CN114540364B

CN114540364B - Transgenic method for improving silk fibroin content in silkworm cocoons and silkworm variety thereof

Info

Publication number: CN114540364B
Application number: CN202210213529.6A
Authority: CN
Inventors: 徐汉福; 曾文慧; 欧瑶; 罗琴; 刘荣鹏; 马艳; 马静文; 唐艺芸; 胡杰; 陈玉琴; 向仲怀
Original assignee: Southwest University
Current assignee: Southwest University
Priority date: 2022-03-04
Filing date: 2022-03-04
Publication date: 2023-07-18
Anticipated expiration: 2042-03-04
Also published as: CN114540364A

Abstract

The invention provides a transgenic method for improving the silk fibroin content in silkworm cocoons and a silkworm variety thereof, wherein the transgenic method for improving the silk fibroin content in silkworm cocoons respectively constructs a specific over-expression BmDimm and specific knockout BmYki and BmSd in the rear silk gland of the silkworm through a GAL4/UAS system, and obtains the transgenic silkworm with the enlarged rear silk gland; the silk fibroin content of the silkworms can be improved by specifically knocking out BmYki in the rear silk gland of the silkworms, or the silk fibroin content of the silkworms can be improved by specifically knocking out BmSd in the rear silk gland of the silkworms, or the silk fibroin content of the silkworms can be improved by specifically over-expressing BmDimm in the rear silk gland of the silkworms. According to the sequence codon preference of the silkworm silk gland expression endogenous gene in the silkworm genome sequence database, the gene sequence of the Cas9 protein is optimally designed, so that the Cas9 gene is more beneficial to expression in silkworm individual silk glands; tissue-specific knockout and overexpression of silkworm silk gland are carried out by GAL4/UAS system and CRISPR/Cas9 gene editing technology.

Description

Transgenic method for improving silk fibroin content in silkworm cocoons and silkworm variety thereof

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to a transgenic method for improving silk fibroin content in silkworm cocoons and a silkworm variety thereof.

Background

Silkworm is an important economic insect and lepidopteran mode insect. In the raising and domesticating process for over five thousands of years, the improvement of the silk yield of the silkworms is mainly realized by the traditional crossbreeding method, and the technical challenges of long breeding period, complex operation, more and more difficult acquisition of excellent characters and the like exist. Along with the completion of the whole genome sequencing of the silkworms, the research and the knowledge of human beings on the silkworms are marked to enter the era of genetic modification, and the genetic modification of the economic characters of the silkworms from the genome level by utilizing the efficient and stable transgenic technology is a simple and quick technical means.

CRISPR/Cas is an immune mechanism from bacterial immune viral DNA invasion, with CRISPR/Cas9 systems being most widely used. Cas9 protein can bind to gRNA to form a complex, then form a hairpin structure by binding to PAM sequence in genome, and then cut the target DNA double strand, so that the DNA double strand breaks, and then the damage of the DNA can initiate intracellular repair mechanism, mainly comprising two ways: firstly, repairing is carried out through a non-homologous end connecting way, and the repairing mechanism can lead to deletion or insertion of bases, thereby leading to frame shift mutation and finally realizing gene knockout; and secondly, under the condition of providing an exogenous repair template, repairing the DNA breaking position through homologous repair, and realizing the accurate editing of the target gene by using the mechanism.

A large number of PAM sequences exist in the whole genome sequence of the silkworm, and in theory, all genes of the silkworm can be knocked out and edited. However, tissue-specific knockouts have not been achieved in silkworms at present.

Disclosure of Invention

Based on the technical problems in the prior art, the invention provides a transgenic method for improving the silk fibroin content in silkworm cocoons and a silkworm variety thereof.

According to a first aspect of the technical scheme of the invention, a transgenic method for improving silk fibroin content in silkworm cocoons is provided, wherein through a GAL4/UAS system, a transgenic silkworm with enlarged rear silk glands is respectively constructed by specifically over-expressing BmDimm and specifically knocking out BmYki and BmSd in the rear silk glands of silkworm; the silk fibroin content of the silkworms can be improved by specifically knocking out BmYki in the rear silk gland of the silkworms, or the silk fibroin content of the silkworms can be improved by specifically knocking out BmSd in the rear silk gland of the silkworms, or the silk fibroin content of the silkworms can be improved by specifically over-expressing BmDimm in the rear silk gland of the silkworms.

Specifically, through the modified GAL4/UAS high-efficiency binary expression system and CRISPR/Cas9 (the gene sequence (SEQ ID NO. 1) of Cas9 protein is optimized according to the preference of silkworm codons), bmDimm (SEQ ID NO. 2) is specifically over-expressed in silkworm rear silk gland, bmYki (SEQ ID NO. 3) and BmSd (SEQ ID NO. 4) genes are specifically knocked out to cause the increase of rear silk gland organs, the synthesis amount of silk fibroin is increased, and silk spinning and cocoon formation can be normally carried out.

Wherein, the method for improving silk fibroin content of the silkworm by specifically knocking out BmYki in silk gland at the rear part of the silkworm comprises the following steps:

s1, constructing GAL4 expression vectors;

s2, constructing a UAS expression vector for knocking out BmYki;

s3, preparing transgenic silkworms with BmYki specifically knocked out in PSG;

s4, carrying out morphological observation on 5L6D silk glands of the transgenic silkworms with BmYki specifically knocked out in PSG, and taking pictures by using a camera;

s5, morphological observation is carried out on cocoon shells of the transgenic silkworms with BmYki knocked out specifically in PSG, and a camera is used for shooting a photo for evidence and verification;

and S6, extracting DNA from 5L6D silk glands of transgenic silkworms with BmYki specifically knocked out in PSG, carrying out PCR amplification on the successfully extracted DNA according to primers designed by knocked-out sites, and carrying out nucleic acid electrophoresis on the amplification result.

Further, a method for increasing silk fibroin content of silkworms by specifically knocking out BmSd in silk glands at the rear of silkworms, comprising the steps of:

s1, constructing GAL4 expression vectors;

s2, constructing a UAS expression vector for knocking out BmSd;

s3, preparing transgenic silkworms with BmSd specifically knocked out in PSG;

S4, carrying out morphological observation on 5L6D silk glands of transgenic silkworms with BmSd specifically knocked out in PSG, and taking a photo for evidence and verification by using a camera;

s5, morphological observation is carried out on cocoon shells of the transgenic silkworms with BmSd knocked out specifically in the PSG, and a camera is used for shooting a photo for evidence and verification;

and S6, extracting DNA from 5L6D silk glands of transgenic silkworms with BmSd specifically knocked out in PSG, carrying out PCR amplification on the successfully extracted DNA according to primers designed by knocked-out sites, and carrying out nucleic acid electrophoresis on the amplification result.

Preferably, a method for increasing silk fibroin content of silkworms by specifically overexpressing bmdim in the rear silk gland of silkworms, comprising the steps of:

s1, constructing GAL4 expression vectors;

s2, constructing a UAS expression vector for over-expressing BmDimm;

s3, preparing transgenic silkworms with specific over-expression BmDimm in PSG;

s4, carrying out morphological observation on 5L6D silk glands of transgenic silkworms with specific over-expression BmDimm in PSG, and taking a photo for evidence and verification by using a camera;

s5, morphological observation is carried out on cocoon shells of the transgenic silkworms with the specificity of over-expressing BmDimm in the PSG, and a camera is used for shooting a photo for evidence and verification;

And S6, extracting DNA from 5L6D silk glands of transgenic silkworms with specific over-expression BmDimm in PSG, designing primers according to BmDimm sites to carry out PCR amplification on the extracted DNA, and carrying out nucleic acid electrophoresis on the amplification result to carry out genome identification.

Additionally, GAL4 expression vector construction: the GAL4 vector for the silkworm rear silk gland specific activation expression is constructed, namely the GAL4 expression vector taking the silk fibroin heavy chain fibH as a promoter and taking the gene sequence of the GAL4 protein binding domain as a target gene.

Wherein, the UAS expression vector of the BmYki is knocked out and constructed: sequentially connecting a plurality of sequences such as a 10 XUAS sequence, a Cas 9 protein coding sequence optimized according to the preference of silkworm codons, a U6 promoter sequence, two BmYki knockout targets, ser1-polyA serving as a termination signal and the like in series to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector skeleton, namely pBac [3 XP 3-ECFP ] and naming the target gene expression frame as BmYki knockout.

Preferably, the corresponding HG4 transgenic silkworms and UAS transgenic silkworms are obtained through embryo microinjection and fluorescence screening, and the transgenic silkworms with red fluorescence and green fluorescence in eyes are screened through hybridization of the two transgenic silkworms.

Further, the UAS expression vector with BmSd knocked out is constructed: sequentially connecting a plurality of sequences such as a 10 XUAS sequence, a Cas 9 protein coding sequence optimized according to the preference of silkworm codons, a U6 promoter sequence, two BmSd knockout targets, ser1-polyA serving as a termination signal and the like in series to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector framework, namely pBac [3 XP 3-ECFP ] and naming the target gene expression frame as BmSd knockout.

Still further, UAS expression vector construction that overexpresses BmDimm: and sequentially connecting a plurality of sequences of 10 XUAS sequence, bmDimm as a target gene, ser1-polyA as a termination signal and the like in series to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector skeleton, namely pBac [3 XP 3-ECFP ] and naming the target gene expression frame as over-expression BmDimm.

According to a second aspect of the technical scheme of the invention, a silkworm variety obtained by the transgenic method for improving the silk fibroin content in silkworm cocoons is provided, wherein through a GAL4/UAS system, a transgenic silkworm with increased rear silk glands is obtained by respectively constructing specific over-expression BmDimm and specific knockout of BmYki and BmSd in rear silk glands of the silkworm, and further, a high-yield silk variety with increased silk spitting quantity of the silkworm is produced.

Compared with the prior art, the transgenic method for improving the silk fibroin content in the cocoons and the technical scheme of the silkworm variety thereof have the advantages that:

1. according to the sequence codon preference of the silkworm silk gland expression gene in the silkworm genome sequence database, the gene sequence (SEQ ID NO. 1) of the Cas9 protein is subjected to codon optimization design, so that the Cas9 gene is expressed more efficiently in the silkworm silk gland;

2. tissue-specific target gene knockout and target gene overexpression are performed on the silk gland of the family through a GAL4/UAS system and a CRISPR/Cas9 gene editing technology.

3. The invention specifically over-expresses the silkworm gene BmDimm (SEQ ID NO. 2) and specifically knocks out the silkworm gene BmYki (SEQ ID NO. 3) and BmSd (SEQ ID NO. 4) in the silkworm rear silk gland, so that the silkworm rear silk gland can be enlarged, the silk fibroin synthesis is increased, and the silk output is increased.

4. The silkworm variety with increased silk fibroin content created by the invention has good application prospect in the field of silkworm industry.

