CN114540364A

CN114540364A - Transgenic method for improving silk fibroin content in silkworm cocoon and silkworm variety thereof

Info

Publication number: CN114540364A
Application number: CN202210213529.6A
Authority: CN
Inventors: 徐汉福; 曾文慧; 欧瑶; 罗琴; 刘荣鹏; 马艳; 马静文; 唐艺芸; 胡杰; 陈玉琴; 向仲怀
Original assignee: Southwest University
Current assignee: Southwest University
Priority date: 2022-03-04
Filing date: 2022-03-04
Publication date: 2022-05-27
Anticipated expiration: 2042-03-04
Also published as: CN114540364B

Abstract

The invention provides a transgenic method for improving the content of silk fibroin in silkworm cocoons and a silkworm variety thereof, wherein the transgenic method for improving the content of silk fibroin in silkworm cocoons respectively constructs specific overexpression BmDimm and specific knockout of BmYki and BmSD in rear silk glands of the silkworms through a GAL4/UAS system, and obtains transgenic silkworms with enlarged rear silk glands; the silk fibroin content of the silkworms can be improved by specifically knocking out BmYki in the rear silk glands of the silkworms, or can be improved by specifically knocking out BmSD in the rear silk glands of the silkworms, or can be improved by specifically over-expressing BmDimm in the rear silk glands of the silkworms. According to the sequence codon preference of the silkworm silk gland expression endogenous gene in the silkworm genome sequence database, the gene sequence of the Cas9 protein is optimally designed, so that the Cas9 gene is more favorable for expression in the silkworm silk gland; tissue-specific knockout and over-expression are carried out on the silkworm silk gland by a GAL4/UAS system and a CRISPR/Cas9 gene editing technology.

Description

Transgenic method for improving silk fibroin content in silkworm cocoon and silkworm variety thereof

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to a transgenic method for improving the content of fibroin in silkworm cocoons and a silkworm variety thereof.

Background

Silkworm is an important economic insect and lepidoptera model insect. In the process of feeding and domesticating for more than five thousand years, the improvement of the silkworm silk yield is mainly realized by a traditional crossbreeding method, and the technical challenges of long breeding period, complex operation, more and more difficult acquisition of excellent characters and the like exist. With the completion of silkworm whole genome sequencing, it is marked that the research and knowledge of human beings on silkworms begins to enter the era of gene modification, and the genetic improvement of the economic traits of silkworms from the genome level by using a highly efficient and stable transgenic technology is a simple and rapid technical means.

CRISPR/Cas is an immune mechanism from invasion of bacterial immune virus DNA, with the CRISPR/Cas9 system being most widely used. The Cas9 protein can be combined with gRNA to form a complex, and then combined with a PAM sequence in a genome to form a hairpin structure, so that a target DNA double strand is cut, the DNA double strand is broken, and then the damage of the DNA can initiate a repair mechanism in a cell, and the repair mechanism mainly comprises two ways: firstly, repair is carried out through a non-homologous end connection way, and the repair mechanism can cause deletion or insertion of bases, so that frameshift mutation is caused, and gene knockout is finally realized; and secondly, under the condition of providing an exogenous repair template, repairing the DNA fracture position through homologous repair, and realizing the accurate editing of the target gene by utilizing the mechanism.

A large number of PAM sequences exist in the whole genome sequence of the silkworm, and theoretically, all genes of the silkworm can be knocked out and edited. However, no tissue-specific knockout has been achieved in silkworms at present.

Disclosure of Invention

Based on the technical problems in the prior art, the invention provides a transgenic method for improving the content of silk fibroin in silkworm cocoons and a silkworm variety thereof.

According to the first aspect of the technical scheme, the invention provides a transgenic method for improving the content of silk fibroin in silkworm cocoons, which comprises the steps of respectively constructing specific overexpression BmDimm and specific knockout of BmYki and BmSD in rear silk glands of silkworms through a GAL4/UAS system, and obtaining transgenic silkworms with enlarged rear silk glands; the silk fibroin content of the silkworms can be improved by specifically knocking out BmYki in the rear silk glands of the silkworms, or can be improved by specifically knocking out BmSD in the rear silk glands of the silkworms, or can be improved by specifically over-expressing BmDimm in the rear silk glands of the silkworms.

Specifically, through a modified GAL4/UAS high-efficiency binary expression system and a CRISPR/Cas9 (a gene sequence (SEQ ID NO.1) of Cas9 protein is optimized according to the preference of silkworm codons), BmDimm (SEQ ID NO.2) is specifically over-expressed in rear silk glands of silkworms, BmYki (SEQ ID NO.3) and BmSD (SEQ ID NO.4) genes are specifically knocked out, so that rear silk gland organs are enlarged, the synthetic amount of silk fibroin is increased, and silk spinning and cocooning can be performed normally.

The method for improving the silk fibroin content of the silkworms by specifically knocking out BmYki in the posterior silk glands of the silkworms comprises the following steps:

step S1, GAL4 expression vector construction;

s2, building a UAS expression vector for knocking out BmYki;

s3, manufacturing a transgenic silkworm with BmYki being specifically knocked out in PSG;

step S4, carrying out morphological observation on the 5L6D silk gland of the transgenic silkworm with BmYki being specifically knocked out in PSG, and taking a picture by using a camera;

step S5, performing morphological observation on cocoon shells of transgenic silkworms with BmYki being specifically knocked out in PSG, and taking pictures with a camera for evidence retention and verification;

s6, extracting DNA from the 5L6D silk gland of the transgenic silkworm with BmYki being specifically knocked out in PSG, carrying out PCR amplification on the successfully extracted DNA according to a primer designed on a knocking-out site, and carrying out nucleic acid electrophoresis on the amplification result.

Further, the method for improving the silk fibroin content of the silkworm by specifically knocking out BmSD in the posterior silk gland of the silkworm comprises the following steps:

step S1, GAL4 expression vector construction;

s2, building a UAS expression vector for knocking out BmSD;

s3, manufacturing a transgenic silkworm with BmSD knocked out specifically in PSG;

s4, carrying out morphological observation on the 5L6D silk gland of the transgenic silkworm with the specificity of knocking out BmSD in PSG, and taking a picture by using a camera for evidence keeping and verification;

step S5, morphologically observing cocoon shells of transgenic silkworms with BmSD knocked out specifically in PSG, and shooting pictures with a camera for evidence retention and verification;

s6, extracting DNA from the 5L6D silk gland of the transgenic silkworm with specificity knockout of BmSd in PSG, carrying out PCR amplification on the successfully extracted DNA according to a primer designed on a knockout site, and carrying out nucleic acid electrophoresis on the amplification result.

Preferably, the method for increasing silk fibroin content of silkworms by specifically overexpressing BmDimm in their posterior silk glands comprises the steps of:

step S1, GAL4 expression vector construction;

step S2, constructing a UAS expression vector for over-expressing BmDimm;

s3, preparing a transgenic silkworm specifically overexpressing BmDimm in PSG;

step S4, carrying out morphological observation on the 5L6D silk gland of the transgenic silkworm specifically over-expressing BmDimm in PSG, and taking a picture by using a camera for evidence keeping and verification;

step S5, performing morphological observation on cocoon shells of transgenic silkworms with BmDimm specifically overexpressed in PSG, and taking pictures with a camera for evidence retention and verification;

s6, extracting DNA from the 5L6D silk gland of the transgenic silkworm with specificity over-expression BmDimm in PSG, carrying out PCR amplification on the successfully extracted DNA according to BmDimm site design primers, carrying out nucleic acid electrophoresis on the amplification result, and carrying out genome identification.

Alternatively, GAL4 expression vectors were constructed: GAL4 vector for specific activation expression of silkworm posterior silk gland is constructed, namely GAL4 expression vector using fibroin heavy chain fibH as promoter and GAL4 protein binding domain gene sequence as target gene.

Wherein, the construction of the UAS expression vector for knocking out BmYki comprises the following steps: the method comprises the steps of sequentially connecting a plurality of sequences, namely a 10 XUAS sequence, a Cas9 protein sequence optimized according to the preference of silkworm codons, a U6 promoter sequence, two BmYki knockout targets, Ser1-polyA as a termination signal and the like in series to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector framework, namely pBac [3 XP 3-ECFP ] and naming the target gene expression frame as knockout BmYki.

Preferably, the corresponding HG4 transgenic bombyx mori and UAS transgenic bombyx mori are obtained through embryo microinjection and fluorescence screening, and the transgenic bombyx mori with red fluorescence and green fluorescence in eyes are screened through pairwise hybridization of the two transgenic bombyx mori.

Further, construction of the UAS expression vector for knocking out BmSD: the method comprises the steps of sequentially connecting a plurality of sequences, namely a 10 XUAS sequence, a Cas9 protein sequence optimized according to the preference of bombyx mori codons, a U6 promoter sequence, two BmSD knock-out targets, Ser1-polyA as a termination signal and the like in series to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector framework, namely pBac [3 XP 3-ECFP ] and naming the target gene expression frame as the knock-out BmSD.

Further, construction of UAS expression vector overexpressing BmDimm: and sequentially connecting a plurality of sequences such as a 10 XUAS sequence, a BmDimm target gene, a Ser1-polyA termination signal and the like in series to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector framework, namely pBac (3 XP 3-ECFP) and naming the expression as overexpression BmDimm.

According to the second aspect of the technical scheme of the invention, the silkworm variety obtained by using the transgenic method for improving the silk fibroin content in the silkworm cocoon is provided, and through a GAL4/UAS system, the specific overexpression BmDimm and the specific knockout of BmYki and BmSD in the rear silk gland of the silkworm are respectively constructed, so that the transgenic silkworm with the enlarged rear silk gland is obtained, and the high-yield silk variety with the increased silk output of the silkworm is further produced.

Compared with the prior art, the transgenic method for improving the silk fibroin content in the silkworm cocoon and the technical scheme of the silkworm variety thereof have the advantages that:

1. according to the sequence codon preference of the silkworm silk gland expression gene in the silkworm genome sequence database, the codon optimization design is carried out on the gene sequence (SEQ ID NO.1) of the Cas9 protein, so that the expression of the Cas9 gene in the silkworm silk gland is more efficient;

2. tissue-specific target gene knockout and target gene overexpression are carried out on the silkworm silk gland by a GAL4/UAS system and a CRISPR/Cas9 gene editing technology.

3. According to the invention, the silkworm gene BmDimm (SEQ ID NO.2) is specifically overexpressed in the rear silk gland of the silkworm, and the silkworm genes BmYki (SEQ ID NO.3) and BmSD (SEQ ID NO.4) are specifically knocked out, so that the rear silk gland of the silkworm can be enlarged, the synthesis of silk fibroin is increased, and the silk output is increased.

4. The silkworm variety with increased silk fibroin content created by the invention has good application prospect in the field of silkworm industry.

Drawings

FIG. 1 is a schematic diagram showing the results of GAL4/UAS transgenic silkworms according to the transgenic method for increasing the silk fibroin content in silkworm cocoons of the present invention;

FIG. 2 is a diagram showing the observation result of the silk gland of GAL4/UAS transgenic silkworms with BmDimm (SEQ ID NO.2) specifically overexpressed in the posterior silk gland;

FIG. 3 is a diagram showing the observation result of the silk gland of GAL4/UAS transgenic silkworms with BmYki (SEQ ID NO.3) being specifically knocked out by the posterior silk gland;

FIG. 4 is a diagram showing the observation of the silk gland of GAL4/UAS transgenic silkworms with rear silk gland-specific knockout of BmSD (SEQ ID NO. 4);

FIG. 5 is a diagram showing observation results of silkworm cocoons of GAL4/UAS transgenic silkworms whose posterior silk gland specifically knock out BmYki (SEQ ID NO. 3);

FIG. 6 is a diagram showing observation results of cocoons of GAL4/UAS transgenic silkworms having a rear silk gland-specific knockout of BmSD (SEQ ID NO. 4);

FIG. 7 is a diagram showing the result of genome identification of GAL4/UAS transgenic silkworms specifically overexpressing BmDimm (SEQ ID NO.2) in the posterior silk gland;

FIG. 8 is a graph showing the result of identifying the target point knockout efficiency of GAL4/UAS transgenic silkworms for post-silk gland-specific knockout of BmYki (SEQ ID NO. 3);

FIG. 9 is a diagram showing the result of genome identification of GAL4/UAS transgenic silkworms with a rear silk gland-specific knockout of BmSD (SEQ ID NO. 4).

