttttctccct tgctactgac attatggctg tatataataa aagaatttat gcaggcaatg 720

tttatcattc cgtacaataa tgccataggc cacctattcg tcttcctact gcaggtcatc 780

acagaacaca tttggtctag cgtgtccact ccgcctttag tttgattata atacataacc 840

atttgcggtt taccggtact ttcgttgata gaagcatcct catcacaaga tgataataag 900

tataccatct tagctggctt cggtttatat gagacgagag taaggggtcc gtcaaaacaa 960

aacatcgatg ttcccactgg cctggagcga ctgtttttca gtacttccgg tatctcgcgt 1020

ttgtttgatc gcacggttcc cacaatggtt t 1051

<210> 11

<211> 679

<212> DNA

<213> Trichoplusia ni (Trichoplusia ni)

<400> 11

agatctgaca atgttcagtg cagagactcg gctacgcctc gtggactttg aagttgacca 60

acaatgttta ttcttacctc taatagtcct ctgtggcaag gtcaagattc tgttagaagc 120

caatgaagaa cctggttgtt caataacatt ttgttcgtct aatatttcac taccgcttga 180

cgttggctgc acttcatgta cctcatctat aaacgcttct tctgtatcgc tctggacgtc 240

atcttcactt acgtgatctg atatttcact gtcagaatcc tcaccaacaa gctcgtcatc 300

gctttgcaga agagcagaga ggatatgctc atcgtctaaa gaactaccca ttttattata 360

tattagtcac gatatctata acaagaaaat atatatataa taagttatca cgtaagtaga 420

acatgaaata acaatataat tatcgtatga gttaaatctt aaaagtcacg taaaagataa 480

tcatgcgtca ttttgactca cgcggtcgtt atagttcaaa atcagtgaca cttaccgcat 540

tgacaagcac gcctcacggg agctccaagc ggcgactgag atgtcctaaa tgcacagcga 600

cggattcgcg ctatttagaa agagagagca atatttcaag aatgcatgcg tcaattttac 660

gcagactatc tttctaggg 679

<210> 12

<211> 867

<212> DNA

<213> Victoria jellyfish (Aequorea victoria)

<400> 12

gcaaagtgaa cacgtcgcta agcgaaagct aagcaaataa acaagcgcag ctgaacaagc 60

taaacaatcg gggtaccgct agagtcgacg gtacgatcca ccggtcgcca ccatggtgag 120

caagggcgag gagctgttca ccggggtggt gcccatcctg gtcgagctgg acggcgacgt 180

aaacggccac aagttcagcg tgtccggcga gggcgagggc gatgccacct acggcaagct 240

gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg ccctggccca ccctcgtgac 300

caccctgacc tggggcgtgc agtgcttcag ccgctacccc gaccacatga agcagcacga 360

cttcttcaag tccgccatgc ccgaaggcta cgtccaggag cgcaccatct tcttcaagga 420

cgacggcaac tacaagaccc gcgccgaggt gaagttcgag ggcgacaccc tggtgaaccg 480

catcgagctg aagggcatcg acttcaagga ggacggcaac atcctggggc acaagctgga 540

gtacaactac atcagccaca acgtctatat caccgccgac aagcagaaga acggcatcaa 600

ggccaacttc aagatccgcc acaacatcga ggacggcagc gtgcagctcg ccgaccacta 660

ccagcagaac acccccatcg gcgacggccc cgtgctgctg cccgacaacc actacctgag 720

cacccagtcc gccctgagca aagaccccaa cgagaagcgc gatcacatgg tcctgctgga 780

gttcgtgacc gccgccggga tcactctcgg catggacgag ctgtacaagt aaactctaga 840

tcataatcag ccataccaca tttgtag 867

Claims

1. A transgenic method for preparing pure sericin cocoons by inducing complete degeneration of silkworm silk-secreting organs is characterized in that BmFMBP1, BmE93 and BmSdRFP genes are specifically up-regulated in rear silk gland cells of silkworms through a modified GAL4/UAS efficient binary expression system, so that the rear silk gland organs are completely degenerated and disappear, and normal silking and cocooning can still be realized.

2. The transgenic method for inducing the complete degeneration of silkworms secretion organs to prepare pure sericin cocoons according to claim 1, which comprises the steps of:

step S1, GAL4/UAS expression vector construction;

step S2, making GAL4/UAS transgenic silkworm;

step S4, morphological observation is carried out on cocoon shells of the 3 kinds of GAL4/UAS transgenic silkworms, and photos are taken by a camera;

and step S5, extracting DNA from the 5L6D silk glands of the 3 rear silk gland-specific GAL4/UAS transgenic silkworms, carrying out PCR amplification on the successfully extracted DNA according to designed primers, and carrying out nucleic acid electrophoresis on the amplification result.

3. The transgenic method for preparing pure sericin cocoons by inducing the complete degeneration of silkworm silk-secreting organs as claimed in claim 2, wherein the GAL4/UAS expression vector constructing step comprises constructing a vector for GAL4 specific activation expression of the posterior silk gland of silkworms and an expression vector for connecting a target gene with UAS.

4. The transgenic method for inducing the complete degeneration of silkworms secretion organs to prepare pure sericin cocoons according to claim 3, wherein the GAL4 vector mainly comprises: the fibroin heavy chain fibH is used as a promoter (SEQ ID NO.1) [ NCBI gene ID: NM-001113262.1 ], the gene sequence of GAL4 protein binding domain is the target sequence (G4BD) (SEQ ID NO. 2).

5. The transgenic method for preparing pure sericin cocoons by inducing the complete degeneration of silkworm silk-secreting organs according to claim 4, wherein the UAS vector mainly comprises a 10 XUAS sequence (SEQ ID NO.3) and a downstream gene sequence of interest.

6. The transgenic method for inducing complete degeneration of silkworm silk-secreting organs to produce pure sericin cocoons according to claim 5, wherein the GAL4/UAS transgenic silkworms are prepared by: the GAL4 transgenic silkworm with red fluorescence on eyes and the UAS knockout transgenic silkworm with green fluorescence on eyes are obtained by microinjecting the two expression vectors through silkworm embryos, and the two transgenic silkworms are crossed pairwise to obtain the over-expression transgenic silkworm with red fluorescence and green fluorescence on eyes.

7. A silkworm variety obtained by a transgenic method for inducing complete degeneration of silkworm silk secretion organs is characterized in that BmFMBP1, BmE93 and BmSdRFP genes are specifically up-regulated in rear silk gland cells of silkworms through a modified GAL4/UAS high-efficiency binary expression system, so that the rear silk gland organs are completely degenerated and disappear, but normal silk spinning and cocooning can still be realized, and offspring can be bred.