Drawings

FIG. 1 is a schematic diagram showing the results of GAL4/UAS transgenic silkworms according to the transgenic method for increasing silk fibroin content in cocoons of the present invention;

FIG. 2 is a diagram showing the results of silk gland observation of GAL4/UAS transgenic silkworms with rear silk gland-specific over-expression BmDimm (SEQ ID NO. 2);

FIG. 3 is a diagram showing the result of silk gland observation of GAL4/UAS transgenic silkworms with BmYki (SEQ ID NO. 3) knocked out by rear silk gland;

FIG. 4 is a diagram showing the result of silk gland observation of GAL4/UAS transgenic silkworms with BmSd (SEQ ID NO. 4) knocked out by the rear silk gland;

FIG. 5 is a diagram showing the observation result of the silkworm cocoon of the GAL4/UAS transgenic silkworm with BmYki (SEQ ID NO. 3) knocked out by the rear silk gland;

FIG. 6 is a diagram showing the observation result of cocoons of GAL4/UAS transgenic silkworms with BmSd (SEQ ID NO. 4) knocked out by the rear silk gland;

FIG. 7 is a graph showing the result of genome identification of GAL4/UAS transgenic silkworms with rear silk gland-specific over-expression BmDimm (SEQ ID NO. 2);

FIG. 8 is a graph showing the target knockout efficiency identification result of the GAL4/UAS transgenic silkworms with BmYki (SEQ ID NO. 3) knocked out by the rear silk gland;

FIG. 9 is a graph showing the result of genome identification of GAL4/UAS transgenic silkworms with BmSd (SEQ ID NO. 4) knocked out by the rear silk gland.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the technical solutions, but not all embodiments. All other embodiments, which are obtained by a person skilled in the art without making any inventive effort, are within the scope of the present invention based on the embodiments of the present technical solution. In addition, the scope of the present invention should not be limited to the specific structures or components or the specific parameters described below.

The invention provides a transgenic method for improving silk fibroin content in silkworm cocoons and a silkworm variety thereof, which respectively construct a specific over-expression BmDimm (SEQ ID NO. 2) and a specific knockout BmYki (SEQ ID NO. 3) and a specific knockout BmSd (SEQ ID NO. 4) in the rear silk gland of the silkworm through a GAL4/UAS system, and both obtain the transgenic silkworm with the enlarged rear silk gland, thereby further leading to the high-yield silk variety with the increased silk spitting amount of the silkworm, providing a new method and means for genetic resources of the silkworm, and enriching the conventional silkworm variety.

The transgenic method for improving the silk fibroin content in silkworm cocoons utilizes a GAL4/UAS binary expression system, wherein the GAL4/UAS binary expression system is a set of GAL4 (transcription activator) driven by a specific promoter, and can specifically identify and combine with a UAS sequence (upstream activating sequence) so as to activate transcription of a downstream target gene. The GAL4/UAS binary expression system can activate and express target genes in large quantity and can avoid gene lethal effect. The silk gland utilized in the invention is the only silk-spiter organ of silkworms. Silk is mainly composed of silk fibroin secreted by the posterior silk gland and sericin secreted by the middle silk gland. Silk fibroin is specifically synthesized and secreted by the posterior silk gland, determining the yield and quality of silk.

The invention provides a transgenic method for improving silk fibroin content in silkworm cocoons, and correspondingly provides a method for improving silk fibroin content of silkworms by specifically knocking out BmYki (SEQ ID NO. 3) in silk glands at the rear parts of silkworms. And a method for increasing silk fibroin content of silkworms by specifically knocking out BmSd (SEQ ID NO. 4) in silk glands at the rear of silkworms, and a method for increasing silk fibroin content of silkworms by specifically overexpressing BmDimm (SEQ ID NO. 2) in silk glands at the rear of silkworms. The invention develops a tissue-specific gene editing technology, in particular to a specific gene editing technology aiming at silk glands of silk producing organs of silkworms, which is favorable for realizing accurate transformation of silk characters of silkworms and creating new varieties of silkworms with greatly improved silk yield or quality.

The invention provides a method for improving silk fibroin content of silkworms by specifically knocking out BmYki (SEQ ID NO. 3) in silk glands at the rear parts of silkworms, which comprises the following steps:

step S1, GAL4 expression vector construction: constructing a GAL4 vector for the specific activation expression of silk glands at the rear part of silkworms, namely taking a silk fibroin heavy chain fibH as a promoter (SEQ ID NO. 5), taking a gene sequence of a GAL4 protein binding domain, namely GAL4BD (SEQ ID NO. 6), as a target gene, and taking VP16 as an enhancer (SEQ ID NO. 7); ser1-polyA is the termination signal (SEQ ID NO. 8) which is then inserted into the piggyBac vector backbone, pBac [3×P3-DsRed ], which is completed by the following steps: first, a 3×P3-DsRed sequence (SEQ ID NO. 9) consisting of a 3-fold repeated P3 promoter (eye-and nerve-specific promoter) driven to express a red fluorescent protein (DsRed) sequence was assembled; the right piggyBac arm (SEQ ID NO. 10) and the left piggyBac arm (SEQ ID NO. 11) were then assembled at the 5 'and 3' ends of the 3 XP 3-DsRed sequence, respectively. And is designated HG4.

Step S2, constructing a UAS expression vector of knockout BmYki (SEQ ID NO. 3): sequentially carrying out tandem connection on a plurality of sequences taking a 10 XUAS sequence (SEQ ID NO. 12), a Cas 9 protein coding sequence (SEQ ID NO. 1) optimized according to the preference of silkworm codons, a U6 promoter sequence (SEQ ID NO. 13), two BmYki knockout targets (SEQ ID NO. 3), ser1-polyA (SEQ ID NO. 8) as termination signals and the like to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector framework, namely pBac [3 XP 3-ECFP ], wherein the framework vector is completed by the following steps: first, a 3 XP 3-ECFP sequence (SEQ ID NO. 14) consisting of a 3-fold repeated P3 promoter (eye-and nerve-specific promoter) driving the expression of an ECFP (cyan fluorescent protein) sequence was assembled; the right piggyBac arm (SEQ ID NO. 10) and the left piggyBac arm (SEQ ID NO. 11) were then assembled at the 5 'and 3' ends of the 3 XP 3-ECFP sequence (SEQ ID NO. 14), respectively, and designated knockout BmYki (SEQ ID NO. 3).

Step S3, preparation of transgenic silkworms with BmYki (SEQ ID NO. 3) specifically knocked out in PSG (posterior silk gland): the corresponding HG4 transgenic silkworms and UAS transgenic silkworms are obtained through embryo microinjection and fluorescence screening, and the transgenic silkworms with red fluorescence and blue-green fluorescence in eyes are screened through hybridization of the two silkworms

Step S4, morphological observation is carried out on five-year sixth day (5L 6D) silk glands of transgenic silkworms with BmYki (SEQ ID NO. 3) specifically knocked out in PSG (rear silk glands), and a photo is taken by a camera.

Step S5, morphological observation is carried out on the cocoon shells of the transgenic silkworms with BmYki (SEQ ID NO. 3) specifically knocked out in PSG (posterior silk gland), and a photo is taken by a camera.

S6, extracting DNA from five-year sixth-day (5L 6D) silk glands of transgenic silkworms with BmYki (SEQ ID NO. 3) knocked out specifically in PSG (rear silk glands), carrying out PCR amplification on the extracted DNA according to primers designed by knocked-out sites, carrying out nucleic acid electrophoresis on the amplification result, recovering fragments, linking T-carrier, carrying out company sequencing, and identifying knockout efficiency.

The invention provides a method for improving silk fibroin content of silkworms by specifically knocking out BmSd (SEQ ID NO. 4) in silk glands at the rear parts of silkworms, which comprises the following steps:

step S1, GAL4 expression vector construction: constructing a GAL4 vector for the specific activation expression of silk glands at the rear part of silkworms, namely taking a silk fibroin heavy chain fibH as a promoter (SEM ID No. 5), taking a gene sequence of a GAL4 protein binding domain, namely GAL4BD (SEQ ID No. 6) as a target gene, and taking VP16 as an enhancer (SEQ ID No. 7); ser1-polyA is the termination signal (SEQ ID NO. 8) which is then inserted into the piggyBac vector backbone, pBac [3×P3-DsRed ], which is completed by the following steps: first, a 3×P3-DsRed sequence (SEQ ID NO. 9) consisting of a 3-fold repeated P3 promoter (eye-and nerve-specific promoter) driven to express a red fluorescent protein (DsRed) sequence was assembled; the right piggyBac arm (SEQ ID NO. 10) and the left piggyBac arm (SEQ ID NO. 11) were then assembled at the 5 'and 3' ends of the 3 XP 3-DsRed sequence (SEQ ID NO. 9), respectively. And is designated HG4.

Step S2, constructing a UAS expression vector for knocking out BmSd (SEQ ID NO. 4): sequentially carrying out tandem connection on a plurality of sequences of 10 XUAS sequence (SEQ ID NO. 12), cas 9 protein sequence (SEQ ID NO. 1) which is optimized according to the preference of silkworm codon, U6 promoter sequence (SEQ ID NO. 13), two BmSd knockout targets (SEQ ID NO. 4), ser1-polyA (SEM ID NO. 8) which are termination signals and the like to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector framework, namely pBac [3 XP 3-ECFP ], wherein the framework vector is completed by the following steps: first, a 3 XP 3-ECFP sequence (SEQ ID NO. 14) consisting of a 3-fold repeated P3 promoter (eye-and nerve-specific promoter) driving the expression of an ECFP (cyan fluorescent protein) sequence was assembled; the right piggyBac arm (SEQ ID NO. 10) and the left piggyBac arm (SEQ ID NO. 11) were then assembled at the 5 'and 3' ends of the 3 XP 3-ECFP sequence (SEQ ID NO. 14), respectively, and designated knockout BmSd (SEQ ID NO. 4).

Step S3, preparation of transgenic silkworms with BmSd (SEQ ID NO. 4) specifically knocked out in PSG (posterior silk gland): corresponding HG4 transgenic silkworms and UAS transgenic silkworms are obtained through embryo microinjection and fluorescence screening, and the transgenic silkworms with eyes emitting red fluorescence and cyan fluorescence simultaneously are screened through hybridization of the two silkworms

Step S4, morphological observation is carried out on five-year sixth day (5L 6D) silk glands of transgenic silkworms with BmSd (SEQ ID NO. 4) specifically knocked out in PSG (rear silk glands), and a photo is taken by a camera.

Step S5, morphological observation is carried out on the cocoon shells of the transgenic silkworms with BmSd (SEQ ID NO. 4) specifically knocked out in PSG (posterior silk gland), and a camera is used for shooting pictures.

S6, extracting DNA from five-year sixth-day (5L 6D) silk glands of transgenic silkworms with BmSd (SEQ ID NO. 4) specifically knocked out in PSG (rear silk glands), carrying out PCR amplification on the extracted DNA according to primers designed by knocked-out sites, carrying out nucleic acid electrophoresis on the amplification result, recovering fragments, linking T-carrier, carrying out company sequencing, and identifying knockout efficiency.

The invention provides a method for improving silk fibroin content of silkworms by specifically over-expressing BmDimm (SEQ ID NO. 2) in silk glands at the rear parts of silkworms, which comprises the following steps:

step S1, GAL4 expression vector construction: constructing a GAL4 vector for activating and expressing the rear silk gland specificity of the silkworm, namely taking a silk fibroin heavy chain fibH as a promoter (SEM ID No. 5), taking a GAL4BD as a target gene which is a gene sequence of a GAL4 protein binding domain, and taking VP16 as an enhancer (SEQ ID No. 7); ser1-poly A is the termination signal (SEQ ID NO. 8) which is then inserted into the piggyBac vector backbone, pBac [3×P3-DsRed ], which is completed by the following steps: first, a 3×P3-DsRed sequence (SEQ ID NO. 9) consisting of a 3-fold repeated P3 promoter (eye-and nerve-specific promoter) driven to express a red fluorescent protein (DsRed) sequence was assembled; the right piggyBac arm (SEQ ID NO. 10) and the left piggyBac arm (SEQ ID NO. 11) were then assembled at the 5 'and 3' ends of the 3 XP 3-DsRed sequence (SEQ ID NO. 9), respectively. And is designated HG4.