Detailed Description

The technical solutions in the embodiments of the present invention will be described clearly and completely with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only some embodiments, not all embodiments, of the technical solutions. All other embodiments obtained by a person skilled in the art based on the embodiments of the present technical solution without creative efforts shall fall within the protection scope of the present invention. In addition, the scope of the present invention should not be limited to the particular structures or components or the specific parameters set forth below.

The invention provides a transgenic method for improving the silk fibroin content in silkworm cocoons and a silkworm variety thereof, wherein a GAL4/UAS system is adopted to respectively construct a specific overexpression BmDimm (SEQ ID NO.2), a specific knockout BmYki (SEQ ID NO.3) and a knockout BmSd (SEQ ID NO.4) in the rear silk gland of the silkworm, so that the transgenic silkworm with the enlarged rear silk gland is obtained, the high-yield silk variety with the increased silk output of the silkworm is further caused, a new method and means are provided for silkworm genetic resources, and the existing silkworm variety is enriched.

The transgenic method for improving the silk fibroin content in the silkworm cocoons utilizes a GAL4/UAS binary expression system, wherein the GAL4/UAS binary expression system is a set of GAL4 (transcription activating factor) driven by a specific promoter to express, and can specifically recognize and combine with a UAS sequence (upstream activating sequence) so as to activate the transcription of a downstream target gene. The GAL4/UAS binary expression system can activate and express target gene in great amount and avoid gene lethal effect. The silk gland utilized by the invention is the only silk-producing organ of the silkworm. Silk is mainly composed of silk fibroin secreted by posterior silk glands and sericin secreted by middle silk glands. The silk fibroin is specifically synthesized and secreted by posterior silk glands, and determines the yield and quality of the silk.

The invention discloses a transgenic method for improving silk fibroin content in silkworm cocoons, and correspondingly provides a method for improving silk fibroin content of silkworms by specifically knocking BmYki (SEQ ID NO.3) out of silk glands at the rear parts of the silkworms. Also provides a method for improving the silk fibroin content of the silkworm by specifically knocking out BmSD (SEQ ID NO.4) in the posterior silk gland of the silkworm, and further provides a method for improving the silk fibroin content of the silkworm by specifically over-expressing BmDimm (SEQ ID NO.2) in the posterior silk gland of the silkworm. The invention develops a tissue-specific gene editing technology, particularly establishes a specific gene editing technology aiming at silk glands of silk production organs of silkworms, is beneficial to realizing the accurate reconstruction of silk characters of the silkworms and creates a new variety of silkworms with greatly improved silk yield or quality.

The invention provides a method for specifically knocking out BmYki (SEQ ID NO.3) in posterior silk glands of silkworms to improve the silk fibroin content of the silkworms, which comprises the following steps:

step S1, GAL4 expression vector construction: GAL4 vector for specific activation expression of posterior silk gland of silkworm is constructed, that is, silk fibroin heavy chain fibH is used as promoter (SEQ ID NO.5), GAL4 protein binding domain gene sequence GAL4BD (SEQ ID NO.6) is used as target gene, VP16 is used as enhancer (SEQ ID NO. 7); ser1-polyA as a termination signal (SEQ ID NO.8) which was subsequently inserted into the piggyBac vector backbone, pBac [3 XP 3-DsRed ], by the following steps: firstly, assembling a 3 XP 3-DsRed sequence (SEQ ID NO.9), wherein the sequence consists of a 3-fold repeated P3 promoter (eye and nerve specific promoter) driven and expressed red fluorescent protein (DsRed) sequence; the right (SEQ ID NO.10) and left (SEQ ID NO.11) piggyBac arms were then assembled at the 5 'and 3' ends, respectively, of the 3 XP 3-DsRed sequence. And is designated HG 4.

Step S2, construction of UAS expression vector for knocking BmYki (SEQ ID NO. 3): sequentially connecting a plurality of sequences such as a 10 XUAS sequence (SEQ ID NO.12), a Cas9 protein sequence (SEQ ID NO.1), a U6 promoter sequence (SEQ ID NO.13), two BmYki knockout targets (SEQ ID NO.3), a Ser1-polyA (SEQ ID NO.8) as termination signals and the like which are optimized according to the preference of silkworm codons in series to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector framework (pBac [3 XP 3-ECFP ]), wherein the framework vector is prepared by the following steps: firstly, assembling a 3 XP 3-ECFP sequence (SEQ ID NO.14), wherein the sequence consists of an ECFP (cyan fluorescent protein) sequence driven by a 3-fold repeated P3 promoter (eye and nerve specific promoter) to express; the piggyBac right arm (SEQ ID NO.10) and the piggyBac left arm (SEQ ID NO.11) were then assembled at the 5 'end and 3' end, respectively, of the 3 XP 3-ECFP sequence (SEQ ID NO.14) and designated as knockout BmYki (SEQ ID NO. 3).

Step S3, preparation of transgenic silkworm specifically knocking out BmYki (SEQ ID NO.3) in PSG (posterior silk gland): obtaining corresponding HG4 transgenic silkworms and UAS transgenic silkworms by embryo microinjection and fluorescence screening, and screening transgenic silkworms with eyes emitting red fluorescence and blue green fluorescence by hybridizing the two silkworms in pairs

Step S4, morphological observation was performed by five-year-old six-day (5L6D) silk glands of transgenic silkworms specifically knocking out BmYki (SEQ ID NO.3) in PSG (posterior silk glands), and photographs were taken with a camera.

Step S5, morphological observation is carried out on cocoon shells of transgenic silkworms specifically knocking out BmYki (SEQ ID NO.3) in PSG (posterior silk gland), and photographs are taken by a camera.

S6, extracting DNA of the silk gland of the fifth-instar sixth day (5L6D) of a transgenic silkworm with BmYki (SEQ ID NO.3) specifically knocked out from PSG (posterior silk gland), carrying out PCR amplification on the successfully extracted DNA according to a primer designed by a knocking-out site, carrying out nucleic acid electrophoresis on an amplification result, recovering a fragment, linking T-loading, sending to a company for sequencing, and identifying knocking-out efficiency.

The invention provides a method for specifically knocking out BmSD (SEQ ID NO.4) in a silk gland at the rear part of a silkworm to improve the silk fibroin content of the silkworm, which comprises the following steps:

step S1, GAL4 expression vector construction: GAL4 vector for specific activation expression of posterior silk gland of silkworm is constructed, that is, silk fibroin heavy chain fibH is used as promoter (SEM ID NO.5), GAL4 protein binding domain gene sequence GAL4BD (SEQ ID NO.6) is used as target gene, and VP16 is used as enhancer (SEQ ID NO. 7); ser1-polyA as a termination signal (SEQ ID NO.8) which was subsequently inserted into the piggyBac vector backbone, pBac [3 XP 3-DsRed ], by the following steps: firstly, assembling a 3 XP 3-DsRed sequence (SEQ ID NO.9), wherein the sequence consists of a 3-fold repeated P3 promoter (eye and nerve specific promoter) driven and expressed red fluorescent protein (DsRed) sequence; subsequently, a piggyBac right arm (SEQ ID NO.10) and a piggyBac left arm (SEQ ID NO.11) were assembled at the 5 'end and the 3' end, respectively, of the 3 XP 3-DsRed sequence (SEQ ID NO. 9). And is designated HG 4.

Step S2, construction of UAS expression vector for knocking out BmSD (SEQ ID NO. 4): sequentially connecting a plurality of sequences such as a 10 XUAS sequence (SEQ ID NO.12), a Cas9 protein sequence (SEQ ID NO.1), a U6 promoter sequence (SEQ ID NO.13), two BmSD knockout targets (SEQ ID NO.4), a Ser1-polyA (SEM ID NO.8) as termination signals and the like which are optimized according to the codon preference of silkworm in series to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector framework (pBac [3 XP 3-ECFP ]), wherein the framework vector is prepared by the following steps: firstly, assembling a 3 XP 3-ECFP sequence (SEQ ID NO.14), wherein the sequence consists of an ECFP (cyan fluorescent protein) sequence driven by a 3-fold repeated P3 promoter (eye and nerve specific promoter) to express; the piggyBac right arm (SEQ ID NO.10) and piggyBac left arm (SEQ ID NO.11) were then assembled at the 5 'end and 3' end, respectively, of the 3 XP 3-ECFP sequence (SEQ ID NO.14) and designated as knockout BmSD (SEQ ID NO. 4).

Step S3, production of transgenic silkworms with specific knockout of BmSD (SEQ ID NO.4) in PSG (posterior silk gland): obtaining corresponding HG4 transgenic silkworms and UAS transgenic silkworms by embryo microinjection and fluorescence screening, and screening the transgenic silkworms with eyes simultaneously emitting red fluorescence and cyan fluorescence by hybridizing the two transgenic silkworms with the UAS transgenic silkworms in pairs

Step S4, morphological observation is carried out by five-year-old (5L6D) silk glands of transgenic silkworms of PSG (posterior silk gland) of which BmSD (SEQ ID NO.4) is specifically knocked out, and photographs are taken by a camera.

Step S5, by morphological observation of cocoon shells of transgenic silkworms specifically knock out BmSD (SEQ ID NO.4) in PSG (posterior silk gland), photographs were taken with a camera.

S6, extracting DNA of the silk gland of the fifth-instar sixth-day (5L6D) of a transgenic silkworm with specificity knockout of BmSD (SEQ ID NO.4) in PSG (posterior silk gland), carrying out PCR amplification on the successfully extracted DNA according to a primer designed by a knockout site, carrying out nucleic acid electrophoresis on an amplification result, recovering a fragment, linking T-loading, sending to a company for sequencing, and identifying knockout efficiency.

The invention provides a method for improving the silk fibroin content of silkworms by specifically overexpressing BmDimm (SEQ ID NO.2) in the posterior silk glands of the silkworms, which comprises the following steps:

step S1, GAL4 expression vector construction: GAL4 vector for specific activation expression of posterior silk gland of silkworm is constructed, that is, silk fibroin heavy chain fibH is used as promoter (SEM ID NO.5), GAL4 protein binding domain gene sequence GAL4BD is used as target gene, and VP16 is used as enhancer (SEQ ID NO. 7); ser1-poly A as a termination signal (SEQ ID NO.8) which was subsequently inserted into the piggyBac vector backbone, pBac [3 XP 3-DsRed ], by the following steps: firstly, assembling a 3 XP 3-DsRed sequence (SEQ ID NO.9), wherein the sequence consists of a 3-fold repeated P3 promoter (eye and nerve specific promoter) driven and expressed red fluorescent protein (DsRed) sequence; subsequently, a piggyBac right arm (SEQ ID NO.10) and a piggyBac left arm (SEQ ID NO.11) were assembled at the 5 'end and the 3' end, respectively, of the 3 XP 3-DsRed sequence (SEQ ID NO. 9). And is designated HG 4.

