CN107043782B

CN107043782B - Gene knockout method, sgRNA fragment and application thereof

Info

Publication number: CN107043782B
Application number: CN201710230028.8A
Authority: CN
Inventors: 沈以红; 于新波; 黄先智
Original assignee: Southwest University
Current assignee: Southwest University
Priority date: 2017-04-10
Filing date: 2017-04-10
Publication date: 2020-12-22
Anticipated expiration: 2037-04-10
Also published as: CN107043782A

Abstract

The invention provides a gene knockout method, a sgRNA fragment and application thereof, wherein the gene knockout method comprises the steps of respectively obtaining transgenic organisms expressing Cas9 and sgRNA, and then hybridizing the two transgenic organisms to obtain a co-expression positive individual. The invention simplifies the vector construction technology, improves the injection efficiency, and can continuously edit the target sequence after the fertilization is finished, thereby ensuring the editing efficiency.

Description

Gene knockout method, sgRNA fragment and application thereof

Technical Field

The invention relates to the technical field of gene editing, in particular to a gene knockout method, a sgRNA fragment and application thereof.

Background

The CRISPR/Cas9 gene editing technology is an immune mechanism which is evolved by bacteria and archaea under the long-term selective pressure of phage and can effectively resist the invasion of exogenous DNA and viruses, and is characterized in that DNA is recognized by a section of RNA through base complementary pairing, the cut and recognized exogenous double-stranded DNA of Cas9 endonuclease is guided, homologous recombination or non-homologous end connection is induced, and then the purpose of editing on target DNA is realized. The targeted cleavage properties of the CRISPR-Cas system on DNA molecules make it possible to use it for targeted gene modification. In 2012, the Doudan research group first identified crRNAs: the tracrRNA binary complex is engineered as a single-stranded RNA chimera and directs Cas9 protein cleavage at a specific site. At present, CRISPR-Cas9 has successfully realized genome site-directed modification in organisms such as human cells, mice, zebra fish, drosophila, Arabidopsis thaliana and the like. Although ZFN, and TALEN technologies also have efficient gene editing efficiency, there are unique advantages in CRISPR/Cas9 site-directed gene editing. Firstly, the distribution frequency of the target of CRISPR/Cas9 in a genome is high, almost every 8bp has one target, the distribution frequency of the target of TALEN in the genome is about 1/125bp, and every 500bp of ZFN has one proper target, so that the CRISPR/Cas9 system can screen high-efficiency targets near the point needing mutation more easily. Secondly, CRISPR/Cas9 has more accurate advantage than ZFN and TALEN when introducing site-specific insertion, because the function of Cas9 to cleave two strands of DNA belongs to two functional domains respectively, Cas9 becomes nickase that cleaves only one strand by mutating one of the functional domains, and a repair template is introduced at the same time, thus greatly reducing the probability of random mutation introduced by natural Cas9 to cleave double strands. Therefore, the CRISPR/Cas9 gene editing technology has an inherent advantage in the aspect of researching the functions of genes.

However, the existing gene editing technology has low editing efficiency and complex operation, and needs to be improved urgently.

Disclosure of Invention

In view of the above-mentioned shortcomings of the prior art, the present invention aims to provide a gene knockout method, and sgRNA fragments and applications thereof, for solving the problems of low efficiency of gene editing and the like in the prior art.

In order to achieve the above objects and other related objects, a first aspect of the present invention provides a gene knockout method, comprising obtaining transgenic organisms expressing Cas9 and sgRNA, respectively, and crossing the two transgenic organisms to obtain a co-expression positive individual.

In some embodiments of the invention, the sgRNA contains at least one of the sequences shown as SEQ ID nos. 9, 10.

In some embodiments of the invention, the organism is Bombyx mori, Bombyx mori Linnaeus, a lepidopteran secretase that uses mulberry leaves as a food material, a species of Bombyx mori, a family arthropoda, a family Bombyx; and respectively introducing the Cas9 vector and the sgRNA vector into silkworm embryos to obtain corresponding target transgenic silkworms, and hybridizing the obtained target transgenic silkworms to obtain co-expression positive individuals.