Step S2, building a UAS expression vector for over-expressing BmDimm (SEQ ID NO. 2): sequentially carrying out tandem connection on a plurality of sequences taking a 10 XUAS sequence (SEQ ID NO. 12) and BmDimm (SEQ ID NO. 2) as target genes, taking Ser1-polyA (SEQ ID NO. 8) as termination signals and the like to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector skeleton, namely pBac [3 XP 3-ECFP ], wherein the skeleton vector is completed by the following steps: first, a 3 XP 3-ECFP sequence (SEQ ID NO. 14) consisting of a 3-fold repeated P3 promoter (eye-and nerve-specific promoter) driving the expression of an ECFP (cyan fluorescent protein) sequence was assembled; the right piggyBac arm (SEQ ID NO. 10) and the left piggyBac arm (SEQ ID NO. 11) were then assembled at the 5 'and 3' ends of the 3 XP 3-ECFP sequence (SEQ ID NO. 14), respectively, and named over-expressed BmDimm (SEQ ID NO. 2).

Step S3, preparation of transgenic silkworms with specific overexpression of BmDimm (SEQ ID NO. 2) in PSG (posterior silk gland): the corresponding HG4 transgenic silkworms and UAS transgenic silkworms are obtained through embryo microinjection and fluorescence screening, and the transgenic silkworms with red fluorescence and blue-green fluorescence in eyes are screened through hybridization of the two silkworms

Step S4, morphological observation is carried out on five-year-six (5L 6D) silk glands of transgenic silkworms which are specifically over-expressed by BmDimm (SEQ ID NO. 2) in PSG (posterior silk gland), and a photo is taken by a camera.

Step S5, morphological observation is carried out on the cocoon shells of the transgenic silkworms with the specificity of over-expressing BmDimm (SEQ ID NO. 2) in PSG (posterior silk gland), and a photo is taken by a camera.

S6, extracting DNA from five-day (5L 6D) silk glands of transgenic silkworms with specificity over-expression BmDimm (SEQ ID NO. 2) in PSG (rear silk glands), designing primers according to BmDimm (SEQ ID NO. 2) sites, performing PCR amplification on the extracted DNA, and performing nucleic acid electrophoresis on the amplification result to identify genome.

Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The experimental methods for which specific conditions are not specified in the examples are generally conducted under conventional conditions or under conditions recommended by the manufacturer.

Example 1, which is mainly the construction of silkworm posterior silk gland specific GAL4/UAS expression vector, combines the three methods described above, comprising the steps of:

step S1 GAL4 construction of an expression vector, namely, a rear silk gland-specific GAL4 expression vector, wherein a silkworm fibH gene promoter (SEQ ID NO. 5) sequence, a GAL4BD (SEQ ID NO. 6) gene sequence, an enhancer VP16 sequence (SEQ ID NO. 7) and a termination signal Ser1-poly A (SEQ ID NO. 8) are sequentially connected in series to form a target gene expression cassette, and a framework vector pBac [3 XP 3-DsRed ] and the target gene expression cassette are cut by using AscI, the framework vector being completed by the steps of: first, a 3×P3-DsRed sequence (SEQ ID NO. 9) consisting of a 3-fold repeated P3 promoter (eye-and nerve-specific promoter) driven to express a red fluorescent protein (DsRed) sequence was assembled; the right piggyBac arm (SEQ ID NO. 10) and the left piggyBac arm (SEQ ID NO. 11) were then assembled at the 5 'and 3' ends of the 3 XP 3-DsRed (SEQ ID NO. 9) sequence, respectively. The expression vector of the silkworm rear silk gland specific GAL4 is successfully constructed by linking through T4 ligase and named HG4.

UAS expression vector construction of step S2-1 knockout BmYki (SEQ ID NO. 3)

The UAS series over-expression gene expression frames are as follows: the 10 XUAS sequence (SEQ ID NO. 12) was ligated in tandem with the Cas9 gene sequence (SEQ ID NO. 1) that had been subjected to the bombyx mori codon optimization, followed by the sequential ligation of the selectable marker gene 3 XP 3-ECFP (SEQ ID NO. 14), the U6 promoter (SEQ ID NO. 13), the 2 BmYki knockout targets (SEQ ID NO. 3), the termination signal Ser1-polyA (SEQ ID NO. 8), and then the backbone vector pBac [3 XP 3-ECFP ] and the gene expression cassette of interest were cut open by using FseI and BgIII, which was completed by the steps of: first, a 3 XP 3-ECFP sequence (SEQ ID NO. 14) consisting of a 3-fold repeated P3 promoter (eye-and nerve-specific promoter) driving the expression of an ECFP (cyan fluorescent protein) sequence was assembled; the right piggyBac arm (SEQ ID No. 10) and the left piggyBac arm (SEQ ID No. 11) were then assembled at the 5 'and 3' ends of the 3 XP 3-ECFP sequence (SEQ ID No. 14), respectively, and linked by T4 ligase into a piggyBac expression vector. And the vector contains a blue-green fluorescent protein (ECFP) gene (SEQ ID NO. 14) with a promoter of 3×P3, namely 3×P3-ECFP, and the cyan fluorescent protein specifically expressed by the eyes and nerves of silkworms is used as a screening marker of positive transgenic silkworms.

UAS expression vector construction of step S2-2 knockout BmSd (SEQ ID NO. 4)

The UAS series over-expression gene expression frames are as follows: the 10 XUAS sequence (SEQ ID NO. 12) was ligated in tandem with the Cas9 gene sequence (SEQ ID NO. 1) that had been subjected to the codon optimization of silkworm, followed by the sequential ligation of the selectable marker gene 3 XP 3-ECFP (SEQ ID NO. 14), the U6 promoter (SEQ ID NO. 13), the 2 BmSd knockout targets (SEQ ID NO. 4), the termination signal Ser1-polyA (SEQ ID NO. 8), and then the backbone vector pBac [3 XP 3-ECFP ] and the gene expression cassette of interest were cut by using FseI and BgIII, which was completed by the following steps: first, a 3 XP 3-ECFP sequence (SEQ ID NO. 14) consisting of a 3-fold repeated P3 promoter (eye-and nerve-specific promoter) driving the expression of an ECFP (cyan fluorescent protein) sequence was assembled; the right piggyBac arm (SEQ ID No. 10) and the left piggyBac arm (SEQ ID No. 11) were then assembled at the 5 'and 3' ends of the 3 XP 3-ECFP sequence (SEQ ID No. 14), respectively, and linked by T4 ligase into a piggyBac expression vector. And the vector contains a blue-green fluorescent protein (ECFP) gene (SEQ ID NO. 14) with a promoter of 3×P3, namely 3×P3-ECFP, and the cyan fluorescent protein specifically expressed by the eyes and nerves of silkworms is used as a screening marker of positive transgenic silkworms.

Step S2-3 construction of UAS expression vector overexpressing BmDimm (SEQ ID NO. 2)

The UAS series over-expression gene expression frames are as follows: 10 XUAS sequence (SEQ ID NO. 12), bmDimm (SEQ ID NO. 2) is the target gene, the termination signal Ser1-polyA (SEQ ID NO. 8), and the backbone vector pBac [3 XP 3-ECFP ] and the target gene expression cassette are cut by using FseI and BgIII, and the backbone vector is completed by the steps of: first, a 3 XP 3-ECFP sequence (SEQ ID NO. 14) consisting of a 3-fold repeated P3 promoter (eye-and nerve-specific promoter) driving the expression of an ECFP (cyan fluorescent protein) sequence was assembled; and then respectively assembling a right piggyBac arm (SEQ ID NO. 10) and a left piggyBac arm (SEQ ID NO. 11) at the 5 'end and the 3' end of the 3 XP 3-ECFP sequence (SEQ ID NO. 14), and linking by a T4 ligase to finally form the UAS over-expression BmDimm (SEQ ID NO. 2) transgene expression vector. And the vector contains a cyan fluorescent protein (ECFP) gene, namely 3 xP 3-ECFP (SEQ ID NO. 14), the promoter of which is 3 xP 3, and the cyan fluorescent protein specifically expressed by the eyes and nerves of silkworms is used as a screening marker of positive transgenic silkworms.

Example 2, which is mainly the production of GAL4/UAS transgenic silkworms, combines the three methods described above, comprising the steps of:

Step S3 transgenic injection and fluorescence screening

After the GAL4/UAS transgenic expression vector is obtained, the GAL4/UAS transgenic expression vector is respectively mixed with auxiliary plasmids (A4 Helper) in equal proportion with the concentration of 450 ng/mu L (nanogram/microliter), the mixture is injected by an Eppendorf microinjection instrument, a plurality of silkworm Nistari (a plurality of batches of silkworm materials can be fed in one year) are taken as injection receptors, silkworm moths are mated for 6 hours before injection, the mixture is placed at 4 ℃ for one day and then taken out of room temperature for spawning, embryos which are just spawned for one hour are taken out, paste is adhered on a glass sheet, the mixture is injected by the Eppendorf microinjection instrument, the mixture is sealed by nontoxic glue, and after being sterilized by 35% formaldehyde steam for 5 minutes, the mixture is placed in an environment with the relative humidity of 85%, the hatched G0 generation (the first generation after injection) silkworm is fed to the silkworm moth, the obtained G0 generation (the first generation after injection) silkworm moth is subjected to selfing or backcrossing, the G1 generation (the second generation after injection silkworm egg) is obtained, the fluorescent knockout of the silkworm egg is screened by using an Olydrum, and the fluorescent knockout of the fluorescent gene of the mulberry leaves is obtained by using a fluorescent knockout microscope of the fluorescent dye of the mulberry leaf (BmID of SEQ ID 4) is knocked out respectively; UAS over-expresses transgenic silkworm BmDimm (SEQ ID NO. 2) and red fluorescence GAL4 transgenic positive silkworm HG4, and is kept normally after first generation of breeding.

Step S3-1 production of transgenic silkworm overexpressing BmDimm (SEQ ID NO. 2)

The GAL4 transgenic silkworms HG4 which emit red fluorescence through the selected eyes and nerves are bred to chemical moths, then the chemical moths are hybridized with UAS over-expressed transgenic silkworms BmDimm (SEQ ID NO. 2) which emit green fluorescence through the selected eyes and nerves, the hatching offspring are bred to four ages through being placed in an environment with the temperature of 25 ℃ and the relative humidity of 85%, and the GAL4/UAS transgenic silkworms which emit green fluorescence and red fluorescence and are specifically expressed in the eyes of the transgenic silkworms are obtained through screening, as shown in the attached figure 1, the production of the transgenic silkworms which express BmDimm (SEQ ID NO. 2) is proved to be successful, and then the transgenic silkworms which emit green fluorescence and red fluorescence are bred to the material-drawing stage normally.

Step S3-2 preparation of specific knockout BmYki (SEQ ID NO. 3) transgenic silkworm

The GAL4 transgenic silkworms HG4 which emit red fluorescence through the selected eyes and nerves are bred to chemical moths, then the chemical moths are bred with UAS knockout transgenic silkworms which emit cyan fluorescence through the selected eyes and nerves, named knockout BmYki (SEQ ID NO. 3), hybridization is carried out, the chemical moths are bred through hatching in an environment with the temperature of 25 ℃ and the relative humidity of 85%, the hatching offspring are bred to four ages, and the GAL4/UAS transgenic silkworms which emit both cyan fluorescence and red fluorescence and are specifically expressed in the eyes of the transgenic silkworms are obtained through screening, as shown in the attached figure 1, the specific knockout BmYki (SEQ ID NO. 3) transgenic silkworms are proved to be successfully manufactured, and then the chemical moths are bred to the material-taking stage normally.