Step S2, construction of UAS expression vector for over-expressing BmDimm (SEQ ID NO. 2): sequentially connecting a plurality of sequences such as a 10 XUAS sequence (SEQ ID NO.12), a BmDimm (SEQ ID NO.2) as a target gene and a Ser1-polyA (SEQ ID NO.8) as a termination signal in series to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector skeleton, namely pBac [3 XP 3-ECFP ], wherein the skeleton vector is prepared by the following steps: firstly, assembling a 3 XP 3-ECFP sequence (SEQ ID NO.14), wherein the sequence consists of an ECFP (cyan fluorescent protein) sequence driven by a 3-fold repeated P3 promoter (eye and nerve specific promoter) to express; then the right arm (SEQ ID NO.10) and the left arm (SEQ ID NO.11) of piggyBac were assembled at the 5 'end and 3' end of the 3 XP 3-ECFP sequence (SEQ ID NO.14), respectively, and named as over-expressed BmDimm (SEQ ID NO. 2).

Step S3, preparation of transgenic silkworms specifically overexpressing BmDimm (SEQ ID NO.2) in PSG (posterior silk gland): obtaining corresponding HG4 transgenic silkworms and UAS transgenic silkworms by embryo microinjection and fluorescence screening, and screening transgenic silkworms with red fluorescence and blue green fluorescence on eyes by pairwise hybridizing the two transgenic silkworms

Step S4, morphological observation is carried out by five-year-old six-day (5L6D) silk glands of transgenic silkworms specifically overexpressing BmDimm (SEQ ID NO.2) in PSG (posterior silk glands), and photographs are taken with a camera.

Step S5, by morphological observation of cocoon shells of transgenic silkworms specifically overexpressing BmDimm (SEQ ID NO.2) in PSG (posterior silk gland), and taking photographs with a camera.

S6, extracting DNA from the silk gland of the sixth day of five years old (5L6D) of a transgenic silkworm with specificity overexpression BmDimm (SEQ ID NO.2) in PSG (posterior silk gland), carrying out PCR amplification on the successfully extracted DNA according to BmDimm (SEQ ID NO.2) site design primers, carrying out nucleic acid electrophoresis on the amplification result, and carrying out genome identification.

Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The experimental procedures, in which specific conditions are not specified in the examples, are generally carried out under conventional conditions or conditions recommended by the manufacturers.

Example 1, which is mainly the construction of a bombyx mori posterior silk gland-specific GAL4/UAS expression vector, combining the three methods described above, comprising the steps of:

step S1 GAL4 expression vector construction, namely the construction of rear silk gland specific GAL4 expression vector, wherein the bombyx mori fibH gene promoter (SEQ ID NO.5) sequence is connected with GAL4BD (SEQ ID NO.6) gene sequence, enhancer VP16 sequence (SEQ ID NO.7) and termination signal Ser1-poly A (SEQ ID NO.8) in series to form the target gene expression frame, the skeleton vector pBac [3 XP 3-DsRed ] and the target gene expression frame are cut by AscI, the skeleton vector is completed by the following steps: firstly, assembling a 3 XP 3-DsRed sequence (SEQ ID NO.9) which consists of a 3-fold repeated P3 promoter (eye and nerve specific promoter) driven and expressed red fluorescent protein (DsRed) sequence; then the right arm (SEQ ID NO.10) and the left arm (SEQ ID NO.11) of piggyBac are assembled at the 5 'end and the 3' end of the 3 XP 3-DsRed (SEQ ID NO.9) sequence respectively. The expression vector of the bombyx mori posterior silk gland-specific GAL4 is successfully constructed by linking through T4 ligase and is named HG 4.

Step S2-1 construction of UAS expression vector for knocking BmYki (SEQ ID NO.3)

The overexpression gene expression frames connected in series by the UAS are as follows in sequence: the 10 × UAS sequence (SEQ ID NO.12) is connected with Cas9 gene sequence (SEQ ID NO.1) which is subjected to silkworm codon optimization, then the screening marker gene 3 × P3-ECFP (SEQ ID NO.14), the U6 promoter (SEQ ID NO.13), 2 BmYki knockout targets (SEQ ID NO.3), and a termination signal Ser1-polyA (SEQ ID NO.8) are connected in series, and then a framework vector pBac [3 × P3-ECFP ] and a target gene expression frame are cut by using FseI and BgIII, wherein the framework vector is completed by the following steps: firstly, assembling a 3 XP 3-ECFP sequence (SEQ ID NO.14), wherein the sequence consists of an ECFP (cyan fluorescent protein) sequence driven by a 3-fold repeated P3 promoter (eye and nerve specific promoter) to express; then a piggyBac right arm (SEQ ID NO.10) and a piggyBac left arm (SEQ ID NO.11) are assembled at the 5 'end and the 3' end of the 3 XP 3-ECFP sequence (SEQ ID NO.14) respectively, and are linked into a piggyBac expression vector through T4 ligase. The vector contains a cyan fluorescent protein (ECFP) gene which is started by 3 XP 3 as a promoter, namely 3 XP 3-ECFP (SEQ ID NO.14), and cyan fluorescent protein which is specifically expressed in silkworm eyes and nerves is used as a screening marker of positive transgenic silkworms.

Step S2-2 knockout of the UAS expression vector construction of BmSd (SEQ ID NO.4)

The overexpression gene expression frames connected in series by the UAS are as follows in sequence: the 10 × UAS sequence (SEQ ID NO.12) is connected in series with a Cas9 gene sequence (SEQ ID NO.1) subjected to silkworm codon optimization, then the screening marker gene 3 × P3-ECFP (SEQ ID NO.14), a U6 promoter (SEQ ID NO.13), 2 BmSD knockout targets (SEQ ID NO.4) and a termination signal Ser1-polyA (SEQ ID NO.8) are connected in series in sequence, and then a skeleton vector pBac [3 × P3-ECFP ] and a target gene expression frame are cut by using FseI and BgIII, wherein the skeleton vector is completed by the following steps: firstly, assembling a 3 XP 3-ECFP sequence (SEQ ID NO.14), wherein the sequence consists of an ECFP (cyan fluorescent protein) sequence driven by a 3-fold repeated P3 promoter (eye and nerve specific promoter) to express; and then a piggyBac right arm (SEQ ID NO.10) and a piggyBac left arm (SEQ ID NO.11) are assembled at the 5 'end and the 3' end of the 3 XP 3-ECFP sequence (SEQ ID NO.14) respectively and are linked into a piggyBac expression vector through T4 ligase. The vector contains a cyan fluorescent protein (ECFP) gene which is started by 3 XP 3 as a promoter, namely 3 XP 3-ECFP (SEQ ID NO.14), and cyan fluorescent protein which is specifically expressed in silkworm eyes and nerves is used as a screening marker of positive transgenic silkworms.

Step S2-3 construction of UAS expression vector for overexpression of BmDimm (SEQ ID NO.2)

The overexpression gene expression frames connected in series by the UAS are as follows in sequence: 10 XUAS sequence (SEQ ID NO.12), BmDimm (SEQ ID NO.2) are respectively target genes, a termination signal Ser1-polyA (SEQ ID NO.8), and a backbone vector pBac [3 XP 3-ECFP ] and a target gene expression cassette are cut by using FseI and BgIII, and the backbone vector is completed by the following steps: firstly, assembling a 3 XP 3-ECFP sequence (SEQ ID NO.14), wherein the sequence consists of an ECFP (cyan fluorescent protein) sequence driven by a 3-fold repeated P3 promoter (eye and nerve specific promoter) to express; then a piggyBac right arm (SEQ ID NO.10) and a piggyBac left arm (SEQ ID NO.11) are assembled at the 5 'end and the 3' end of the 3 XP 3-ECFP sequence (SEQ ID NO.14) respectively, and are linked through a T4 ligase, and finally, a UAS overexpression BmDimm (SEQ ID NO.2) transgenic expression vector is formed. The vector contains a cyan fluorescent protein (ECFP) gene with a promoter of 3 XP 3 start, namely 3 XP 3-ECFP (SEQ ID NO.14), and cyan fluorescent protein specifically expressed in silkworm eyes and nerves is used as a screening marker of positive transgenic silkworms.

Example 2, which is mainly the production of GAL4/UAS transgenic silkworms, which combines the three methods described above, including the following steps:

step S3 transgene injection and fluorescence screening

After the GAL4/UAS transgenic expression vector is obtained, the GAL4/UAS transgenic expression vector is respectively mixed with an auxiliary plasmid (A4Helper) in equal proportion at the concentration of 450 ng/microliter, injected by an Eppendorf microinjector, a diversification silkworm Nistar (a material capable of raising multiple batches of silkworm eggs in one year) is used as an injection receptor, the silkworm moth needs to be mated for 6 hours before injection, laid for spawning at room temperature after being placed for one day at 4 ℃, an embryo which just spawns for one hour is taken out and stuck on a glass sheet by paste, injected by the Eppendorf microinjector, sealed by nontoxic glue, sterilized by 35% formaldehyde steam for 5 minutes, placed in an environment with the relative humidity of 85% at 25 ℃, hatched, a hatched G0 generation (the first generation after injection) silkworm is selfed by mulberry leaves to the silkworm moth, the obtained G0 generation (the first generation after injection) silkworm moth is bred, and the G1 generation (the second generation of silkworm egg after injection) is obtained by means of silkworm moth cross-crossing or back, screening by using an Olympus fluorescence microscope to obtain blue fluorescence UAS knockout transgenic silkworms, namely knockout BmYki (SEQ ID NO.3) and knockout BmSD (SEQ ID NO. 4); UAS over-expresses transgenic silkworm BmDimm (SEQ ID NO.2) and red fluorescent GAL4 transgenic positive silkworm HG4, and normally preserves the seed after feeding one generation.

Step S3-1 preparation of transgenic silkworm overexpressing BmDimm (SEQ ID NO.2)

The screened eyes and nerve red fluorescence GAL4 transgenic silkworms HG4 are fed to moth formation, then are crossed with the screened eyes and nerve cyan fluorescence UAS overexpression transgenic silkworms BmDimm (SEQ ID NO.2) in pairs, are placed in an environment with the temperature of 25 ℃ and the relative humidity of 85 percent for hatching, hatched offspring are fed to four ages, and GAL4/UAS transgenic silkworms which are specifically expressed in the eyes of the transgenic silkworms and emit both green fluorescence and red fluorescence are obtained through screening, as shown in the attached figure 1, the transgenic silkworms which over express BmDimm (SEQ ID NO.2) are successfully manufactured, and are normally fed to a material taking stage.

Step S3-2 preparation of BmYki (SEQ ID NO.3) specific knockout transgenic silkworm

The screened eyes and nerve red fluorescence GAL4 transgenic silkworms HG4 are fed to moth formation, then the moth formation is performed with screened eyes and nerve blue fluorescence UAS knockout transgenic silkworms named as knockout BmYki (SEQ ID NO.3), pairwise hybridization is performed, the screened eyes and nerve blue fluorescence UAS knockout transgenic silkworms are placed in an environment with the temperature of 25 ℃ and the relative humidity of 85%, hatching offspring is fed to four ages, GAL4/UAS transgenic silkworms which are specifically expressed in the eyes of the transgenic silkworms and emit green fluorescence and red fluorescence are obtained through screening, as shown in the attached figure 1, the fact that the transgenic silkworms which specifically knockout BmYki (SEQ ID NO.3) are successfully manufactured is proved, and then the silkworms are normally fed to a material taking stage.