In some embodiments of the invention, a piggyBac recombinant expression vector is used to integrate a Cas9 gene and a sgRNA into a silkworm genome respectively, the piggyBac recombinant expression vector containing a Cas9 gene is obtained by inserting an expression cassette containing a Cas9 gene into a Bgl II enzyme cutting site of a vector pBac [3 xP 3-EGFP ], and the piggyBac recombinant expression vector containing the sgRNA is obtained by inserting an expression cassette containing the sgRNA into a Bgl II enzyme cutting site of a vector pBac [3 xP 3-DsRed ].

In some embodiments of the invention, the method comprises the steps of inserting an expression cassette IE1-Cas9-SV40 into a final vector pBac [3 XP 3-EGFP ], obtaining a recombinant expression vector pBac [3 XP 3-EGFP + IE1-Cas9-SV40], mixing the recombinant expression vector with an auxiliary plasmid, injecting a mixed solution into eggs of silkworm moths, hatching to obtain G0 generation silkworm moths, forming silkworm feathers into silkworm moth backcross or selfing to obtain G1 generation silkworm loops, taking positive transgenic silkworms in the G1 generation silkworm loops, culturing the silkworms to feathering, and self-selecting to obtain transgenic silkworms expressing the protein of Cas 9; the method comprises the steps of inoculating an endogenous gene sequence into a silkworm endogenous U6 promoter, connecting a sgRNA sequence to a U6 promoter to obtain a U6-sgRNA expression cassette, inserting the U6-sgRNA expression cassette into a vector pBac [3 XP 3-DsRed ] to obtain a recombinant expression vector, mixing the recombinant expression vector with an auxiliary plasmid, injecting a mixed solution into eggs of silkworm moths, incubating to obtain G0 generation silkworm, forming silkworm feathers into silkworm moths for backcrossing or selfing to obtain a G1 generation moth ring, taking a positive transgenic silkworm in the G1 generation moth ring, culturing until eclosion, and self-selecting to obtain the transgenic silkworm expressing the sgRNA; and hybridizing the transgenic silkworm expressing the Cas9 protein with the transgenic silkworm expressing the sgRNA to obtain a co-expression positive individual.

The second aspect of the invention provides a sgRNA fragment containing at least one of the sequences shown as SEQ ID No.9 and SEQ ID No. 10.

In a third aspect, the invention provides a recombinant vector, a gene expression cassette, a transgenic cell line, or a transgenic individual containing the sgRNA fragment.

The invention provides a CRISPR/Cas9 vector containing the sgRNA fragment, which comprises a Cas9 expression vector and an expression vector containing the sgRNA fragment, wherein the vector can be a Cas9 protein expression vector based on piggyBac transposition vector.

In some embodiments of the invention, the promoter of the Cas9 expression vector is selected from the BmNPV very early promoter IE 1.

In some embodiments of the invention, the promoter of the sgRNA expression vector is selected from the U6 promoter.

In some embodiments of the invention, the Cas9 expression vector uses a green fluorescent protein promoted by an eye and nerve specific promoter 3 × P3 as an expression cassette, the green fluorescent protein is used as a screening marker, and the screening marker contains an IE1 promoter promoting Cas9 gene expression; the sgRNA expression vector takes red fluorescent protein started by a promoter 3 XP 3 specific to eyes and nerves as an expression cassette, the red fluorescent protein as a screening marker, and the screening marker contains a U6 promoter for starting sgRNA gene expression.

In some embodiments of the invention, the Cas9 expression vector uses an enhanced green fluorescent protein EGFP promoted by an eye and nerve specific promoter 3 × P3 as an expression cassette, the enhanced green fluorescent protein as a screening marker, and the screening marker contains an IE1 promoter promoting Cas9 gene expression.