Step S3-3 preparation of specific knockout BmSd (SEQ ID NO. 4) transgenic silkworm

The GAL4 transgenic silkworms HG4 which emit red fluorescence through the selected eyes and nerves are bred to chemical moths, then the chemical moths are bred with UAS knockout transgenic silkworms which emit cyan fluorescence through the selected eyes and nerves, named knockout BmSd (SEQ ID NO. 4), hybridization is carried out, the chemical moths are bred through hatching in an environment with the temperature of 25 ℃ and the relative humidity of 85%, the hatching offspring are bred to four ages, and the GAL4/UAS transgenic silkworms which emit both cyan fluorescence and red fluorescence and are specifically expressed in the eyes of the transgenic silkworms are obtained through screening, as shown in the attached figure 1, the specific knockout BmSd (SEQ ID NO. 4) transgenic silkworms are proved to be successfully manufactured, and then the chemical moths are bred to the material-taking stage normally.

Example 3, which is a GAL4/UAS transgenic silk gland phenotype observation of posterior silk gland specific over-expression BmDimm (SEQ ID NO. 2), further comprising the steps of:

step S4-1, feeding GAL4/UAS transgenic silkworms with blue-green fluorescence and red fluorescence specifically expressed in GAL4/UAS transgenic silkworms with BmDimm (SEQ ID NO. 2) over-expressed by wild-type silkworms Nistari and PSG (rear silk gland) to five years old, dissecting and observing wild-type silkworms Nistari and GAL4/UAS transgenic silkworms with BmDimm (SEQ ID NO. 2) over-expressed in a buffer of 1 XPBS (phosphate buffer), and photographing, and as a result, over-expressed BmDimm (SEQ ID NO. 2) transgenic silkworms with rear silk glands become larger as compared with wild-type silkworms rear silk glands as shown in FIG. 2.

Example 4, which is essentially a silk gland phenotype observation of a rear silk gland specific knockout BmYki (SEQ ID NO. 3) GAL4/UAS transgenic silkworm, further comprising the steps of:

step S4-2, feeding wild-type silkworms Nistari and PSG (rear silk gland) to specifically knock out the rear silk gland of the GAL4/UAS transgenic silkworms BmYki (SEQ ID NO. 3), specifically expressing GAL4/UAS transgenic silkworms which emit blue green fluorescence and red fluorescence to five ages, dissecting and observing the wild-type silkworms Nistari and the GAL4/UAS transgenic silkworms BmYki (SEQ ID NO. 3) in a buffer solution of 1 XPBS for five ages of the rear silk gland (5L 6D), and photographing, as shown in the attached figure 3, the rear silk gland of the transgenic silkworms BmYki (SEQ ID NO. 3) is knocked out to be larger than the rear silk gland of the wild-type silkworms.

Example 5, which is a silk gland phenotype observation of a GAL4/UAS transgenic silkworm with a rear silk gland specific knockout of BmSd (SEQ ID No. 4), further comprises the steps of:

step S4-3, feeding wild-type silkworms Nistari and PSG (rear silk gland) to specifically knock out GAL4/UAS transgenic silkworms of BmSd (SEQ ID NO. 4) to five years old, dissecting and observing wild-type silkworms Nistari and GAL4/UAS transgenic silkworms of BmSd (SEQ ID NO. 4) in a buffer solution of 1 XPBS, photographing the rear silk gland of the five days old (5L 6D) and knocking out the rear silk gland of the BmSd (SEQ ID NO. 4) compared with the rear silk gland of the wild-type silkworms, and finally shortening the rear silk gland of the transgenic silkworms of BmSd (SEQ ID NO. 4).

Example 6, which is a GAL4/UAS transgenic silkworm cocoon phenotype observation of a rear silk gland specific knockout BmYki (SEQ ID NO. 3), further comprising the steps of:

step S5-1, raising wild silkworms Nistari and PSG (rear silk gland) to specifically knock out GAL4/UAS transgenic silkworms BmYki (SEQ ID NO. 3), wherein GAL4/UAS transgenic silkworms which are specifically expressed in the wild silkworms and emit blue-green fluorescence and red fluorescence are clustered, and the raising environment is as follows: raising in an environment with the temperature of 25 ℃ and the relative humidity of 65 percent, and mounting the environment: the ventilation was good, the temperature was 25 ℃, cocoons were picked up and photographed, and the result was shown in fig. 5, in which the knockout BmYki (SEQ ID No. 3) transgenic home cocoons were enlarged compared to the wild home cocoons.

Example 7, which is a GAL4/UAS transgenic silkworm cocoon phenotype observation of a rear silk gland specific knockout BmSd (SEQ ID NO. 4), further comprising the steps of:

step S5-2, raising wild silkworms Nistari and PSG (rear silk gland) to specifically knock out GAL4/UAS transgenic silkworms BmSd (SEQ ID NO. 4), wherein the GAL4/UAS transgenic silkworms which are specifically expressed in the wild silkworms Nistari and PSG (rear silk gland) and emit blue-green fluorescence and red fluorescence are clustered, and the raising environment is as follows: raising in an environment with the temperature of 25 ℃ and the relative humidity of 65 percent, and mounting the environment: the ventilation was good, the temperature was 25 ℃, cocoons were picked up and photographed, and the result was shown in fig. 6, in which the knockout BmSd (SEQ ID No. 4) transgenic home cocoons were smaller than the wild home cocoons.

Example 8, which is the molecular identification of GAL4/UAS transgenic silkworms with rear silk gland specific over-expression BmDimm (SEQ ID NO. 2), further comprising the steps of:

step S6-1, dissecting the rear silk glands of wild silkworm Nistari and the complaint PSG (rear silk glands) specifically overexpressing BmDimm (SEQ ID NO. 2) transgenic silkworms five-year-old (5L 6D) and collecting through a 1.5mL centrifuge tube.

Step S6-2, extracting the genome of the collected posterior silk gland, wherein the extraction steps are as follows:

(1) Cleaning the mortar and the grinding rod, and sterilizing in an oven at 180 ℃ for 2-3 hours. Before the grinding operation is carried out, the silk gland, the mortar and the grinding rod are required to be subjected to liquid nitrogen precooling treatment. After precooling, the silk gland is ground to powder and then transferred to a centrifuge tube with the volume of 1.5mL (milliliter), and the mixture is stored in liquid nitrogen or at the temperature of minus 80 ℃ for standby.

(2) 1mL of DNA extraction Buffer (Buffer) was added to the centrifuge tube and vortexed at 3000rpm (revolutions per minute) to mix well. RNase was added at a working concentration of 100. Mu.L/mL, and the mixture was digested in a thermostatic waterbath at 37℃for 1 hour, then proteinase K was added thereto, and the mixture was digested in a waterbath at 55℃overnight.

(3) After adding an equal volume of Tris-saturated phenol to the centrifuge tube, shaking thoroughly for 10min, followed by centrifugation at 13400rpm for 10min at 4℃and taking 600. Mu.L of the supernatant to a new centrifuge tube.

(4) 600. Mu.L of Tris phenol/chloroform was thoroughly spun and shaken for 10min, then centrifuged at 13400rpm at 4℃for 10min, and the supernatant was transferred to a new centrifuge tube.

(5) The supernatant was subjected to shaking with sufficient rotation for 10min in chloroform of the same volume as the supernatant, and then centrifuged at 13400rpm for 10min at 4℃to collect the supernatant.

(6) Adding absolute ethyl alcohol precooled at 4 ℃ into a centrifuge tube in an equal volume, slightly reversing the solution until uniform white flocculent precipitate appears, and standing for 5min.

(7) The pellet was carefully picked up with a sterile 100. Mu.l sampler and transferred to a new 1.5mL centrifuge tube, washed 1-2 times with 75% ethanol pre-chilled at 4℃and centrifuged at 13400rpm for 10min at 4℃and the supernatant discarded.

(8) The centrifuge tube lid was opened, and left at room temperature until ethanol was evaporated, and 30-50. Mu.L of EB buffer was added to dissolve DNA pellet.

(9) Detecting DNA purity and concentration by using a spectrophotometer, and performing gel electrophoresis detection on the agarose gel, and then placing the obtained product at-80 ℃ for long-term storage for standby.

Step S6-3 genome PCR:

(1) BmDimm (SEQ ID NO. 2) primers were designed by Primer5 software, synthesized from Huada genes, and stored at 4℃after the primers were dissolved and diluted with ultrapure water.

(2) PCR amplification of target fragment is carried out by taking the extracted genome as a template, and the reaction system is as follows:

(3) The PCR amplification conditions were as follows:

(4) After the reaction, 1% agarose gel was prepared, and 5. Mu.L of PCR amplification product was taken for electrophoresis detection. The detection result is shown in figure 7, and the result shows that the transgenic silkworm with the over-expression Bmdimm (SEQ ID NO. 2) is correct.

Example 9, which is a target knockout efficiency identification of a rear silk gland specific knockout BmYki (SEQ ID NO. 3) GAL4/UAS transgenic silkworm, comprising the steps of:

step S7-1, dissecting the rear silk gland of the wild silkworm Nistari and the complaint PSG (rear silk gland) specifically knocked out BmYki (SEQ ID NO. 3) transgenic silkworm five-year-six (5L 6D), and collecting through a 1.5mL centrifuge tube.

Step S7-2, extracting the genome of the collected posterior silk gland, wherein the extraction steps are as follows:

Step S7-3, genome PCR:

(1) Two target primers for knocking out BmYki (SEQ ID NO. 3) are designed by using Primer5 software, and are synthesized by Huada genes, and then added with ultrapure water for dissolution and dilution and then stored at 4 ℃.

(3) The PCR amplification conditions were as follows:

(4) After the reaction, 1% agarose gel was prepared, and 5. Mu.L of PCR amplification product was taken for electrophoresis detection.

Step S7-4, glue recovery:

the gel is placed on an ultraviolet gum cutter, and the adhesive tape containing the target fragment is cut off in order and is filled into a centrifuge tube with the volume of 1.5 mL. Binding Buffer (Binding Buffer) is added according to the amount of 100 mug/300 mug, and the Binding Buffer is placed on a metal bath with constant temperature of 50 ℃ until the Binding Buffer is fully dissolved, and the Binding Buffer is uniformly mixed up and down every 1min, so that the dissolution of gel blocks can be accelerated. After dissolution was completed quickly, the mixture was taken out and cooled to room temperature.

(1) Absolute ethanol was added to Wash Buffer (WB) (Wash Buffer) according to the instructions of the gel recovery kit prior to recovery.

(2) The fully dissolved solution was transferred to an adsorption column, and centrifuged at 13000rpm for 1min after standing for 2min.

(3) 600. Mu.L of Wash Buffer was added and centrifuged at 13000rpm for 1min. This operation is repeated once.

(4) The mixture was further removed by air-separation at 13400rpm for 2min, the column was placed in a sterile 1.5mL centrifuge tube, allowed to stand until ethanol was evaporated, and 35-50. Mu.L of Elutation Buffer (EB) was added and allowed to stand at room temperature for 2min. Centrifuge at 13400rpm for 1min, collect the effluent.

(5) The concentration of the recovered fragments was detected by a spectrophotometer, and 1% agarose gel electrophoresis was further confirmed to be correct.

Step S7-5T clone

(1) T carrier connection is carried out on the target fragment, and the connection system is as follows:

4. Mu.L of the product was recovered;

1 μl of pMD19T vector;

5. Mu.L of the ligation buffer I.

After gentle mixing, the mixture was placed on a linker for 15min at 25 ℃.

Step S7-6 plasmid transformation

(1) Taking out the T1 escherichia coli competent cells at-80 ℃ and placing the competent cells on ice, rapidly sucking 30 mu L of competent cells into a 1.5mL centrifuge tube when the competent cells are about to be completely dissolved, adding 10 mu L of a connecting product, and gently stirring and mixing the mixture.