Step S3-3 production of BmSD (SEQ ID NO.4) transgenic silkworm with specific knockout

The screened eyes and nerve red fluorescence GAL4 transgenic silkworms HG4 are fed to the moth, then the moth and the screened eyes and nerve red fluorescence UAS knockout transgenic silkworms are named as knockout BmSd (SEQ ID NO.4), pairwise hybridization is carried out, the silkworm is placed in an environment with the temperature of 25 ℃ and the relative humidity of 85 percent for hatching, hatched offspring are fed to the fourth age, GAL4/UAS transgenic silkworms which specifically express in the eyes of the transgenic silkworms and emit both green fluorescence and red fluorescence are obtained through screening, as shown in the attached figure 1, the success of making the transgenic silkworms which specifically knockout BmSd (SEQ ID NO.4) is proved, and then the silkworms are normally fed to the material taking stage.

Example 3, which is a GAL4/UAS transgenic silkworm silk gland phenotype observation of posterior silk gland-specific overexpression of BmDimm (SEQ ID No.2), further comprising the steps of:

step S4-1, feeding the GAL4/UAS transgenic silkworms which are specifically expressed in the GAL4/UAS transgenic silkworms of wild-type silkworms Nistar and PSG (posterior silk gland) over-expressing BmDimm (SEQ ID NO.2) and emit blue-green fluorescence and red-color fluorescence to five-year old, dissecting and observing the silk glands of the wild-type silkworms Nistar and the GAL4/UAS transgenic silkworms of the wild-type silkworms Nistar and the BmDimm (SEQ ID NO.2) over-expressing GAL4/UAS transgenic silkworms of the fifth-year old (5L6D) in a buffer solution of 1 XPBS (phosphate buffer solution), and photographing, as a result, the posterior silk glands of the over-expressed BmDimm (SEQ ID NO.2) are enlarged compared with the posterior silk glands of the wild-type silkworms shown in the attached figure 2.

Example 4, silk gland phenotype observation of GAL4/UAS transgenic silkworms that are primarily posterior silk gland-specific knock-outs BmYki (SEQ ID No.3), further comprising the steps of:

step S4-2, feeding GAL4/UAS transgenic silkworms to five instars, which are specifically expressed in GAL4/UAS transgenic silkworms of the wild-type silkworm nisi and PSG (posterior silk gland) specifically knocking out BmYki (SEQ ID No.3), and fluoresce blue-green and red, dissect and observe the posterior silk glands of the wild-type silkworm nisi and GAL4/UAS transgenic silkworms of the specific knocking out BmYki (SEQ ID No.3) on the sixth day (5L6D) of the five instars in a buffer of 1 × PBS, and photograph, as a result, as shown in fig. 3, the posterior silk glands of the knock-out BmYki (SEQ ID No.3) transgenic silkworms become larger compared with the posterior silk glands of the wild-type silkworms.

Example 5, silk gland phenotype observations of GAL4/UAS transgenic silkworms for the posterior silk gland-specific knockout of BmSd (SEQ ID No.4), further comprising the steps of:

step S4-3, feeding the GAL4/UAS transgenic silkworms specifically expressing GAL4/UAS transgenic silkworms with green fluorescence and red fluorescence, which are specifically knocked out by the wild-type silkworms Nistar and PSG (rear silk glands), to five years, dissecting and observing the rear silk glands of the wild-type silkworms Nistar and GAL4/UAS transgenic silkworms five years (5L6D) with the BmSd (SEQ ID NO.4) specifically knocked out in a buffer solution of 1 XPBS, and photographing, wherein as a result, the rear silk glands of the BmSd (SEQ ID NO.4) transgenic silkworms are knocked out to be shorter than the rear silk glands of the wild-type silkworms as shown in the attached figure 4.

Example 6, GAL4/UAS transgenic silkworm cocoon phenotype observations of a posterior silk gland-specific knockout BmYki (SEQ ID No.3), further comprising the steps of:

step S5-1, feeding GAL4/UAS transgenic silkworms specifically expressed in the GAL4/UAS transgenic silkworms specifically knocking out BmYki (SEQ ID NO.3) of wild type silkworms Nistar and PSG (posterior silk gland) to mount, wherein the feeding environment is as follows: feeding in an environment with the temperature of 25 ℃ and the relative humidity of 65 percent, and mounting in an environment: good ventilation was achieved at 25 ℃ and the cocoons were picked and photographed, and as a result, the knockout BmYki (SEQ ID NO.3) transgenic silkworm cocoon shells became larger as compared to wild type silkworm cocoon shells as shown in FIG. 5.

Example 7, GAL4/UAS transgenic silkworm cocoon phenotypic observations of a posterior silk gland-specific knockout of BmSD (SEQ ID No.4), further comprising the steps of:

step S5-2, feeding GAL4/UAS transgenic silkworms specifically expressed in the GAL4/UAS transgenic silkworms specifically expressing blue-green fluorescence and red fluorescence in wild silkworms Nistar and PSG (posterior silk gland) for specifically knocking out BmSD (SEQ ID NO.4) to mount, wherein the feeding environment is as follows: feeding in an environment with the temperature of 25 ℃ and the relative humidity of 65 percent, and mounting in an environment: good ventilation was achieved at 25 ℃ and the cocoons were subsequently picked and photographed, resulting in a decreased knockout BmSD (SEQ ID NO.4) transgenic silkworm cocoon shell as compared to wild type silkworm cocoon shell as shown in FIG. 6.

Example 8, molecular identification of GAL4/UAS transgenic bombyx mori with posterior silk gland-specific overexpression of bmdim (SEQ ID No.2), further comprising the steps of:

step S6-1, dissecting the posterior silk gland of the wild silkworm Nistar and the Shangshan PSG (posterior silk gland) specifically overexpressing BmDimm (SEQ ID NO.2) and collecting the posterior silk gland of the five-year-old transgenic silkworms on the sixth day (5L6D) through a 1.5mL centrifuge tube.

Step S6-2, extracting the genome of the collected posterior silk gland, wherein the extraction steps are as follows:

(1) cleaning the mortar and the grinding rod, and placing the cleaned mortar and the grinding rod in an oven for high-temperature sterilization at 180 ℃ for 2-3 hours. Before the grinding operation, liquid nitrogen precooling treatment needs to be carried out on the silk gland, the mortar and the grinding rod. After precooling, the silk gland is ground into powder and then transferred to a centrifuge tube with 1.5mL (milliliter) and stored in liquid nitrogen or at the temperature of minus 80 ℃ for later use.

(2) 1mL of DNA extraction Buffer was added to the centrifuge tube and vortexed at 3000rpm (revolutions per minute). Adding RNA enzyme according to the working concentration of 100 mu L/mL, placing the mixture in a constant-temperature water bath kettle at 37 ℃ for digestion for 1 hour, adding proteinase K, and digesting the mixture in a water bath at 55 ℃ overnight.

(3) Equal volume of Tris saturated phenol was added to the centrifuge tube and vortexed thoroughly for 10min, followed by centrifugation at 13400rpm for 10min at 4 ℃ and 600. mu.L of supernatant was taken to a new centrifuge tube.

(4) mu.L Tris phenol/chloroform, fully rotating and shaking for 10min, then, 4 ℃, 13400rpm centrifugation for 10min, then the supernatant is transferred to a new centrifuge tube.

(5) The supernatant was collected by thoroughly rotating and shaking chloroform in an equal volume for 10min, followed by centrifugation at 13400rpm for 10min at 4 ℃.

(6) Adding anhydrous ethanol precooled at 4 ℃ into a centrifuge tube in equal volume, slightly turning upside down until uniform white flocculent precipitate appears, and standing for 5 min.

(7) Carefully picking out the precipitate with a sterile 100. mu.l sampler, transferring to a new 1.5mL centrifuge tube, washing with 4 deg.C pre-cooled 75% ethanol for 1-2 times, centrifuging at 4 deg.C and 13400rpm for 10min, and discarding the supernatant.

(8) The centrifuge tube was opened, allowed to stand at room temperature until the ethanol was evaporated, and 30-50. mu.L of EB buffer was added to dissolve the DNA precipitate.

(9) Detecting DNA purity and concentration by using a spectrophotometer, carrying out agarose gel electrophoresis detection, and storing at-80 ℃ for a long time for later use.

Step S6-3 genomic PCR:

(1) the Primer of BmDimm (SEQ ID NO.2) is designed by using Primer5 software, the Primer is synthesized by Huada gene, and the Primer is dissolved and diluted by adding ultrapure water after being synthesized and then stored at 4 ℃.

(2) And (3) carrying out PCR amplification on a target fragment by taking the extracted genome as a template, wherein the reaction system comprises the following steps:

(3) the PCR amplification conditions were as follows:

(4) after the reaction was completed, 1% agarose gel was prepared, and 5. mu.L of PCR amplification product was subjected to electrophoresis. The detection result is shown in figure 7, and the result shows that the transgenic silkworm over-expressing Bmdimm (SEQ ID NO.2) is correct.

Example 9, identification of target knockout efficiency for GAL4/UAS transgenic silkworms for the posterior silk gland-specific knockout of BmYki (SEQ ID No.3), comprising the steps of:

step S7-1, dissecting the posterior silk gland of the wild silkworm Nistar and the Ushu PSG (posterior silk gland) specific knockout BmYki (SEQ ID NO.3) of the transgenic silkworm on the sixth day of five years old (5L6D), and collecting through a 1.5mL centrifuge tube.

Step S7-2, extracting the genome of the collected posterior silk gland, wherein the extraction steps are as follows:

(2) Add 1mL of DNA extraction Buffer to the centrifuge tube and vortex at 3000rpm (rpm) to mix. Adding RNA enzyme according to the working concentration of 100 mu L/mL, placing the mixture in a constant-temperature water bath kettle at 37 ℃ for digestion for 1 hour, adding proteinase K, and digesting the mixture in a water bath at 55 ℃ overnight.

Step S7-3, genome PCR:

(1) two BmYki (SEQ ID NO.3) target spot primers are knocked out by utilizing Primer5 software, the primers are synthesized by a Huada gene, ultrapure water is added after the primers are synthesized, the primers are dissolved and diluted, and then the primers are stored at 4 ℃.

(3) the PCR amplification conditions were as follows:

(4) after the reaction was completed, 1% agarose gel was prepared, and 5. mu.L of PCR amplification product was subjected to electrophoresis.

Step S7-4 glue recovery:

the gel was placed on an ultraviolet gel cutter, and the gel strip containing the desired fragment was cut out in order and placed in a 1.5mL centrifuge tube. Adding Binding Buffer solution in an amount of 100 μ g/300 μ L, placing on a metal bath at constant temperature of 50 deg.C until fully dissolving, and mixing by turning upside down once every 1min to accelerate the dissolution of the gel block. After the solution is quickly and fully dissolved, the solution is taken out and cooled to room temperature.

(1) Before recovery, absolute ethanol was added to the Wash Buffer (WB) (Wash Buffer) according to the instructions of the gel recovery kit.

(2) The fully dissolved solution was transferred to an adsorption column, left to stand for 2min and centrifuged at 13000rpm for 1 min.

(3) Add 600. mu.L of Wash Buffer, centrifuge at 13000rpm for 1 min. This operation was repeated once.

(4) The column was then emptied at 13400rpm for 2min, the remaining Wash Buffer was removed, the column was placed in a sterile 1.5mL centrifuge tube and allowed to stand until ethanol was evaporated, 35-50. mu.L of Elution Buffer (EB) was added and allowed to stand at room temperature for 2 min. Centrifuging at 13400rpm for 1min, and collecting the effluent.

(5) The concentration of the recovered fragment was detected by a spectrophotometer, and the recovered fragment was further confirmed to be correct by 1% agarose gel electrophoresis.

Step S7-5T cloning

(1) And (3) carrying out T vector connection on the target fragment, wherein the connection system is as follows:

recovering 4 μ L of product;

1 μ L of pMD19T vector;

ligation buffer I5. mu.L.