In some embodiments of the invention, the sgRNA expression vector contains a red fluorescent protein activated by an eye and nerve specific promoter 3 × P3 as an expression cassette, the red fluorescent protein serves as a selection marker, and the selection marker contains a U6 promoter that activates sgRNA gene expression.

The fifth aspect of the invention provides an application of the sgRNA fragment and the CRISPR/Cas9 vector thereof in gene knock-out.

As described above, the gene knockout method, the sgRNA fragment thereof and the application thereof of the present invention have the following beneficial effects: the invention simplifies the vector construction technology, improves the injection efficiency, and can continuously edit the target sequence after the fertilization is finished, thereby ensuring the editing efficiency.

Drawings

FIG. 1 shows a schematic diagram of expression vector pBac [3 XP 3-EGFP + IE1-Cas9-SV40 ].

FIG. 2 shows a schematic diagram of an expression vector pBac [3 XP 3-DsRed + U6-sgRNA ].

FIG. 3 shows fluorescence maps of transgenic silkworm strains expressing Cas9 obtained as expression vector pBac [3 XP 3-EGFP + IE1-Cas9-SV40] at each stage.

FIG. 4 shows fluorescence maps of sgRNA-expressing transgenic silkworm lines obtained from expression vector pBac [3 XP 3-DsRed + U6-BmDES3sgRNA1] at various stages.

Figure 5 shows a protein expression diagram of a transgenic silkworm strain Cas9 expressing Cas 9.

Figure 6a shows a map of Cas9 expression line versus sgRNA1 expression line, with Cas9 expression level detected at the transcriptional level and U6-sgRNA1 detection at the genomic level.

Figure 6b shows a map of Cas9 expression line versus sgRNA2 expression line, with Cas9 expression level detected at the transcriptional level and U6-sgRNA2 detection at the genomic level.

FIG. 7 shows a schematic diagram of gene editing of BmDES3 gene target 1.

FIG. 8 shows a schematic diagram of gene editing of BmDES3 gene target 2.

Detailed Description

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

The Piggy Bac transposon is a transposon discovered in Trichoplusia ni, and the exogenous gene insertion mediated by the Piggy Bac transposition system can identify TTAA sites on a genome and carry the exogenous gene insertion, can be stably inherited and is widely applied to transgenic research of multiple species. In silkworms, the piggyBac transposon mediated foreign gene insertion technology is widely used for the study of gene function.

Example one

Construction of a Cas9 expression vector pBac [3 XP 3-EGFP + IE1-Cas9-SV40] based on piggyBac transposition vector.

Cas9 gene is from vector pHsp70-Cas9 (available from ADDGENE, website: www.addgene.org /), and Cas9 gene sequence is shown in SEQ ID No. 1.

The Cas9 gene is inserted into the multiple cloning site of a starting vector pSL1180 to obtain an intermediate vector, and then a complete expression cassette IE1-Cas9-SV40 containing the Cas9 gene is inserted into a final vector pBac [3 xP 3-EGFP ] to obtain a recombinant expression vector.

The specific operation method comprises the following steps:

step S1, preparation of vector pSL1180[ Cas9-SV40]

The Cas9 gene is subjected to ClaI/XbaI restriction endonuclease double digestion of a vector pHsp70-Cas9, a Cas9 gene fragment is obtained by recovery (the recovery operation is carried out according to the instructions of a TAKARA gel recovery (small amount) kit), and the recovered fragment is connected with the pSL1180[ SV40] vector skeleton fragment subjected to the same digestion according to the instructions of TAKARA DNA ligation kit Ver2.1, so that pSL1180[ Cas9-SV40] is obtained.