(2) The centrifuge tube was placed on ice for 30min.

(3) 200 mu L of the antibiotic-free LB liquid medium is added into a centrifuge tube, and then the culture is expanded by a shaking table at a constant temperature of 37 ℃ for 30min.

(4) 100 mu L of bacterial liquid is sucked on an LB/Amp solid plate, uniformly coated by using a sterile coating rod in a crisscross manner, and then placed in a constant temperature incubator at 37 ℃ until the surface of the plate is dried, and then the plate is cultivated in an inverted manner for 12 hours.

Step S7-7 bacterial liquid electrophoresis screening positive clone

(1) Monoclonal colonies in the plates were picked using a 100. Mu.l sampler after autoclaving and transferred to liquid medium containing 500. Mu.l ampicillin resistance. Shaking culture is carried out for 6 hours at constant temperature of 37 ℃ at 220rpm, or turbidity appears in the bacterial liquid.

(2) Firstly, 50 mu L of bacterial lysate is evenly mixed in 50 mu L of 5×loading Buffer (Loading Buffer), 10 mu L of bacterial lysate is respectively packaged into PCR tubes, 10 mu L of bacterial lysate is respectively added into each PCR tube, and after being evenly mixed, the bacterial lysate is cracked for 10min by using a pipetting gun.

After the cleavage is finished, 1% agarose gel is prepared for electrophoresis detection, and positive bacterial liquid is selected and sent to a company for sequencing identification. The sequencing results are shown in FIG. 8. The results demonstrate that 2 knockout BmYki targets (SEQ ID NO. 3) designed in PSG were successfully knocked out.

Example 10, which is the molecular identification of GAL4/UAS transgenic silkworms with a rear silk gland specific knockout of BmSd (SEQ ID NO. 4), comprising the steps of:

step S8-1, dissecting the rear silk gland of the wild silkworm Nistari and the complaint PSG (rear silk gland) specifically knocked out BmSd (SEQ ID NO. 4) transgenic silkworm five-year-six (5L 6D), and collecting through a 1.5mL centrifuge tube.

Step S8-2, extracting the genome of the collected posterior silk gland, wherein the extraction steps are as follows:

Step S8-3, genome PCR:

(1) Two primers for knocking out BmSd targets (SEQ ID NO. 4) are designed by using Primer5 software, and the primers are synthesized by Huada genes, and are dissolved and diluted by ultrapure water and stored at 4 ℃.

(3) The PCR amplification conditions were as follows:

(4) After the reaction, 1% agarose gel was prepared, and 5. Mu.L of PCR amplification product was taken for electrophoresis detection. The detection result is shown in figure 9, and the successful production of the transgenic silkworm with the BmSd (SEQ ID NO. 4) knocked out is proved.

The invention relates to a sequence table

SEQ ID NO.1 Cas 9 Gene sequence

atggacaaaaagtatagcatcggtctggatattggaactaactccgtcggctgggctgtaatcaccgacgaatacaaggtcccgtcaaaaaagttcaaggtattgggtaacacagatcgtcactctatcaaaaagaatctcattggagctctgttgttcgacagcggcgaaacagctgaggccactagactgaagcgcaccgccagacgccgttacacgaggagaaagaacagaatctgctacttgcaagaaatattctcaaacgagatggccaaagtggacgattcgttctttcataggttagaagagagtttccttgttgaagaggataaaaagcacgaaagacatccgatatttggaaacatcgtggacgaagttgcttatcacgagaagtaccccacgatctatcatctgcgtaaaaagttggtggactcgacagataaggccgacctcaggttaatataccttgcactggcgcacatgatcaaattcagaggccattttctgattgaaggtgacctgaaccctgacaatagtgatgtggacaaactcttcattcaattagttcagacctacaatcaactgtttgaagagaaccctatcaacgcttcaggagttgacgctaaggccatccttagtgcgagactgagcaaatcccgccgtctcgaaaacttaatcgcacagttgcctggagagaaaaagaacggtttgttcggaaatctcattgcgttgtcactcggactcacgccaaacttcaagtctaacttcgatttggcagaagacgcgaaactgcaactgagcaaagacacatatgacgatgacctcgataacctcttagctcagatcggcgatcaatacgccgacttgttcctcgctgccaaaaatctgtcggacgctatacttctgagtgatatcttgcgcgtcaacacagaaattactaaggctcctctgtcggccagtatgataaaacgctatgacgaacaccatcaggatttgacattgctcaaagccctcgtgcgtcaacagctcccagaaaagtacaaggagattttctttgatcagtccaagaatggctacgcaggttatatagacggtggagcgtcgcaagaagagttctacaagttcatcaagccaatattagaaaagatggacggcacggaagagttacttgttaagctgaatcgtgaggacctgttgcgtaaacagaggacattcgataacggatcaattccgcaccaaatacatcttggcgaactgcacgctatcctcaggagacaagaggacttctacccctttttaaaggataaccgtgaaaagatcgagaaaatcctgactttcaggattccttactatgtcggcccactggctcgtggtaatagcaggtttgcctggatgaccaggaagtccgaagagacaattactccgtggaacttcgaagaggtggttgataaaggagcatcagcgcagtctttcatagaacgcatgacaaattttgacaagaacttaccgaatgagaaggtccttcccaaacactcactcctctacgaatacttcacagtatacaacgagctcactaaagtcaagtacgtaaccgagggtatgcgcaaacccgctttcctgtctggagagcagaaaaaggccatcgtggaccttctgttcaagacaaaccgtaaggtcactgtaaagcaactcaaggaagactacttcaaaaagatagagtgtttcgattcagtggaaatctctggcgttgaggacagatttaacgcttccttgggtacttaccacgatttgctcaagatcattaaagataaggacttcctcgacaacgaagagaacgaagatatcttagaggacatagttctcacccttacgctgtttgaagatagagagatgattgaagagcgcctgaagacttatgctcatttgttcgatgacaaagtcatgaagcaactgaaacgccgtaggtacaccggctggggtagattatcgcgcaaacttattaatggtataagggacaagcagtcgggaaaaacgatattggactttctcaagagtgatggtttcgccaacagaaattttatgcaactcatacacgatgacagcttaacattcaaggaagatatccaaaaagcacaggtgtcgggacagggcgacagtttgcacgaacatattgctaacctcgccggctccccggcgataaaaaagggtatccttcagactgtgaaagtcgtagatgaactggtgaaggttatgggtcgtcataaacccgagaacatagttatcgaaatggctagggagaatcaaacaactcagaagggacagaaaaactcaagagaacgcatgaagcgcattgaagagggtatcaaagagcttggcagtcaaatcctgaaggaacaccctgtcgagaacacgcaacttcagaacgaaaaattgtacctctactatctgcagaatggtagagatatgtacgtagaccaagaattggatattaaccgcctctcagattacgacgtggatcatatagttccgcagtcattcttgaaggatgactctatcgacaacaaagtcctcacaagatcagacaagaaccgcggaaaatcagataatgtaccctctgaagaggtggttaaaaagatgaaaaactactggagacagttacttaacgctaagttgatcacgcaaagaaagttcgataacctcacaaaggctgaacgcggcggtttaagcgagcttgacaaggccggtttcataaaacgtcagttagtcgaaaccaggcaaattacgaaacacgtagcccaaatattggattcccgcatgaacactaaatacgatgaaaatgacaagctcatccgtgaggtcaaagtaattaccctgaaaagcaagttggtgtccgacttcagaaaggatttccagttctacaaagttcgcgaaatcaacaactaccaccatgcacatgacgcttacctgaacgcagtcgtaggcactgcgttaattaaaaagtaccctaaactggaatctgagttcgtgtacggtgactataaagtgtacgatgttagaaagatgatcgctaaaagcgaacaggagattggaaaggctaccgccaagtatttcttttactccaacatcatgaatttctttaagaccgaaatcacgttagcaaatggcgagatacgtaaaaggccacttatcgaaacaaacggagaaactggcgagatagtgtgggacaagggtagagattttgccactgtccgcaaagtactgtcgatgccgcaagtgaatatcgttaaaaagaccgaagttcaaacgggaggcttcagcaaagagtccatcctgcccaagcgtaacagtgataaattgatagctaggaaaaaggactgggaccctaaaaagtatggtggattcgacagcccaactgtcgcatactccgtattggtggttgcgaaagtcgaaaaaggaaagagcaaaaagctcaagtccgtaaaagagctgttgggcattaccataatggaaagatcatctttcgagaagaatcctatcgattttctggaagccaagggatataaagaggtcaaaaaggacctcataatcaagttaccaaaatacagtctgttcgaattggagaacggcagaaaacgcatgcttgcatcagcgggtgaactgcaaaagggaaatgagttagcacttccttctaaatacgtcaacttcctgtatttggcgtcacactacgaaaaactgaagggctctccagaagataacgagcaaaagcagttatttgtggaacagcacaaacattaccttgacgaaattatagagcaaatctcggagttcagtaagagagtgattttggctgacgccaatcttgataaagttctgtctgcttacaacaagcaccgtgataaaccgattagggaacaggccgagaacatcatacatctcttcacactcactaaccttggtgcacccgcagcgttcaaatattttgacaccacgatagatcgtaagaggtacaccagcacgaaagaagttttggacgcgacactcatccatcaatcaatcacgggcctgtacgagaccagaatcgacctgtcccagctcggtggcgacaaaaggccggcggccacgaaaaaggctggccaggcaaaaaagaaaaagtaa

SEQ ID NO.2 BmDimm Gene sequence

atgccacactgggtaactgctgaagaaggcactgacaccgaatctcctgaccaagttatgttatattacgaagatgacgcttcagaatactatgataataaacccgacggcccagacaatatagaagaacaaaatggagatttttatgatagtggtagcggaagtgatgagccagtgcagcgcaggatgcgcccaagacgcgctgtagtattagggtcttcatcatcagccggcagtacgggacctccttcaggacccggtcgacggcggaggtgtggcatttccgctcgtgaacgcaacctccgtcgtctcgagagcaatgaaagagaaagaatgcgaatgcattccctcaaccgagcttttgaggatttacgccgcgtaatcccacatgtgaaaaaagacaacagaagtctttcaaagatagaaacccttaccttagccaaaaattacgtgaaagccctcacgaatgctatttgcacaatgagaggtgaagttgctcattattcattcaatagcgacgatgaaaacgtggaacccgcatttgtattgaataggagggatcaggagccgaacaacaacgagactgtcagtacggaccagcaagaaattacgacacggacgcaaggtttcttctga