After mixing gently, the mixture was placed on a connector at 25 ℃ for 15 min.

Step S7-6 plasmid transformation

(1) T1 E.coli competence was taken out at-80 ℃ and placed on ice, and when the cells were to be completely dissolved, 30. mu.L of the competent cells were quickly pipetted into a 1.5mL centrifuge tube, and 10. mu.L of the ligation product was added and gently pipetted and mixed.

(2) The tube was placed on ice and allowed to stand for 30 min.

(3) Adding 200 μ L of nonreactive LB liquid medium into a centrifuge tube, and performing amplification culture for 30min at 37 ℃ by using a constant temperature shaking table.

(4) Sucking 100 mu L of bacterial liquid on an LB/Amp solid plate, using a sterile coating rod to cross and uniformly coat, placing the plate in a constant temperature incubator at 37 ℃ until the surface of the plate is dried, and then carrying out inverted culture for 12 hours.

Step S7-7 bacterial liquid electrophoresis screening positive clone

(1) Monoclonal colonies were picked from the plates using an autoclaved 100. mu.l sampler and transferred to a liquid medium containing 500. mu.L ampicillin resistance. Shaking and culturing for 6 hours at constant temperature of 220rpm and 37 ℃ or turbidity appears in the bacterial liquid.

(2) Firstly, 50 mu L of bacterial lysate is mixed uniformly in 50 mu L of 5 Xloading Buffer, then 10 mu L of bacterial lysate is taken as a unit to be subpackaged into PCR tubes, 10 mu L of bacterial solution is added into each PCR tube respectively, and then the bacterial solution is blown and mixed uniformly by a pipette gun and then is lysed for 10 min.

And (3) after the cracking is finished, preparing 1% agarose gel for electrophoresis detection, and selecting positive bacteria liquid to send to a company for sequencing identification. The sequencing results are shown in FIG. 8. The results demonstrate that 2 of the designed BmYki targets (SEQ ID NO.3) in PSG were successfully knocked out.

Example 10 molecular identification of GAL4/UAS transgenic bombyx mori with a posterior silk gland-specific knockout of BmSd (SEQ ID No.4) comprising the steps of:

step S8-1, dissect the posterior silk gland of the wild silkworm Nistar and the specific knockout BmSD (SEQ ID NO.4) of the PSG (posterior silk gland) of the five-year-old transgenic silkworm six day (5L6D), and collect the posterior silk gland through a centrifugal tube of 1.5 mL.

Step S8-2, extracting the genome of the collected posterior silk gland, wherein the extraction steps are as follows:

Step S8-3, genome PCR:

(1) two primers for knocking out the BmSD target spot (SEQ ID NO.4) are designed by utilizing Primer5 software, the primers are synthesized by Huada gene, ultrapure water is added for dissolving and diluting after the primers are synthesized, and then the primers are stored at 4 ℃.

(3) the PCR amplification conditions were as follows:

(4) after the reaction was completed, 1% agarose gel was prepared, and 5. mu.L of PCR amplification product was subjected to electrophoresis. The detection result is shown in figure 9, which proves that the transgenic silkworm with the BmSD (SEQ ID NO.4) knockout is successfully made.

Sequence listing to which the invention relates

SEQ ID NO.1 Cas9 gene sequence

atggacaaaaagtatagcatcggtctggatattggaactaactccgtcggctgggctgtaatcaccgacgaatacaaggtcccgtcaaaaaagttcaaggtattgggtaacacagatcgtcactctatcaaaaagaatctcattggagctctgttgttcgacagcggcgaaacagctgaggccactagactgaagcgcaccgccagacgccgttacacgaggagaaagaacagaatctgctacttgcaagaaatattctcaaacgagatggccaaagtggacgattcgttctttcataggttagaagagagtttccttgttgaagaggataaaaagcacgaaagacatccgatatttggaaacatcgtggacgaagttgcttatcacgagaagtaccccacgatctatcatctgcgtaaaaagttggtggactcgacagataaggccgacctcaggttaatataccttgcactggcgcacatgatcaaattcagaggccattttctgattgaaggtgacctgaaccctgacaatagtgatgtggacaaactcttcattcaattagttcagacctacaatcaactgtttgaagagaaccctatcaacgcttcaggagttgacgctaaggccatccttagtgcgagactgagcaaatcccgccgtctcgaaaacttaatcgcacagttgcctggagagaaaaagaacggtttgttcggaaatctcattgcgttgtcactcggactcacgccaaacttcaagtctaacttcgatttggcagaagacgcgaaactgcaactgagcaaagacacatatgacgatgacctcgataacctcttagctcagatcggcgatcaatacgccgacttgttcctcgctgccaaaaatctgtcggacgctatacttctgagtgatatcttgcgcgtcaacacagaaattactaaggctcctctgtcggccagtatgataaaacgctatgacgaacaccatcaggatttgacattgctcaaagccctcgtgcgtcaacagctcccagaaaagtacaaggagattttctttgatcagtccaagaatggctacgcaggttatatagacggtggagcgtcgcaagaagagttctacaagttcatcaagccaatattagaaaagatggacggcacggaagagttacttgttaagctgaatcgtgaggacctgttgcgtaaacagaggacattcgataacggatcaattccgcaccaaatacatcttggcgaactgcacgctatcctcaggagacaagaggacttctacccctttttaaaggataaccgtgaaaagatcgagaaaatcctgactttcaggattccttactatgtcggcccactggctcgtggtaatagcaggtttgcctggatgaccaggaagtccgaagagacaattactccgtggaacttcgaagaggtggttgataaaggagcatcagcgcagtctttcatagaacgcatgacaaattttgacaagaacttaccgaatgagaaggtccttcccaaacactcactcctctacgaatacttcacagtatacaacgagctcactaaagtcaagtacgtaaccgagggtatgcgcaaacccgctttcctgtctggagagcagaaaaaggccatcgtggaccttctgttcaagacaaaccgtaaggtcactgtaaagcaactcaaggaagactacttcaaaaagatagagtgtttcgattcagtggaaatctctggcgttgaggacagatttaacgcttccttgggtacttaccacgatttgctcaagatcattaaagataaggacttcctcgacaacgaagagaacgaagatatcttagaggacatagttctcacccttacgctgtttgaagatagagagatgattgaagagcgcctgaagacttatgctcatttgttcgatgacaaagtcatgaagcaactgaaacgccgtaggtacaccggctggggtagattatcgcgcaaacttattaatggtataagggacaagcagtcgggaaaaacgatattggactttctcaagagtgatggtttcgccaacagaaattttatgcaactcatacacgatgacagcttaacattcaaggaagatatccaaaaagcacaggtgtcgggacagggcgacagtttgcacgaacatattgctaacctcgccggctccccggcgataaaaaagggtatccttcagactgtgaaagtcgtagatgaactggtgaaggttatgggtcgtcataaacccgagaacatagttatcgaaatggctagggagaatcaaacaactcagaagggacagaaaaactcaagagaacgcatgaagcgcattgaagagggtatcaaagagcttggcagtcaaatcctgaaggaacaccctgtcgagaacacgcaacttcagaacgaaaaattgtacctctactatctgcagaatggtagagatatgtacgtagaccaagaattggatattaaccgcctctcagattacgacgtggatcatatagttccgcagtcattcttgaaggatgactctatcgacaacaaagtcctcacaagatcagacaagaaccgcggaaaatcagataatgtaccctctgaagaggtggttaaaaagatgaaaaactactggagacagttacttaacgctaagttgatcacgcaaagaaagttcgataacctcacaaaggctgaacgcggcggtttaagcgagcttgacaaggccggtttcataaaacgtcagttagtcgaaaccaggcaaattacgaaacacgtagcccaaatattggattcccgcatgaacactaaatacgatgaaaatgacaagctcatccgtgaggtcaaagtaattaccctgaaaagcaagttggtgtccgacttcagaaaggatttccagttctacaaagttcgcgaaatcaacaactaccaccatgcacatgacgcttacctgaacgcagtcgtaggcactgcgttaattaaaaagtaccctaaactggaatctgagttcgtgtacggtgactataaagtgtacgatgttagaaagatgatcgctaaaagcgaacaggagattggaaaggctaccgccaagtatttcttttactccaacatcatgaatttctttaagaccgaaatcacgttagcaaatggcgagatacgtaaaaggccacttatcgaaacaaacggagaaactggcgagatagtgtgggacaagggtagagattttgccactgtccgcaaagtactgtcgatgccgcaagtgaatatcgttaaaaagaccgaagttcaaacgggaggcttcagcaaagagtccatcctgcccaagcgtaacagtgataaattgatagctaggaaaaaggactgggaccctaaaaagtatggtggattcgacagcccaactgtcgcatactccgtattggtggttgcgaaagtcgaaaaaggaaagagcaaaaagctcaagtccgtaaaagagctgttgggcattaccataatggaaagatcatctttcgagaagaatcctatcgattttctggaagccaagggatataaagaggtcaaaaaggacctcataatcaagttaccaaaatacagtctgttcgaattggagaacggcagaaaacgcatgcttgcatcagcgggtgaactgcaaaagggaaatgagttagcacttccttctaaatacgtcaacttcctgtatttggcgtcacactacgaaaaactgaagggctctccagaagataacgagcaaaagcagttatttgtggaacagcacaaacattaccttgacgaaattatagagcaaatctcggagttcagtaagagagtgattttggctgacgccaatcttgataaagttctgtctgcttacaacaagcaccgtgataaaccgattagggaacaggccgagaacatcatacatctcttcacactcactaaccttggtgcacccgcagcgttcaaatattttgacaccacgatagatcgtaagaggtacaccagcacgaaagaagttttggacgcgacactcatccatcaatcaatcacgggcctgtacgagaccagaatcgacctgtcccagctcggtggcgacaaaaggccggcggccacgaaaaaggctggccaggcaaaaaagaaaaagtaa

SEQ ID NO.2 BmDimm gene sequence

atgccacactgggtaactgctgaagaaggcactgacaccgaatctcctgaccaagttatgttatattacgaagatgacgcttcagaatactatgataataaacccgacggcccagacaatatagaagaacaaaatggagatttttatgatagtggtagcggaagtgatgagccagtgcagcgcaggatgcgcccaagacgcgctgtagtattagggtcttcatcatcagccggcagtacgggacctccttcaggacccggtcgacggcggaggtgtggcatttccgctcgtgaacgcaacctccgtcgtctcgagagcaatgaaagagaaagaatgcgaatgcattccctcaaccgagcttttgaggatttacgccgcgtaatcccacatgtgaaaaaagacaacagaagtctttcaaagatagaaacccttaccttagccaaaaattacgtgaaagccctcacgaatgctatttgcacaatgagaggtgaagttgctcattattcattcaatagcgacgatgaaaacgtggaacccgcatttgtattgaataggagggatcaggagccgaacaacaacgagactgtcagtacggaccagcaagaaattacgacacggacgcaaggtttcttctga