Step S2, preparing IE1 promoter sequence

PCR in vitro amplification, namely amplifying an IE1 promoter sequence from a BmNPV genome, adding HindIII restriction enzyme restriction sites and ClaI restriction enzyme restriction sites on the upstream and downstream of an amplified fragment respectively, cloning to a vector pMD19-T through T-A to obtain a plasmid, carrying out double digestion on the obtained pMD19-T vector plasmid by using HindIII restriction enzyme and ClaI restriction enzyme, recovering an IE1 promoter sequence (the recovery operation is carried out according to the use instruction of a TAKARA gel recovery (small amount) kit), wherein the sequence of the promoter IE1 is shown as SEQ ID No. 2.

The required PCR reaction procedure was: pre-denaturation at 94 ℃ for 4min, denaturation at 94 ℃ for 40s, annealing at 55 ℃ for 40s, extension at 72 ℃ for 40s, and returning to the step (c) for 30 cycles, final extension at 72 ℃ for 10min, and Forever at 12 ℃.

The PCR amplification upstream primer and the PCR amplification downstream primer are respectively shown as SEQ ID No.3 and SEQ ID No. 4:

IE1-F(SEQ ID No.3)：5’-CGAAGCTTTTGCAGTTCGGGACATAAATG-3’

IE1-R(SEQ ID No.4)：5’–CGATCGATTAGATCCCTAGTCGTTTGGT-3’

step S3, preparing an intermediate vector pSL1180[ IE1-Cas9-SV40]

The vector pSL1180[ Cas9-SV40] obtained in step S1 was digested with HindIII restriction enzyme and ClaI restriction enzyme, the vector backbone was recovered (the recovery was performed according to the instructions of TAKARA gel recovery kit (small amount)), and the vector backbone was ligated with the IE1 promoter sequence obtained in step S2 according to the instructions of TAKARA DNA ligation kit Ver2.1 to obtain an intermediate vector pSL1180[ IE1-Cas9-SV40 ].

Step S4, preparing expression cassette fragment IE1-Cas9-SV40

Through single restriction enzyme digestion of pSL1180[ IE1-Cas9-SV40] by AscI restriction enzyme, the cohesive end is recovered and filled according to the requirements of the kit, and the expression cassette fragment IE1-Cas9-SV40 is prepared.

Step S5, preparing a carrier skeleton

Vector backbone was recovered and dephosphorylated by BglII restriction endonuclease single digestion of vector pBac [3 XP 3-EGFP ] (see references: TomitaM, MunetsunaH, Satot, et al, transgenic single work product recombinant human type III procollagenin conjugates, NatBiotechnol,2003,21: 52-56.) according to TAKARA gel recovery (small amount) kit instructions to obtain vector backbone fragments.

Step S6, preparing a target vector pBac [3 XP 3-EGFP + IE1-Cas9-SV40]

And (3) connecting the expression cassette fragment IE1-OmElo-SV40 prepared in the step S4 with the pBac [3 xP 3-EGFP ] vector skeleton fragment prepared in the step S5 according to TAKARA DNA ligation kit Ver2.1 instructions to obtain a target vector pBac [3 xP 3-EGFP + IE1-Cas9-SV40 ].

The transgenic recombinant vector constructed in the embodiment uses an expression cassette of Enhanced Green Fluorescent Protein (EGFP) started by an eye and nerve specific promoter 3 xP 3, the enhanced green fluorescent protein is used as a screening marker, and then contains an IE1 promoter to start the expression of an optimized Cas9 gene.

Example two

And breeding the transgenic silkworm of the Cas9 gene.

The commercial diversification silkworm strain 305 is used as a raw material, parent silkworm eggs are raised by normal mulberry leaves, and moths are mated and spawned.

The recombinant vector plasmid pBac [3 XP 3-EGFP + IE1-Cas9-SV40] prepared in the first example with the concentration of 10 nL-15 nL of 400 ng/mu L is mixed with the helper plasmid pHA3 PIG. The mixed solution is respectively injected into the silkworm eggs laid by 400 female moths of the silkworm strain 305 for 2 to 6 hours, sealed by using non-toxic glue and then placed in an environment with the temperature of 25 ℃ and the relative humidity of 85 percent for hatching. 156 heads of G0 generation silkworm larvae are obtained from pBac (3 xP 3-EGFP + IE1-Cas9-SV 40) after hatching.