SEQ ID NO.3 BmYki knockout target

ggactcaaagcgaccgctacagg

gatcttggacccttaccagcagg

SEQ ID NO.4 BmSd knockout target spot

tggcgatatacccgccctggttt

tggcagccaggcctacaagcgtt

SEQ ID NO.5 silkworm fibH gene promoter

cctgcgtgatcaggaaaaatgtggaaagcttaacgattttgtcacattttacttatcacaacttgtttttataataattcgcttaaatgagcagctattacttaatctcgtagtggtttttgacaaaatcagcttctttagaactaaaatatcatttttttcgtaatttttttaatgaaaaatgctctagtgttatacctttccaaaatcaccattaattaggtagtgtttaagcttgttgtacaaaactgccacacgcatttttttctccactgtaggttgtagttacgcgaaaacaaaatcgttctgtgaaaattcaaacaaaaatattttttcgtaaaaacacttatcaatgagtaaagtaacaattcatgaataatttcatgtaaaaaaaaaatactagaaaaggaatttttcattacgagatgcttaaaaatctgtttcaaggtagagatttttcgatatttcggaaaattttgtaaaactgtaaatccgtaaaattttgctaaacatatattgtgttgttttggtaagtattgacccaagctatcacctcctgcagtatgtcgtgctaattactggacacattgtataacagttccactgtattgacaataataaaacctcttcattgacttgagaatgtctggacagatttggctttgtatttttgatttacaaatgtttttttggtgatttacccatccaaggcattctccaggatggttgtggcatcacgccgattggcaaacaaaaactaaaatgaaactaaaaagaaacagtttccgctgtcccgttcctctagtgggagaaagcatgaagtaagttctttaaatattacaaaaaaattgaacgatattataaaattctttaaaatattaaaagtaagaacaataagatcaattaaatcataattaatcacattgttcatgatcacaatttaatttacttcatacgttgtattgttatgttaaataaaaagattaatttctatgtaattgtatctgtacaatacaatgtgtagatgtttattctatcgaaagtaaatac

gtcaaaactcgaaaattttcagtataaaaaggttcaactttttcaaatcagcatcagttcggttccaactctcaag

SEQ ID NO.6 GAL4BD gene sequence

atgaaactgctctcatcaatcgaacaggcctgtgacatttgtagactcaaaaaactcaaatgctccaaggagaaacccaaatgtgccaaatgcctgaaaaacaactgggagtgccggtactctcctaaaaccaaacggagccctctcacacgggcccatctcactgaagtggaatctcgactcgaacggctcgaacagctctttctgctcatctttcctagagaggatctcgacatgatcctgaaaatggatagcctccaggacatcaaagccctgctcactggactgtttgtccaggataacgtgaacaaggacgccgtgaccgataggctggcatccgtggaaaccgatatgccactcacactgagacagcaccggattagtgccacatcttcttccgaggagtcatccaataagggacagcgacagctcaccgtgtca

SEQ ID NO.7 protein activation domain VP16 sequence

tgcaccgcccctattaccgatgtgtctctgggcgacgaactccggctggatggcgaggaagtcgatatgacccctgccgacgctctcgacgatttcgacctggaaatgctgggagatgtcgaatctccttctcctggcatgacacacgatcccgtgtcttacggagcactggatgtgtaa

SEQ ID NO.8 termination signal Ser1-poly A sequence

tacaactaaacacgacttggagtattccttgtagtgtttaagattttaaatcttacttaatgacttcgaacgattttaacgataactttctctttgtttaactttaatcagcatacataaaaagccccggttttgtatcgggaagaaaaaaaatgtaattgtgttgcctagataataaacgtattatcaaagtgtgtggttttcctttaccaaagacccctttaagatgggcctaatgggcttaagtcgagtcctttccgatgtgttaaatacacatttattacactgatgcgtcgaatgtacacttttaataggatagctccactaaaaattattttatttatttaatttgttgcaccaaaactgatacattgacgaa

SEQ ID NO.9 3 XP 3-DsRed sequence

gcaaagtgaacacgtcgctaagcgaaagctaagcaaataaacaagcgcagctgaacaagctaaacaatcggggtaccgctagagtcgacggtaccgcgggcccgggatccaccggtcgccaccatggtgcgctcctccaagaacgtcatcaaggagttcatgcgcttcaaggtgcgcatggagggcaccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggccacaacaccgtgaagctgaaggtgaccaagggcggccccctgcccttcgcctgggacatcctgtccccccagttccagtacggctccaaggtgtacgtgaagcaccccgccgacatccccgactacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggctgcttcatctacaaggtgaagttcatcggcgtgaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggcgagatccacaaggccctgaagctgaaggacggcggccactacctggtggagttcaagtccatctacatggccaagaagcccgtgcagctgcccggctactactacgtggactccaagctggacatcacctcccacaacgaggactacaccatcgtggagcagtacgagcgcaccgagggccgccaccacctgttcctgtagtcataatcagccataccacatttgtag

SEQ ID NO.10 piggyBac Right arm sequence

ccctagaaagataatcatattgtgacgtacgttaaagataatcatgcgtaaaattgacgcatgtgttttatcggtctgtatatcgaggtttatttattaatttgaatagatattaagttttattatatttacacttacatactaataataaattcaacaaacaatttatttatgtttatttatttattaaaaaaaaacaaaaactcaaaatttcttctataaagtaacaaaacttttaaacattctctcttttacaaaaataaacttattttgtactttaaaaacagtcatgttgtattataaaataagtaattagcttaacttatacataatagaaacaaattatacttattagtcagtcagaaacaactttggcacatatcaatattatgctctcgacaaataacttttttgcattttttgcacgatgcatttgcctttcgccttattttagaggggcagtaagtacagtaagtacgttttttcattactggctcttcagtactgtcatctgatgtaccaggcacttcatttggcaaaatattagagatattatcgcgcaaatatctcttcaaagtaggagcttctaaacgcttacgcataaacgatgacgtcaggctcatgtaaaggtttctcataaattttttgcgactttggaccttttctcccttgctactgacattatggctgtatataataaaagaatttatgcaggcaatgtttatcattccgtacaataatgccataggccacctattcgtcttcctactgcaggtcatcacagaacacatttggtctagcgtgtccactccgcctttagtttgattataatacataaccatttgcggtttaccggtactttcgttgatagaagcatcctcatcacaagatgataataagtataccatcttagctggcttcggtttatatgagacgagagtaaggggtccgtcaaaacaaaacatcgatgttcccactggcctggagcgactgtttttcagtacttccggtatctcgcgtttgtttgatcgcacggttcccacaatggttt

SEQ ID NO.11 piggyBac left arm sequence

agatctgacaatgttcagtgcagagactcggctacgcctcgtggactttgaagttgaccaacaatgtttattcttacctctaatagtcctctgtggcaaggtcaagattctgttagaagccaatgaagaacctggttgttcaataacattttgttcgtctaatatttcactaccgcttgacgttggctgcacttcatgtacctcatctataaacgcttcttctgtatcgctctggacgtcatcttcacttacgtgatctgatatttcactgtcagaatcctcaccaacaagctcgtcatcgctttgcagaagagcagagaggatatgctcatcgtctaaagaactacccattttattatatattagtcacgatatctataacaagaaaatatatatataataagttatcacgtaagtagaacatgaaataacaatataattatcgtatgagttaaatcttaaaagtcacgtaaaagataatcatgcgtcattttgactcacgcggtcgttatagttcaaaatcagtgacacttaccgcattgacaagcacgcctcacgggagctccaagcggcgactgagatgtcctaaatgcacagcgacggattcgcgctatttagaaagagagagcaatatttcaagaatgcatgcgtcaattttacgcagactatctttctaggg

SEQ ID NO.12 10 XUAS sequence

cggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggaagcttgcatgcctgcaggtcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagactctagcgagcgccggagtataaatagaggcgcttcgtctacggagcgacaattcaattcaaacaagcaaagtgaacacgtcgctaagcgaaagctaagcaaataaacaagcgcagctgaacaagctaaacaatctgcagtaaagtgcaagttaaagtgaatcaattaaaagtaaccagcaaccaagtaaatcaactgcaactactgaaatctgccaagaagtaattattgaatacaagaagagaactctgaatagggaattgg

SEQ ID NO. 13U 6 promoter sequence

aggttatgtagtacacattgttgtaaatcactgaattgttttagatgattttaacaattagtacttattaatattaaataagtacataccttgagaatttaaaaatcgtcaactataagccatacgaatttaagcttggtacttggcttatagataaggacagaataagaattgttaacgtgtaagacaaggtcagatagtcatagtgattttgtcaaagtaataacagatggcgctgtacaaaccataactgttttcatttgtttttatggattttattacaaattctaaaggttttattgttattatttaatttcgttttaattatattatatatctttaatagaatatgttaagagtttttgctctttttgaataatctttgtaaagtcgagtgttgttgtaaatcacgctttcaatagtttagtttttttaggtatatatacaaaatatcgtgctctacaagt

SEQ ID NO.14 3 XP 3-ECFP sequence

gcaaagtgaacacgtcgctaagcgaaagctaagcaaataaacaagcgcagctgaacaagctaaacaatcggggtaccgctagagtcgacggtacgatccaccggtcgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaactctagatcataatcagccataccacatttgtag

The present invention is not limited to the above-mentioned embodiments, and any changes or substitutions that can be easily understood by those skilled in the art within the technical scope of the present invention are intended to be included in the scope of the present invention.

Sequence listing

<110> university of southwest

<120> a transgenic method for increasing silk fibroin content in silkworm cocoons and silkworm variety thereof