Knockout target spot of SEQ ID NO.3 BmYki

ggactcaaagcgaccgctacagg

gatcttggacccttaccagcagg

Knockout target spot of SEQ ID NO.4 BmSD

tggcgatatacccgccctggttt

tggcagccaggcctacaagcgtt

SEQ ID NO.5 bombyx mori fibH gene promoter

cctgcgtgatcaggaaaaatgtggaaagcttaacgattttgtcacattttacttatcacaacttgtttttataataattcgcttaaatgagcagctattacttaatctcgtagtggtttttgacaaaatcagcttctttagaactaaaatatcatttttttcgtaatttttttaatgaaaaatgctctagtgttatacctttccaaaatcaccattaattaggtagtgtttaagcttgttgtacaaaactgccacacgcatttttttctccactgtaggttgtagttacgcgaaaacaaaatcgttctgtgaaaattcaaacaaaaatattttttcgtaaaaacacttatcaatgagtaaagtaacaattcatgaataatttcatgtaaaaaaaaaatactagaaaaggaatttttcattacgagatgcttaaaaatctgtttcaaggtagagatttttcgatatttcggaaaattttgtaaaactgtaaatccgtaaaattttgctaaacatatattgtgttgttttggtaagtattgacccaagctatcacctcctgcagtatgtcgtgctaattactggacacattgtataacagttccactgtattgacaataataaaacctcttcattgacttgagaatgtctggacagatttggctttgtatttttgatttacaaatgtttttttggtgatttacccatccaaggcattctccaggatggttgtggcatcacgccgattggcaaacaaaaactaaaatgaaactaaaaagaaacagtttccgctgtcccgttcctctagtgggagaaagcatgaagtaagttctttaaatattacaaaaaaattgaacgatattataaaattctttaaaatattaaaagtaagaacaataagatcaattaaatcataattaatcacattgttcatgatcacaatttaatttacttcatacgttgtattgttatgttaaataaaaagattaatttctatgtaattgtatctgtacaatacaatgtgtagatgtttattctatcgaaagtaaatac

gtcaaaactcgaaaattttcagtataaaaaggttcaactttttcaaatcagcatcagttcggttccaactctcaag

SEQ ID NO.6 GAL4BD gene sequence

atgaaactgctctcatcaatcgaacaggcctgtgacatttgtagactcaaaaaactcaaatgctccaaggagaaacccaaatgtgccaaatgcctgaaaaacaactgggagtgccggtactctcctaaaaccaaacggagccctctcacacgggcccatctcactgaagtggaatctcgactcgaacggctcgaacagctctttctgctcatctttcctagagaggatctcgacatgatcctgaaaatggatagcctccaggacatcaaagccctgctcactggactgtttgtccaggataacgtgaacaaggacgccgtgaccgataggctggcatccgtggaaaccgatatgccactcacactgagacagcaccggattagtgccacatcttcttccgaggagtcatccaataagggacagcgacagctcaccgtgtca

SEQ ID NO.7 protein activation domain VP16 sequence

tgcaccgcccctattaccgatgtgtctctgggcgacgaactccggctggatggcgaggaagtcgatatgacccctgccgacgctctcgacgatttcgacctggaaatgctgggagatgtcgaatctccttctcctggcatgacacacgatcccgtgtcttacggagcactggatgtgtaa

SEQ ID NO.8 termination signal Ser1-poly A sequence

tacaactaaacacgacttggagtattccttgtagtgtttaagattttaaatcttacttaatgacttcgaacgattttaacgataactttctctttgtttaactttaatcagcatacataaaaagccccggttttgtatcgggaagaaaaaaaatgtaattgtgttgcctagataataaacgtattatcaaagtgtgtggttttcctttaccaaagacccctttaagatgggcctaatgggcttaagtcgagtcctttccgatgtgttaaatacacatttattacactgatgcgtcgaatgtacacttttaataggatagctccactaaaaattattttatttatttaatttgttgcaccaaaactgatacattgacgaa

SEQ ID NO. 93 XP 3-DsRed sequence

gcaaagtgaacacgtcgctaagcgaaagctaagcaaataaacaagcgcagctgaacaagctaaacaatcggggtaccgctagagtcgacggtaccgcgggcccgggatccaccggtcgccaccatggtgcgctcctccaagaacgtcatcaaggagttcatgcgcttcaaggtgcgcatggagggcaccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggccacaacaccgtgaagctgaaggtgaccaagggcggccccctgcccttcgcctgggacatcctgtccccccagttccagtacggctccaaggtgtacgtgaagcaccccgccgacatccccgactacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggctgcttcatctacaaggtgaagttcatcggcgtgaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggcgagatccacaaggccctgaagctgaaggacggcggccactacctggtggagttcaagtccatctacatggccaagaagcccgtgcagctgcccggctactactacgtggactccaagctggacatcacctcccacaacgaggactacaccatcgtggagcagtacgagcgcaccgagggccgccaccacctgttcctgtagtcataatcagccataccacatttgtag

SEQ ID NO.10 piggyBac right arm sequence

ccctagaaagataatcatattgtgacgtacgttaaagataatcatgcgtaaaattgacgcatgtgttttatcggtctgtatatcgaggtttatttattaatttgaatagatattaagttttattatatttacacttacatactaataataaattcaacaaacaatttatttatgtttatttatttattaaaaaaaaacaaaaactcaaaatttcttctataaagtaacaaaacttttaaacattctctcttttacaaaaataaacttattttgtactttaaaaacagtcatgttgtattataaaataagtaattagcttaacttatacataatagaaacaaattatacttattagtcagtcagaaacaactttggcacatatcaatattatgctctcgacaaataacttttttgcattttttgcacgatgcatttgcctttcgccttattttagaggggcagtaagtacagtaagtacgttttttcattactggctcttcagtactgtcatctgatgtaccaggcacttcatttggcaaaatattagagatattatcgcgcaaatatctcttcaaagtaggagcttctaaacgcttacgcataaacgatgacgtcaggctcatgtaaaggtttctcataaattttttgcgactttggaccttttctcccttgctactgacattatggctgtatataataaaagaatttatgcaggcaatgtttatcattccgtacaataatgccataggccacctattcgtcttcctactgcaggtcatcacagaacacatttggtctagcgtgtccactccgcctttagtttgattataatacataaccatttgcggtttaccggtactttcgttgatagaagcatcctcatcacaagatgataataagtataccatcttagctggcttcggtttatatgagacgagagtaaggggtccgtcaaaacaaaacatcgatgttcccactggcctggagcgactgtttttcagtacttccggtatctcgcgtttgtttgatcgcacggttcccacaatggttt

SEQ ID NO.11 piggyBac left arm sequence

agatctgacaatgttcagtgcagagactcggctacgcctcgtggactttgaagttgaccaacaatgtttattcttacctctaatagtcctctgtggcaaggtcaagattctgttagaagccaatgaagaacctggttgttcaataacattttgttcgtctaatatttcactaccgcttgacgttggctgcacttcatgtacctcatctataaacgcttcttctgtatcgctctggacgtcatcttcacttacgtgatctgatatttcactgtcagaatcctcaccaacaagctcgtcatcgctttgcagaagagcagagaggatatgctcatcgtctaaagaactacccattttattatatattagtcacgatatctataacaagaaaatatatatataataagttatcacgtaagtagaacatgaaataacaatataattatcgtatgagttaaatcttaaaagtcacgtaaaagataatcatgcgtcattttgactcacgcggtcgttatagttcaaaatcagtgacacttaccgcattgacaagcacgcctcacgggagctccaagcggcgactgagatgtcctaaatgcacagcgacggattcgcgctatttagaaagagagagcaatatttcaagaatgcatgcgtcaattttacgcagactatctttctaggg

SEQ ID NO. 1210 XUAS sequence

cggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggaagcttgcatgcctgcaggtcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagactctagcgagcgccggagtataaatagaggcgcttcgtctacggagcgacaattcaattcaaacaagcaaagtgaacacgtcgctaagcgaaagctaagcaaataaacaagcgcagctgaacaagctaaacaatctgcagtaaagtgcaagttaaagtgaatcaattaaaagtaaccagcaaccaagtaaatcaactgcaactactgaaatctgccaagaagtaattattgaatacaagaagagaactctgaatagggaattgg

SEQ ID NO. 13U 6 promoter sequence

aggttatgtagtacacattgttgtaaatcactgaattgttttagatgattttaacaattagtacttattaatattaaataagtacataccttgagaatttaaaaatcgtcaactataagccatacgaatttaagcttggtacttggcttatagataaggacagaataagaattgttaacgtgtaagacaaggtcagatagtcatagtgattttgtcaaagtaataacagatggcgctgtacaaaccataactgttttcatttgtttttatggattttattacaaattctaaaggttttattgttattatttaatttcgttttaattatattatatatctttaatagaatatgttaagagtttttgctctttttgaataatctttgtaaagtcgagtgttgttgtaaatcacgctttcaatagtttagtttttttaggtatatatacaaaatatcgtgctctacaagt

SEQ ID NO. 143 XP 3-ECFP sequence

gcaaagtgaacacgtcgctaagcgaaagctaagcaaataaacaagcgcagctgaacaagctaaacaatcggggtaccgctagagtcgacggtacgatccaccggtcgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaactctagatcataatcagccataccacatttgtag

The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention are included in the scope of the present invention.

Sequence listing

<110> university of southwest

<120> transgenic method for improving silk fibroin content in silkworm cocoon and silkworm variety thereof