<141> 2022-03-04

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4155

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 1

atggacaaaa agtatagcat cggtctggat attggaacta actccgtcgg ctgggctgta 60

atcaccgacg aatacaaggt cccgtcaaaa aagttcaagg tattgggtaa cacagatcgt 120

cactctatca aaaagaatct cattggagct ctgttgttcg acagcggcga aacagctgag 180

gccactagac tgaagcgcac cgccagacgc cgttacacga ggagaaagaa cagaatctgc 240

tacttgcaag aaatattctc aaacgagatg gccaaagtgg acgattcgtt ctttcatagg 300

ttagaagaga gtttccttgt tgaagaggat aaaaagcacg aaagacatcc gatatttgga 360

aacatcgtgg acgaagttgc ttatcacgag aagtacccca cgatctatca tctgcgtaaa 420

aagttggtgg actcgacaga taaggccgac ctcaggttaa tataccttgc actggcgcac 480

atgatcaaat tcagaggcca ttttctgatt gaaggtgacc tgaaccctga caatagtgat 540

gtggacaaac tcttcattca attagttcag acctacaatc aactgtttga agagaaccct 600

atcaacgctt caggagttga cgctaaggcc atccttagtg cgagactgag caaatcccgc 660

cgtctcgaaa acttaatcgc acagttgcct ggagagaaaa agaacggttt gttcggaaat 720

ctcattgcgt tgtcactcgg actcacgcca aacttcaagt ctaacttcga tttggcagaa 780

gacgcgaaac tgcaactgag caaagacaca tatgacgatg acctcgataa cctcttagct 840

cagatcggcg atcaatacgc cgacttgttc ctcgctgcca aaaatctgtc ggacgctata 900

cttctgagtg atatcttgcg cgtcaacaca gaaattacta aggctcctct gtcggccagt 960

atgataaaac gctatgacga acaccatcag gatttgacat tgctcaaagc cctcgtgcgt 1020

caacagctcc cagaaaagta caaggagatt ttctttgatc agtccaagaa tggctacgca 1080

ggttatatag acggtggagc gtcgcaagaa gagttctaca agttcatcaa gccaatatta 1140

gaaaagatgg acggcacgga agagttactt gttaagctga atcgtgagga cctgttgcgt 1200

aaacagagga cattcgataa cggatcaatt ccgcaccaaa tacatcttgg cgaactgcac 1260

gctatcctca ggagacaaga ggacttctac ccctttttaa aggataaccg tgaaaagatc 1320

gagaaaatcc tgactttcag gattccttac tatgtcggcc cactggctcg tggtaatagc 1380

aggtttgcct ggatgaccag gaagtccgaa gagacaatta ctccgtggaa cttcgaagag 1440

gtggttgata aaggagcatc agcgcagtct ttcatagaac gcatgacaaa ttttgacaag 1500

aacttaccga atgagaaggt ccttcccaaa cactcactcc tctacgaata cttcacagta 1560

tacaacgagc tcactaaagt caagtacgta accgagggta tgcgcaaacc cgctttcctg 1620

tctggagagc agaaaaaggc catcgtggac cttctgttca agacaaaccg taaggtcact 1680

gtaaagcaac tcaaggaaga ctacttcaaa aagatagagt gtttcgattc agtggaaatc 1740

tctggcgttg aggacagatt taacgcttcc ttgggtactt accacgattt gctcaagatc 1800

attaaagata aggacttcct cgacaacgaa gagaacgaag atatcttaga ggacatagtt 1860

ctcaccctta cgctgtttga agatagagag atgattgaag agcgcctgaa gacttatgct 1920

catttgttcg atgacaaagt catgaagcaa ctgaaacgcc gtaggtacac cggctggggt 1980

agattatcgc gcaaacttat taatggtata agggacaagc agtcgggaaa aacgatattg 2040

gactttctca agagtgatgg tttcgccaac agaaatttta tgcaactcat acacgatgac 2100

agcttaacat tcaaggaaga tatccaaaaa gcacaggtgt cgggacaggg cgacagtttg 2160

cacgaacata ttgctaacct cgccggctcc ccggcgataa aaaagggtat ccttcagact 2220

gtgaaagtcg tagatgaact ggtgaaggtt atgggtcgtc ataaacccga gaacatagtt 2280

atcgaaatgg ctagggagaa tcaaacaact cagaagggac agaaaaactc aagagaacgc 2340

atgaagcgca ttgaagaggg tatcaaagag cttggcagtc aaatcctgaa ggaacaccct 2400

gtcgagaaca cgcaacttca gaacgaaaaa ttgtacctct actatctgca gaatggtaga 2460

gatatgtacg tagaccaaga attggatatt aaccgcctct cagattacga cgtggatcat 2520

atagttccgc agtcattctt gaaggatgac tctatcgaca acaaagtcct cacaagatca 2580

gacaagaacc gcggaaaatc agataatgta ccctctgaag aggtggttaa aaagatgaaa 2640

aactactgga gacagttact taacgctaag ttgatcacgc aaagaaagtt cgataacctc 2700

acaaaggctg aacgcggcgg tttaagcgag cttgacaagg ccggtttcat aaaacgtcag 2760

ttagtcgaaa ccaggcaaat tacgaaacac gtagcccaaa tattggattc ccgcatgaac 2820

actaaatacg atgaaaatga caagctcatc cgtgaggtca aagtaattac cctgaaaagc 2880

aagttggtgt ccgacttcag aaaggatttc cagttctaca aagttcgcga aatcaacaac 2940

taccaccatg cacatgacgc ttacctgaac gcagtcgtag gcactgcgtt aattaaaaag 3000

taccctaaac tggaatctga gttcgtgtac ggtgactata aagtgtacga tgttagaaag 3060

atgatcgcta aaagcgaaca ggagattgga aaggctaccg ccaagtattt cttttactcc 3120

aacatcatga atttctttaa gaccgaaatc acgttagcaa atggcgagat acgtaaaagg 3180

ccacttatcg aaacaaacgg agaaactggc gagatagtgt gggacaaggg tagagatttt 3240

gccactgtcc gcaaagtact gtcgatgccg caagtgaata tcgttaaaaa gaccgaagtt 3300

caaacgggag gcttcagcaa agagtccatc ctgcccaagc gtaacagtga taaattgata 3360

gctaggaaaa aggactggga ccctaaaaag tatggtggat tcgacagccc aactgtcgca 3420

tactccgtat tggtggttgc gaaagtcgaa aaaggaaaga gcaaaaagct caagtccgta 3480

aaagagctgt tgggcattac cataatggaa agatcatctt tcgagaagaa tcctatcgat 3540

tttctggaag ccaagggata taaagaggtc aaaaaggacc tcataatcaa gttaccaaaa 3600

tacagtctgt tcgaattgga gaacggcaga aaacgcatgc ttgcatcagc gggtgaactg 3660

caaaagggaa atgagttagc acttccttct aaatacgtca acttcctgta tttggcgtca 3720

cactacgaaa aactgaaggg ctctccagaa gataacgagc aaaagcagtt atttgtggaa 3780

cagcacaaac attaccttga cgaaattata gagcaaatct cggagttcag taagagagtg 3840

attttggctg acgccaatct tgataaagtt ctgtctgctt acaacaagca ccgtgataaa 3900

ccgattaggg aacaggccga gaacatcata catctcttca cactcactaa ccttggtgca 3960

cccgcagcgt tcaaatattt tgacaccacg atagatcgta agaggtacac cagcacgaaa 4020

gaagttttgg acgcgacact catccatcaa tcaatcacgg gcctgtacga gaccagaatc 4080

gacctgtccc agctcggtgg cgacaaaagg ccggcggcca cgaaaaaggc tggccaggca 4140

aaaaagaaaa agtaa 4155

<210> 2

<211> 636

<212> DNA

<213> silkworm (Bombyx mori)

<400> 2

atgccacact gggtaactgc tgaagaaggc actgacaccg aatctcctga ccaagttatg 60

ttatattacg aagatgacgc ttcagaatac tatgataata aacccgacgg cccagacaat 120

atagaagaac aaaatggaga tttttatgat agtggtagcg gaagtgatga gccagtgcag 180

cgcaggatgc gcccaagacg cgctgtagta ttagggtctt catcatcagc cggcagtacg 240

ggacctcctt caggacccgg tcgacggcgg aggtgtggca tttccgctcg tgaacgcaac 300

ctccgtcgtc tcgagagcaa tgaaagagaa agaatgcgaa tgcattccct caaccgagct 360

tttgaggatt tacgccgcgt aatcccacat gtgaaaaaag acaacagaag tctttcaaag 420

atagaaaccc ttaccttagc caaaaattac gtgaaagccc tcacgaatgc tatttgcaca 480

atgagaggtg aagttgctca ttattcattc aatagcgacg atgaaaacgt ggaacccgca 540

tttgtattga ataggaggga tcaggagccg aacaacaacg agactgtcag tacggaccag 600

caagaaatta cgacacggac gcaaggtttc ttctga 636

<210> 3

<211> 46

<212> DNA

<213> silkworm (Bombyx mori)

<400> 3

ggactcaaag cgaccgctac agggatcttg gacccttacc agcagg 46

<210> 4

<211> 46

<212> DNA

<213> silkworm (Bombyx mori)

<400> 4

tggcgatata cccgccctgg ttttggcagc caggcctaca agcgtt 46

<210> 5

<211> 1126

<212> DNA

<213> silkworm (Bombyx mori)

<400> 5

cctgcgtgat caggaaaaat gtggaaagct taacgatttt gtcacatttt acttatcaca 60

acttgttttt ataataattc gcttaaatga gcagctatta cttaatctcg tagtggtttt 120

tgacaaaatc agcttcttta gaactaaaat atcatttttt tcgtaatttt tttaatgaaa 180

aatgctctag tgttatacct ttccaaaatc accattaatt aggtagtgtt taagcttgtt 240

gtacaaaact gccacacgca tttttttctc cactgtaggt tgtagttacg cgaaaacaaa 300

atcgttctgt gaaaattcaa acaaaaatat tttttcgtaa aaacacttat caatgagtaa 360

agtaacaatt catgaataat ttcatgtaaa aaaaaaatac tagaaaagga atttttcatt 420

acgagatgct taaaaatctg tttcaaggta gagatttttc gatatttcgg aaaattttgt 480

aaaactgtaa atccgtaaaa ttttgctaaa catatattgt gttgttttgg taagtattga 540

cccaagctat cacctcctgc agtatgtcgt gctaattact ggacacattg tataacagtt 600

ccactgtatt gacaataata aaacctcttc attgacttga gaatgtctgg acagatttgg 660

ctttgtattt ttgatttaca aatgtttttt tggtgattta cccatccaag gcattctcca 720

ggatggttgt ggcatcacgc cgattggcaa acaaaaacta aaatgaaact aaaaagaaac 780

agtttccgct gtcccgttcc tctagtggga gaaagcatga agtaagttct ttaaatatta 840

caaaaaaatt gaacgatatt ataaaattct ttaaaatatt aaaagtaaga acaataagat 900

caattaaatc ataattaatc acattgttca tgatcacaat ttaatttact tcatacgttg 960

tattgttatg ttaaataaaa agattaattt ctatgtaatt gtatctgtac aatacaatgt 1020

gtagatgttt attctatcga aagtaaatac gtcaaaactc gaaaattttc agtataaaaa 1080

ggttcaactt tttcaaatca gcatcagttc ggttccaact ctcaag 1126

<210> 6

<211> 441

<212> DNA

<213> Yeast (Saccharomyces cerevisiae)

<400> 6

atgaaactgc tctcatcaat cgaacaggcc tgtgacattt gtagactcaa aaaactcaaa 60

tgctccaagg agaaacccaa atgtgccaaa tgcctgaaaa acaactggga gtgccggtac 120

tctcctaaaa ccaaacggag ccctctcaca cgggcccatc tcactgaagt ggaatctcga 180

ctcgaacggc tcgaacagct ctttctgctc atctttccta gagaggatct cgacatgatc 240

ctgaaaatgg atagcctcca ggacatcaaa gccctgctca ctggactgtt tgtccaggat 300

aacgtgaaca aggacgccgt gaccgatagg ctggcatccg tggaaaccga tatgccactc 360

acactgagac agcaccggat tagtgccaca tcttcttccg aggagtcatc caataaggga 420

cagcgacagc tcaccgtgtc a 441

<210> 7

<211> 180

<212> DNA

<213> human herpesvirus 2 strain (human herpesvirus 2)

<400> 7

tgcaccgccc ctattaccga tgtgtctctg ggcgacgaac tccggctgga tggcgaggaa 60

gtcgatatga cccctgccga cgctctcgac gatttcgacc tggaaatgct gggagatgtc 120

gaatctcctt ctcctggcat gacacacgat cccgtgtctt acggagcact ggatgtgtaa 180

<210> 8

<211> 379

<212> DNA

<213> silkworm (Bombyx mori)

<400> 8

tacaactaaa cacgacttgg agtattcctt gtagtgttta agattttaaa tcttacttaa 60

tgacttcgaa cgattttaac gataactttc tctttgttta actttaatca gcatacataa 120

aaagccccgg ttttgtatcg ggaagaaaaa aaatgtaatt gtgttgccta gataataaac 180

gtattatcaa agtgtgtggt tttcctttac caaagacccc tttaagatgg gcctaatggg 240

cttaagtcga gtcctttccg atgtgttaaa tacacattta ttacactgat gcgtcgaatg 300

tacactttta ataggatagc tccactaaaa attattttat ttatttaatt tgttgcacca 360

aaactgatac attgacgaa 379

<210> 9

<211> 831

<212> DNA

<213> Lentinus edodes coral (Discosoma sp)

<400> 9

gcaaagtgaa cacgtcgcta agcgaaagct aagcaaataa acaagcgcag ctgaacaagc 60

taaacaatcg gggtaccgct agagtcgacg gtaccgcggg cccgggatcc accggtcgcc 120

accatggtgc gctcctccaa gaacgtcatc aaggagttca tgcgcttcaa ggtgcgcatg 180

gagggcaccg tgaacggcca cgagttcgag atcgagggcg agggcgaggg ccgcccctac 240

gagggccaca acaccgtgaa gctgaaggtg accaagggcg gccccctgcc cttcgcctgg 300

gacatcctgt ccccccagtt ccagtacggc tccaaggtgt acgtgaagca ccccgccgac 360

atccccgact acaagaagct gtccttcccc gagggcttca agtgggagcg cgtgatgaac 420

ttcgaggacg gcggcgtggt gaccgtgacc caggactcct ccctgcagga cggctgcttc 480

atctacaagg tgaagttcat cggcgtgaac ttcccctccg acggccccgt aatgcagaag 540

aagaccatgg gctgggaggc ctccaccgag cgcctgtacc cccgcgacgg cgtgctgaag 600

ggcgagatcc acaaggccct gaagctgaag gacggcggcc actacctggt ggagttcaag 660

tccatctaca tggccaagaa gcccgtgcag ctgcccggct actactacgt ggactccaag 720

ctggacatca cctcccacaa cgaggactac accatcgtgg agcagtacga gcgcaccgag 780

ggccgccacc acctgttcct gtagtcataa tcagccatac cacatttgta g 831

<210> 10

<211> 1051

<212> DNA

<213> Trichoplusia ni (Trichoplusia ni)

<400> 10

ccctagaaag ataatcatat tgtgacgtac gttaaagata atcatgcgta aaattgacgc 60

atgtgtttta tcggtctgta tatcgaggtt tatttattaa tttgaataga tattaagttt 120

tattatattt acacttacat actaataata aattcaacaa acaatttatt tatgtttatt 180

tatttattaa aaaaaaacaa aaactcaaaa tttcttctat aaagtaacaa aacttttaaa 240

cattctctct tttacaaaaa taaacttatt ttgtacttta aaaacagtca tgttgtatta 300

taaaataagt aattagctta acttatacat aatagaaaca aattatactt attagtcagt 360

cagaaacaac tttggcacat atcaatatta tgctctcgac aaataacttt tttgcatttt 420

ttgcacgatg catttgcctt tcgccttatt ttagaggggc agtaagtaca gtaagtacgt 480

tttttcatta ctggctcttc agtactgtca tctgatgtac caggcacttc atttggcaaa 540

atattagaga tattatcgcg caaatatctc ttcaaagtag gagcttctaa acgcttacgc 600

ataaacgatg acgtcaggct catgtaaagg tttctcataa attttttgcg actttggacc 660

ttttctccct tgctactgac attatggctg tatataataa aagaatttat gcaggcaatg 720

tttatcattc cgtacaataa tgccataggc cacctattcg tcttcctact gcaggtcatc 780

acagaacaca tttggtctag cgtgtccact ccgcctttag tttgattata atacataacc 840

atttgcggtt taccggtact ttcgttgata gaagcatcct catcacaaga tgataataag 900

tataccatct tagctggctt cggtttatat gagacgagag taaggggtcc gtcaaaacaa 960

aacatcgatg ttcccactgg cctggagcga ctgtttttca gtacttccgg tatctcgcgt 1020

ttgtttgatc gcacggttcc cacaatggtt t 1051

<210> 11

<211> 679

<212> DNA

<213> Trichoplusia ni (Trichoplusia ni)

<400> 11

agatctgaca atgttcagtg cagagactcg gctacgcctc gtggactttg aagttgacca 60

acaatgttta ttcttacctc taatagtcct ctgtggcaag gtcaagattc tgttagaagc 120

caatgaagaa cctggttgtt caataacatt ttgttcgtct aatatttcac taccgcttga 180

cgttggctgc acttcatgta cctcatctat aaacgcttct tctgtatcgc tctggacgtc 240

atcttcactt acgtgatctg atatttcact gtcagaatcc tcaccaacaa gctcgtcatc 300

gctttgcaga agagcagaga ggatatgctc atcgtctaaa gaactaccca ttttattata 360

tattagtcac gatatctata acaagaaaat atatatataa taagttatca cgtaagtaga 420

acatgaaata acaatataat tatcgtatga gttaaatctt aaaagtcacg taaaagataa 480

tcatgcgtca ttttgactca cgcggtcgtt atagttcaaa atcagtgaca cttaccgcat 540

tgacaagcac gcctcacggg agctccaagc ggcgactgag atgtcctaaa tgcacagcga 600

cggattcgcg ctatttagaa agagagagca atatttcaag aatgcatgcg tcaattttac 660

gcagactatc tttctaggg 679

<210> 12

<211> 483

<212> DNA

<213> Yeast (Saccharomyces cerevisiae)

<400> 12

cggagtactg tcctccgagc ggagtactgt cctccgagcg gagtactgtc ctccgagcgg 60

agtactgtcc tccgagcgga gtactgtcct ccgagcggaa gcttgcatgc ctgcaggtcg 120

gagtactgtc ctccgagcgg agtactgtcc tccgagcgga gtactgtcct ccgagcggag 180

tactgtcctc cgagcggagt actgtcctcc gagcggagac tctagcgagc gccggagtat 240

aaatagaggc gcttcgtcta cggagcgaca attcaattca aacaagcaaa gtgaacacgt 300

cgctaagcga aagctaagca aataaacaag cgcagctgaa caagctaaac aatctgcagt 360

aaagtgcaag ttaaagtgaa tcaattaaaa gtaaccagca accaagtaaa tcaactgcaa 420

ctactgaaat ctgccaagaa gtaattattg aatacaagaa gagaactctg aatagggaat 480

tgg 483

<210> 13

<211> 467

<212> DNA

<213> silkworm (Bombyx mori)

<400> 13

aggttatgta gtacacattg ttgtaaatca ctgaattgtt ttagatgatt ttaacaatta 60

gtacttatta atattaaata agtacatacc ttgagaattt aaaaatcgtc aactataagc 120

catacgaatt taagcttggt acttggctta tagataagga cagaataaga attgttaacg 180

tgtaagacaa ggtcagatag tcatagtgat tttgtcaaag taataacaga tggcgctgta 240

caaaccataa ctgttttcat ttgtttttat ggattttatt acaaattcta aaggttttat 300

tgttattatt taatttcgtt ttaattatat tatatatctt taatagaata tgttaagagt 360

ttttgctctt tttgaataat ctttgtaaag tcgagtgttg ttgtaaatca cgctttcaat 420

agtttagttt ttttaggtat atatacaaaa tatcgtgctc tacaagt 467

<210> 14

<211> 867

<212> DNA

<213> Victoria jellyfish (Aequorea victoria)

<400> 14

gcaaagtgaa cacgtcgcta agcgaaagct aagcaaataa acaagcgcag ctgaacaagc 60

taaacaatcg gggtaccgct agagtcgacg gtacgatcca ccggtcgcca ccatggtgag 120

caagggcgag gagctgttca ccggggtggt gcccatcctg gtcgagctgg acggcgacgt 180

aaacggccac aagttcagcg tgtccggcga gggcgagggc gatgccacct acggcaagct 240

gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg ccctggccca ccctcgtgac 300

caccctgacc tggggcgtgc agtgcttcag ccgctacccc gaccacatga agcagcacga 360

cttcttcaag tccgccatgc ccgaaggcta cgtccaggag cgcaccatct tcttcaagga 420

cgacggcaac tacaagaccc gcgccgaggt gaagttcgag ggcgacaccc tggtgaaccg 480

catcgagctg aagggcatcg acttcaagga ggacggcaac atcctggggc acaagctgga 540

gtacaactac atcagccaca acgtctatat caccgccgac aagcagaaga acggcatcaa 600

ggccaacttc aagatccgcc acaacatcga ggacggcagc gtgcagctcg ccgaccacta 660

ccagcagaac acccccatcg gcgacggccc cgtgctgctg cccgacaacc actacctgag 720

cacccagtcc gccctgagca aagaccccaa cgagaagcgc gatcacatgg tcctgctgga 780

gttcgtgacc gccgccggga tcactctcgg catggacgag ctgtacaagt aaactctaga 840

tcataatcag ccataccaca tttgtag 867

Claims

1. A transgenic method for improving silk fibroin content in silkworm cocoons is characterized in that the method constructs a specific over-expression BmDimm and specific knockout BmYki and BmSd in silk glands at the rear parts of silkworms through a GAL4/UAS system, and obtains transgenic silkworms with enlarged rear silk glands; the silk fibroin content of the silkworms can be improved by specifically knocking out BmYki in the silk gland at the rear part of the silkworms, and the silk fibroin content of the silkworms can be improved by specifically knocking out BmSd in the silk gland at the rear part of the silkworms and the silk fibroin content of the silkworms can be improved by specifically over-expressing BmDimm in the silk gland at the rear part of the silkworms;

Wherein, the method for improving the silk fibroin content of the silkworms by specifically knocking out BmSd in the silk gland at the rear part of the silkworms comprises the following steps:

s1, constructing GAL4 expression vectors;

s2, constructing a UAS expression vector for knocking out BmSd;

s3, preparing transgenic silkworms with BmSd specifically knocked out in PSG;

2. The transgenic method for increasing silk fibroin content in silkworm cocoons according to claim 1, wherein the silk fibroin content of silkworm can be increased by specifically knocking out BmYki in the silk gland at the rear of silkworm, comprising the steps of:

s1, constructing GAL4 expression vectors;

s2, constructing a UAS expression vector for knocking out BmYki;

S3, preparing transgenic silkworms with BmYki specifically knocked out in PSG;

3. The transgenic method for increasing silk fibroin content in silkworm cocoons according to claim 1, wherein the silk fibroin content of silkworm can be increased by specifically overexpressing bmdim in silk gland at rear portion of silkworm, comprising the steps of:

s1, constructing GAL4 expression vectors;

s2, constructing a UAS expression vector for over-expressing BmDimm;

s3, preparing transgenic silkworms with specific over-expression BmDimm in PSG;

4. The transgenic method for increasing silk fibroin content in cocoons according to claim 2, wherein GAL4 expression vector construction: the GAL4 vector for the silkworm rear silk gland specific activation expression is constructed, namely the GAL4 expression vector taking the silk fibroin heavy chain fibH as a promoter and taking the gene sequence of the GAL4 protein binding domain as a target gene.

5. The transgenic method for increasing silk fibroin content in silkworm cocoons according to claim 2, wherein the UAS expression vector for knocking out BmYki is constructed by: sequentially connecting a plurality of sequences such as a 10 XUAS sequence, a Cas9 protein coding sequence optimized according to the preference of silkworm codons, a U6 promoter sequence, two BmYki knockout targets, ser1-polyA serving as a termination signal and the like in series to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector skeleton, namely pBac [3 XP 3-ECFP ] and naming the target gene expression frame as BmYki knockout.

6. The transgenic method for increasing silk fibroin content in cocoons according to claim 2, wherein the corresponding HG4 transgenic silkworms and UAS transgenic silkworms are obtained through embryo microinjection and fluorescence screening, and the transgenic silkworms with red fluorescence and green fluorescence in eyes are screened by hybridization of the two silkworms.

7. The transgenic method for increasing silk fibroin content in cocoons according to claim 1, wherein the UAS expression vector for knocking out BmSd is constructed by: sequentially connecting a plurality of sequences such as a 10 XUAS sequence, a Cas9 protein coding sequence optimized according to the preference of silkworm codons, a U6 promoter sequence, two BmSd knockout targets, ser1-polyA serving as a termination signal and the like in series to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector framework, namely pBac [3 XP 3-ECFP ] and naming the target gene expression frame as BmSd knockout.

8. The transgenic method for increasing silk fibroin content in cocoons according to claim 6, wherein the UAS expression vector for overexpressing BmDimm is constructed by: and sequentially connecting a plurality of sequences of 10 XUAS sequence, bmDimm as a target gene, ser1-polyA as a termination signal and the like in series to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector skeleton, namely pBac [3 XP 3-ECFP ] and naming the target gene expression frame as over-expression BmDimm.

9. Use of a transgenic method for increasing silk fibroin content in cocoons according to any one of claims 1-8 in the preparation of silkworm varieties, characterized in that specific over-expression of bmdim and specific knockout of BmYki and BmSd in the rear silk gland of silkworms are constructed by a GAL4/UAS system, transgenic silkworms with increased rear silk glands are obtained, and high-yield silk varieties with increased silk spitting amount of silkworms are produced.