<141> 2022-03-04

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4155

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 1

atggacaaaa agtatagcat cggtctggat attggaacta actccgtcgg ctgggctgta 60

atcaccgacg aatacaaggt cccgtcaaaa aagttcaagg tattgggtaa cacagatcgt 120

cactctatca aaaagaatct cattggagct ctgttgttcg acagcggcga aacagctgag 180

gccactagac tgaagcgcac cgccagacgc cgttacacga ggagaaagaa cagaatctgc 240

tacttgcaag aaatattctc aaacgagatg gccaaagtgg acgattcgtt ctttcatagg 300

ttagaagaga gtttccttgt tgaagaggat aaaaagcacg aaagacatcc gatatttgga 360

aacatcgtgg acgaagttgc ttatcacgag aagtacccca cgatctatca tctgcgtaaa 420

aagttggtgg actcgacaga taaggccgac ctcaggttaa tataccttgc actggcgcac 480

atgatcaaat tcagaggcca ttttctgatt gaaggtgacc tgaaccctga caatagtgat 540

gtggacaaac tcttcattca attagttcag acctacaatc aactgtttga agagaaccct 600

atcaacgctt caggagttga cgctaaggcc atccttagtg cgagactgag caaatcccgc 660

cgtctcgaaa acttaatcgc acagttgcct ggagagaaaa agaacggttt gttcggaaat 720

ctcattgcgt tgtcactcgg actcacgcca aacttcaagt ctaacttcga tttggcagaa 780

gacgcgaaac tgcaactgag caaagacaca tatgacgatg acctcgataa cctcttagct 840

cagatcggcg atcaatacgc cgacttgttc ctcgctgcca aaaatctgtc ggacgctata 900

cttctgagtg atatcttgcg cgtcaacaca gaaattacta aggctcctct gtcggccagt 960

atgataaaac gctatgacga acaccatcag gatttgacat tgctcaaagc cctcgtgcgt 1020

caacagctcc cagaaaagta caaggagatt ttctttgatc agtccaagaa tggctacgca 1080

ggttatatag acggtggagc gtcgcaagaa gagttctaca agttcatcaa gccaatatta 1140

gaaaagatgg acggcacgga agagttactt gttaagctga atcgtgagga cctgttgcgt 1200

aaacagagga cattcgataa cggatcaatt ccgcaccaaa tacatcttgg cgaactgcac 1260

gctatcctca ggagacaaga ggacttctac ccctttttaa aggataaccg tgaaaagatc 1320

gagaaaatcc tgactttcag gattccttac tatgtcggcc cactggctcg tggtaatagc 1380

aggtttgcct ggatgaccag gaagtccgaa gagacaatta ctccgtggaa cttcgaagag 1440

gtggttgata aaggagcatc agcgcagtct ttcatagaac gcatgacaaa ttttgacaag 1500

aacttaccga atgagaaggt ccttcccaaa cactcactcc tctacgaata cttcacagta 1560

tacaacgagc tcactaaagt caagtacgta accgagggta tgcgcaaacc cgctttcctg 1620

tctggagagc agaaaaaggc catcgtggac cttctgttca agacaaaccg taaggtcact 1680

gtaaagcaac tcaaggaaga ctacttcaaa aagatagagt gtttcgattc agtggaaatc 1740

tctggcgttg aggacagatt taacgcttcc ttgggtactt accacgattt gctcaagatc 1800

attaaagata aggacttcct cgacaacgaa gagaacgaag atatcttaga ggacatagtt 1860

ctcaccctta cgctgtttga agatagagag atgattgaag agcgcctgaa gacttatgct 1920

catttgttcg atgacaaagt catgaagcaa ctgaaacgcc gtaggtacac cggctggggt 1980

agattatcgc gcaaacttat taatggtata agggacaagc agtcgggaaa aacgatattg 2040

gactttctca agagtgatgg tttcgccaac agaaatttta tgcaactcat acacgatgac 2100

agcttaacat tcaaggaaga tatccaaaaa gcacaggtgt cgggacaggg cgacagtttg 2160

cacgaacata ttgctaacct cgccggctcc ccggcgataa aaaagggtat ccttcagact 2220

gtgaaagtcg tagatgaact ggtgaaggtt atgggtcgtc ataaacccga gaacatagtt 2280

atcgaaatgg ctagggagaa tcaaacaact cagaagggac agaaaaactc aagagaacgc 2340

atgaagcgca ttgaagaggg tatcaaagag cttggcagtc aaatcctgaa ggaacaccct 2400

gtcgagaaca cgcaacttca gaacgaaaaa ttgtacctct actatctgca gaatggtaga 2460

gatatgtacg tagaccaaga attggatatt aaccgcctct cagattacga cgtggatcat 2520

atagttccgc agtcattctt gaaggatgac tctatcgaca acaaagtcct cacaagatca 2580

gacaagaacc gcggaaaatc agataatgta ccctctgaag aggtggttaa aaagatgaaa 2640

aactactgga gacagttact taacgctaag ttgatcacgc aaagaaagtt cgataacctc 2700

acaaaggctg aacgcggcgg tttaagcgag cttgacaagg ccggtttcat aaaacgtcag 2760

ttagtcgaaa ccaggcaaat tacgaaacac gtagcccaaa tattggattc ccgcatgaac 2820

actaaatacg atgaaaatga caagctcatc cgtgaggtca aagtaattac cctgaaaagc 2880

aagttggtgt ccgacttcag aaaggatttc cagttctaca aagttcgcga aatcaacaac 2940

taccaccatg cacatgacgc ttacctgaac gcagtcgtag gcactgcgtt aattaaaaag 3000

taccctaaac tggaatctga gttcgtgtac ggtgactata aagtgtacga tgttagaaag 3060

atgatcgcta aaagcgaaca ggagattgga aaggctaccg ccaagtattt cttttactcc 3120

aacatcatga atttctttaa gaccgaaatc acgttagcaa atggcgagat acgtaaaagg 3180

ccacttatcg aaacaaacgg agaaactggc gagatagtgt gggacaaggg tagagatttt 3240

gccactgtcc gcaaagtact gtcgatgccg caagtgaata tcgttaaaaa gaccgaagtt 3300

caaacgggag gcttcagcaa agagtccatc ctgcccaagc gtaacagtga taaattgata 3360

gctaggaaaa aggactggga ccctaaaaag tatggtggat tcgacagccc aactgtcgca 3420

tactccgtat tggtggttgc gaaagtcgaa aaaggaaaga gcaaaaagct caagtccgta 3480

aaagagctgt tgggcattac cataatggaa agatcatctt tcgagaagaa tcctatcgat 3540

tttctggaag ccaagggata taaagaggtc aaaaaggacc tcataatcaa gttaccaaaa 3600

tacagtctgt tcgaattgga gaacggcaga aaacgcatgc ttgcatcagc gggtgaactg 3660

caaaagggaa atgagttagc acttccttct aaatacgtca acttcctgta tttggcgtca 3720

cactacgaaa aactgaaggg ctctccagaa gataacgagc aaaagcagtt atttgtggaa 3780

cagcacaaac attaccttga cgaaattata gagcaaatct cggagttcag taagagagtg 3840

attttggctg acgccaatct tgataaagtt ctgtctgctt acaacaagca ccgtgataaa 3900

ccgattaggg aacaggccga gaacatcata catctcttca cactcactaa ccttggtgca 3960

cccgcagcgt tcaaatattt tgacaccacg atagatcgta agaggtacac cagcacgaaa 4020

gaagttttgg acgcgacact catccatcaa tcaatcacgg gcctgtacga gaccagaatc 4080

gacctgtccc agctcggtgg cgacaaaagg ccggcggcca cgaaaaaggc tggccaggca 4140

aaaaagaaaa agtaa 4155

<210> 2

<211> 636

<212> DNA

<213> silkworm (Bombyx mori)

<400> 2

atgccacact gggtaactgc tgaagaaggc actgacaccg aatctcctga ccaagttatg 60

ttatattacg aagatgacgc ttcagaatac tatgataata aacccgacgg cccagacaat 120

atagaagaac aaaatggaga tttttatgat agtggtagcg gaagtgatga gccagtgcag 180

cgcaggatgc gcccaagacg cgctgtagta ttagggtctt catcatcagc cggcagtacg 240

ggacctcctt caggacccgg tcgacggcgg aggtgtggca tttccgctcg tgaacgcaac 300

ctccgtcgtc tcgagagcaa tgaaagagaa agaatgcgaa tgcattccct caaccgagct 360

tttgaggatt tacgccgcgt aatcccacat gtgaaaaaag acaacagaag tctttcaaag 420

atagaaaccc ttaccttagc caaaaattac gtgaaagccc tcacgaatgc tatttgcaca 480

atgagaggtg aagttgctca ttattcattc aatagcgacg atgaaaacgt ggaacccgca 540

tttgtattga ataggaggga tcaggagccg aacaacaacg agactgtcag tacggaccag 600

caagaaatta cgacacggac gcaaggtttc ttctga 636

<210> 3

<211> 46

<212> DNA

<213> silkworm (Bombyx mori)

<400> 3

ggactcaaag cgaccgctac agggatcttg gacccttacc agcagg 46

<210> 4

<211> 46

<212> DNA

<213> silkworm (Bombyx mori)

<400> 4

tggcgatata cccgccctgg ttttggcagc caggcctaca agcgtt 46

<210> 5

<211> 1126

<212> DNA

<213> silkworm (Bombyx mori)

<400> 5

cctgcgtgat caggaaaaat gtggaaagct taacgatttt gtcacatttt acttatcaca 60

acttgttttt ataataattc gcttaaatga gcagctatta cttaatctcg tagtggtttt 120

tgacaaaatc agcttcttta gaactaaaat atcatttttt tcgtaatttt tttaatgaaa 180

aatgctctag tgttatacct ttccaaaatc accattaatt aggtagtgtt taagcttgtt 240

gtacaaaact gccacacgca tttttttctc cactgtaggt tgtagttacg cgaaaacaaa 300

atcgttctgt gaaaattcaa acaaaaatat tttttcgtaa aaacacttat caatgagtaa 360

agtaacaatt catgaataat ttcatgtaaa aaaaaaatac tagaaaagga atttttcatt 420

acgagatgct taaaaatctg tttcaaggta gagatttttc gatatttcgg aaaattttgt 480

aaaactgtaa atccgtaaaa ttttgctaaa catatattgt gttgttttgg taagtattga 540

cccaagctat cacctcctgc agtatgtcgt gctaattact ggacacattg tataacagtt 600

ccactgtatt gacaataata aaacctcttc attgacttga gaatgtctgg acagatttgg 660

ctttgtattt ttgatttaca aatgtttttt tggtgattta cccatccaag gcattctcca 720

ggatggttgt ggcatcacgc cgattggcaa acaaaaacta aaatgaaact aaaaagaaac 780

agtttccgct gtcccgttcc tctagtggga gaaagcatga agtaagttct ttaaatatta 840

caaaaaaatt gaacgatatt ataaaattct ttaaaatatt aaaagtaaga acaataagat 900

caattaaatc ataattaatc acattgttca tgatcacaat ttaatttact tcatacgttg 960

tattgttatg ttaaataaaa agattaattt ctatgtaatt gtatctgtac aatacaatgt 1020

gtagatgttt attctatcga aagtaaatac gtcaaaactc gaaaattttc agtataaaaa 1080

ggttcaactt tttcaaatca gcatcagttc ggttccaact ctcaag 1126

<210> 6

<211> 441

<212> DNA

<213> Yeast (Saccharomyces cerevisiae)

<400> 6

atgaaactgc tctcatcaat cgaacaggcc tgtgacattt gtagactcaa aaaactcaaa 60

tgctccaagg agaaacccaa atgtgccaaa tgcctgaaaa acaactggga gtgccggtac 120

tctcctaaaa ccaaacggag ccctctcaca cgggcccatc tcactgaagt ggaatctcga 180

ctcgaacggc tcgaacagct ctttctgctc atctttccta gagaggatct cgacatgatc 240

ctgaaaatgg atagcctcca ggacatcaaa gccctgctca ctggactgtt tgtccaggat 300

aacgtgaaca aggacgccgt gaccgatagg ctggcatccg tggaaaccga tatgccactc 360

acactgagac agcaccggat tagtgccaca tcttcttccg aggagtcatc caataaggga 420

cagcgacagc tcaccgtgtc a 441

<210> 7

<211> 180

<212> DNA

<213> human herpesvirus 2 Strain (human herpesvirus 2)

<400> 7

tgcaccgccc ctattaccga tgtgtctctg ggcgacgaac tccggctgga tggcgaggaa 60

gtcgatatga cccctgccga cgctctcgac gatttcgacc tggaaatgct gggagatgtc 120

gaatctcctt ctcctggcat gacacacgat cccgtgtctt acggagcact ggatgtgtaa 180

<210> 8

<211> 379

<212> DNA

<213> silkworm (Bombyx mori)

<400> 8

tacaactaaa cacgacttgg agtattcctt gtagtgttta agattttaaa tcttacttaa 60

tgacttcgaa cgattttaac gataactttc tctttgttta actttaatca gcatacataa 120

aaagccccgg ttttgtatcg ggaagaaaaa aaatgtaatt gtgttgccta gataataaac 180

gtattatcaa agtgtgtggt tttcctttac caaagacccc tttaagatgg gcctaatggg 240

cttaagtcga gtcctttccg atgtgttaaa tacacattta ttacactgat gcgtcgaatg 300

tacactttta ataggatagc tccactaaaa attattttat ttatttaatt tgttgcacca 360

aaactgatac attgacgaa 379

<210> 9

<211> 831

<212> DNA

<213> Mushroom coral (Discosoma sp)

<400> 9

gcaaagtgaa cacgtcgcta agcgaaagct aagcaaataa acaagcgcag ctgaacaagc 60

taaacaatcg gggtaccgct agagtcgacg gtaccgcggg cccgggatcc accggtcgcc 120

accatggtgc gctcctccaa gaacgtcatc aaggagttca tgcgcttcaa ggtgcgcatg 180

gagggcaccg tgaacggcca cgagttcgag atcgagggcg agggcgaggg ccgcccctac 240

gagggccaca acaccgtgaa gctgaaggtg accaagggcg gccccctgcc cttcgcctgg 300

gacatcctgt ccccccagtt ccagtacggc tccaaggtgt acgtgaagca ccccgccgac 360

atccccgact acaagaagct gtccttcccc gagggcttca agtgggagcg cgtgatgaac 420

ttcgaggacg gcggcgtggt gaccgtgacc caggactcct ccctgcagga cggctgcttc 480

atctacaagg tgaagttcat cggcgtgaac ttcccctccg acggccccgt aatgcagaag 540

aagaccatgg gctgggaggc ctccaccgag cgcctgtacc cccgcgacgg cgtgctgaag 600

ggcgagatcc acaaggccct gaagctgaag gacggcggcc actacctggt ggagttcaag 660

tccatctaca tggccaagaa gcccgtgcag ctgcccggct actactacgt ggactccaag 720

ctggacatca cctcccacaa cgaggactac accatcgtgg agcagtacga gcgcaccgag 780

ggccgccacc acctgttcct gtagtcataa tcagccatac cacatttgta g 831

<210> 10

<211> 1051

<212> DNA

<213> Trichoplusia ni (Trichoplusia ni)

<400> 10

ccctagaaag ataatcatat tgtgacgtac gttaaagata atcatgcgta aaattgacgc 60

atgtgtttta tcggtctgta tatcgaggtt tatttattaa tttgaataga tattaagttt 120

tattatattt acacttacat actaataata aattcaacaa acaatttatt tatgtttatt 180

tatttattaa aaaaaaacaa aaactcaaaa tttcttctat aaagtaacaa aacttttaaa 240

cattctctct tttacaaaaa taaacttatt ttgtacttta aaaacagtca tgttgtatta 300

taaaataagt aattagctta acttatacat aatagaaaca aattatactt attagtcagt 360

cagaaacaac tttggcacat atcaatatta tgctctcgac aaataacttt tttgcatttt 420

ttgcacgatg catttgcctt tcgccttatt ttagaggggc agtaagtaca gtaagtacgt 480

tttttcatta ctggctcttc agtactgtca tctgatgtac caggcacttc atttggcaaa 540

atattagaga tattatcgcg caaatatctc ttcaaagtag gagcttctaa acgcttacgc 600

ataaacgatg acgtcaggct catgtaaagg tttctcataa attttttgcg actttggacc 660

ttttctccct tgctactgac attatggctg tatataataa aagaatttat gcaggcaatg 720

tttatcattc cgtacaataa tgccataggc cacctattcg tcttcctact gcaggtcatc 780

acagaacaca tttggtctag cgtgtccact ccgcctttag tttgattata atacataacc 840

atttgcggtt taccggtact ttcgttgata gaagcatcct catcacaaga tgataataag 900

tataccatct tagctggctt cggtttatat gagacgagag taaggggtcc gtcaaaacaa 960

aacatcgatg ttcccactgg cctggagcga ctgtttttca gtacttccgg tatctcgcgt 1020

ttgtttgatc gcacggttcc cacaatggtt t 1051

<210> 11

<211> 679

<212> DNA

<213> Trichoplusia ni (Trichoplusia ni)

<400> 11

agatctgaca atgttcagtg cagagactcg gctacgcctc gtggactttg aagttgacca 60

acaatgttta ttcttacctc taatagtcct ctgtggcaag gtcaagattc tgttagaagc 120

caatgaagaa cctggttgtt caataacatt ttgttcgtct aatatttcac taccgcttga 180

cgttggctgc acttcatgta cctcatctat aaacgcttct tctgtatcgc tctggacgtc 240

atcttcactt acgtgatctg atatttcact gtcagaatcc tcaccaacaa gctcgtcatc 300

gctttgcaga agagcagaga ggatatgctc atcgtctaaa gaactaccca ttttattata 360

tattagtcac gatatctata acaagaaaat atatatataa taagttatca cgtaagtaga 420

acatgaaata acaatataat tatcgtatga gttaaatctt aaaagtcacg taaaagataa 480

tcatgcgtca ttttgactca cgcggtcgtt atagttcaaa atcagtgaca cttaccgcat 540

tgacaagcac gcctcacggg agctccaagc ggcgactgag atgtcctaaa tgcacagcga 600

cggattcgcg ctatttagaa agagagagca atatttcaag aatgcatgcg tcaattttac 660

gcagactatc tttctaggg 679

<210> 12

<211> 483

<212> DNA

<213> Yeast (Saccharomyces cerevisiae)

<400> 12

cggagtactg tcctccgagc ggagtactgt cctccgagcg gagtactgtc ctccgagcgg 60

agtactgtcc tccgagcgga gtactgtcct ccgagcggaa gcttgcatgc ctgcaggtcg 120

gagtactgtc ctccgagcgg agtactgtcc tccgagcgga gtactgtcct ccgagcggag 180

tactgtcctc cgagcggagt actgtcctcc gagcggagac tctagcgagc gccggagtat 240

aaatagaggc gcttcgtcta cggagcgaca attcaattca aacaagcaaa gtgaacacgt 300

cgctaagcga aagctaagca aataaacaag cgcagctgaa caagctaaac aatctgcagt 360

aaagtgcaag ttaaagtgaa tcaattaaaa gtaaccagca accaagtaaa tcaactgcaa 420

ctactgaaat ctgccaagaa gtaattattg aatacaagaa gagaactctg aatagggaat 480

tgg 483

<210> 13

<211> 467

<212> DNA

<213> silkworm (Bombyx mori)

<400> 13

aggttatgta gtacacattg ttgtaaatca ctgaattgtt ttagatgatt ttaacaatta 60

gtacttatta atattaaata agtacatacc ttgagaattt aaaaatcgtc aactataagc 120

catacgaatt taagcttggt acttggctta tagataagga cagaataaga attgttaacg 180

tgtaagacaa ggtcagatag tcatagtgat tttgtcaaag taataacaga tggcgctgta 240

caaaccataa ctgttttcat ttgtttttat ggattttatt acaaattcta aaggttttat 300

tgttattatt taatttcgtt ttaattatat tatatatctt taatagaata tgttaagagt 360

ttttgctctt tttgaataat ctttgtaaag tcgagtgttg ttgtaaatca cgctttcaat 420

agtttagttt ttttaggtat atatacaaaa tatcgtgctc tacaagt 467

<210> 14

<211> 867

<212> DNA

<213> Victoria jellyfish (Aequorea victoria)

<400> 14

gcaaagtgaa cacgtcgcta agcgaaagct aagcaaataa acaagcgcag ctgaacaagc 60

taaacaatcg gggtaccgct agagtcgacg gtacgatcca ccggtcgcca ccatggtgag 120

caagggcgag gagctgttca ccggggtggt gcccatcctg gtcgagctgg acggcgacgt 180

aaacggccac aagttcagcg tgtccggcga gggcgagggc gatgccacct acggcaagct 240

gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg ccctggccca ccctcgtgac 300

caccctgacc tggggcgtgc agtgcttcag ccgctacccc gaccacatga agcagcacga 360

cttcttcaag tccgccatgc ccgaaggcta cgtccaggag cgcaccatct tcttcaagga 420

cgacggcaac tacaagaccc gcgccgaggt gaagttcgag ggcgacaccc tggtgaaccg 480

catcgagctg aagggcatcg acttcaagga ggacggcaac atcctggggc acaagctgga 540

gtacaactac atcagccaca acgtctatat caccgccgac aagcagaaga acggcatcaa 600

ggccaacttc aagatccgcc acaacatcga ggacggcagc gtgcagctcg ccgaccacta 660

ccagcagaac acccccatcg gcgacggccc cgtgctgctg cccgacaacc actacctgag 720

cacccagtcc gccctgagca aagaccccaa cgagaagcgc gatcacatgg tcctgctgga 780

gttcgtgacc gccgccggga tcactctcgg catggacgag ctgtacaagt aaactctaga 840

tcataatcag ccataccaca tttgtag 867

Claims

1. A transgenic method for improving the silk fibroin content in silkworm cocoons is characterized in that a GAL4/UAS system is used for respectively constructing specific overexpression BmDimm and specific knockout BmYki and BmSD in rear silk glands of silkworms, and transgenic silkworms with enlarged rear silk glands are obtained; the silk fibroin content of the silkworms can be improved by specifically knocking out BmYki in the rear silk glands of the silkworms, or can be improved by specifically knocking out BmSD in the rear silk glands of the silkworms, or can be improved by specifically over-expressing BmDimm in the rear silk glands of the silkworms.

2. The transgenic method for increasing silk fibroin content in silkworm cocoon as claimed in claim 1, wherein the method for increasing silk fibroin content of silkworm by specifically knocking out BmYki in posterior silk gland of silkworm comprises the following steps:

step S1, GAL4 expression vector construction;

s2, building a UAS expression vector for knocking out BmYki;

3. The transgenic method for increasing silk fibroin content in silkworm cocoon according to claim 1, characterized in that the method for increasing silk fibroin content of silkworm by specifically knocking out BmSD in the posterior silk gland of silkworm comprises the following steps:

step S1, GAL4 expression vector construction;

s2, building a UAS expression vector for knocking out BmSD;

4. The transgenic method for increasing silk fibroin content in silkworm cocoon according to claim 1, characterized in that the method for increasing silk fibroin content of silkworm by specifically overexpressing BmDimm in the posterior silk gland of silkworm comprises the steps of:

step S1, GAL4 expression vector construction;

step S2, constructing a UAS expression vector for over-expressing BmDimm;

s3, preparing a transgenic silkworm specifically overexpressing BmDimm in PSG;

5. The transgenic method for increasing the content of silk fibroin in silkworm cocoons according to claim 2, wherein GAL4 expression vector is constructed by: GAL4 vector for specific activation expression of silkworm posterior silk gland is constructed, namely GAL4 expression vector using fibroin heavy chain fibH as promoter and GAL4 protein binding domain gene sequence as target gene.

6. The transgenic method for increasing the silk fibroin content of silkworm cocoons according to claim 2, wherein the BmYki-knocked-out UAS expression vector is constructed by: the method comprises the steps of sequentially connecting a plurality of sequences, namely a 10 XUAS sequence, a Cas9 protein sequence optimized according to the preference of silkworm codons, a U6 promoter sequence, two BmYki knockout targets, Ser1-polyA as a termination signal and the like in series to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector framework, namely pBac [3 XP 3-ECFP ] and naming the target gene expression frame as knockout BmYki.

7. The transgenic method for increasing the content of silk fibroin in silkworm cocoons according to claim 2, characterized in that the corresponding HG4 transgenic silkworms and UAS transgenic silkworms are obtained by embryo microinjection and fluorescence screening, and the transgenic silkworms with red fluorescence and green fluorescence in eyes are screened by pairwise crossing the two transgenic silkworms.

8. The transgenic method for increasing the silk fibroin content of silkworm cocoons according to claim 3, wherein the UAS expression vector for knocking out BmSD is constructed by: the method comprises the steps of sequentially connecting a plurality of sequences, namely a 10 XUAS sequence, a Cas9 protein sequence optimized according to the preference of bombyx mori codons, a U6 promoter sequence, two BmSD knock-out targets, Ser1-polyA as a termination signal and the like in series to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector framework, namely pBac [3 XP 3-ECFP ] and naming the target gene expression frame as the knock-out BmSD.

9. The transgenic method for increasing the content of silk fibroin in silkworm cocoon according to claim 7, characterized in that the UAS expression vector for over-expressing BmDimm is constructed: and sequentially connecting a plurality of sequences such as a 10 XUAS sequence, a BmDimm target gene, a Ser1-polyA termination signal and the like in series to form a target gene expression frame, and then inserting the target gene expression frame into a piggyBac vector framework, namely pBac (3 XP 3-ECFP) and naming the expression as overexpression BmDimm.

10. A silkworm variety obtained by a transgenic method for improving the content of silk fibroin in silkworm cocoons is characterized in that a GAL4/UAS system is used for respectively constructing specific overexpression BmDimm and specific knockout of BmYki and BmSD in rear silk glands of silkworms, so that transgenic silkworms with enlarged rear silk glands are obtained, and further, a high-yield silk variety with increased silk output of silkworms is produced.