The obtained silkworm is bred with mulberry leaves until emergence to form moths, and the obtained silkworm moths are backcrossed or selfed to obtain 37 moth rings injected with pBac [3 XP 3-EGFP + IE1-Cas9-SV40] plasmids.

Moth ring G1 generation silkworm egg, use

Observing and screening by an electric macroscopic fluorescence microscope to obtain 6 moth rings with green fluorescence on eyes, wherein the conversion efficiency is 16.22%.

The obtained positive transgenic silkworm is fed to eclosion and then is subjected to self-selection and purification, and the silkworm transgenic line which can be stably inherited and can express the Cas9 protein in the whole tissue of the silkworm in the whole period, namely the IE1-Cas9-SV40 transgenic silkworm line is obtained.

EXAMPLE III

In this embodiment, a silkworm endogenous fatty acid desaturase gene BmDES3 is taken as an example, and the gene is a member of a silkworm fatty acid desaturase gene family, and it should be noted that the knockout method of the present invention is applicable to multiple knockout of any single endogenous gene with a specific suitable target or a gene family with a similar structural domain. The gene sequence of BmDES3 is shown in SEQ ID No. 5.

Constructing a targeting vector of the silkworm endogenous fatty acid desaturase gene BmDES 3.

The designed BmDES3 specific target sequence is connected with a domestic silkworm endogenous U6 promoter, then is connected with sgRNA, and then a sgRNA expression cassette containing a complete target sequence is inserted into a final vector pBac [3 xP 3-DsRed ] to obtain a recombinant expression vector.

The specific operation method comprises the following steps:

step S1, preparing U6 promoter sequence

PCR in vitro amplification, namely amplifying a U6 promoter sequence from a silkworm DZ strain genome, and cloning the amplified sequence to a vector pMD19-T through T-A to obtain a plasmid pMD 19-T-U6.

The PCR amplification upstream and downstream primers are respectively shown as SEQ ID No.7 and SEQ ID No. 8:

U6-F(SEQ ID No.7)：5’-AGGTTATGTAGTACACAT-3’

U6-R(SEQ ID No.8)：5’-ACTTGTAGAGCACGATAT-3’

the sequence of the U6 promoter is shown in SEQ ID No. 6.

Step S2, screening the sgRNA target point sequence of BmDES3

Predicting the sgRNA sequence of the silkworm endogenous desaturase gene BmDes3 according to a CRISPRC online analysis tool (http:// crispr. dbcls. jp /), analyzing the off-target efficiency of a target sequence in silkworms according to software, and finally selecting the efficiently edited sgRNA sequences with the sequences of SEQ ID No.9 and SEQ ID No. 10.

Target1(SEQ ID No.9)：GGCTTATGGCGAGTGCATAA

Target2(SEQ ID No.10)：GCGTAACTCGGGATATGTTT

It should be noted that the sgRNA sequence selected in this embodiment is two sequences with the best specificity screened by performing blast comparison with a silkworm genome sequence, so as to facilitate subsequent knockout experiments, and certainly, other selections exist for the sgRNA sequence.

Step S3, preparing sgRNA expression cassette

Taking U6-BmDES3-F (SEQ ID No.11) and U6-BmDES3-R11(SEQ ID No.12) as primers, and taking plasmid pMD19-T-U6 as a template to carry out in-vitro amplification to obtain an amplification product; diluting the obtained amplification product by 50 times to be used as a template, and performing in-vitro amplification by using a primer U6-BmDES3-F (SEQ ID No.11) and a primer U6-BmDES3-R2(SEQ ID No.13) to obtain an amplification product; diluting the obtained amplification product by 50 times to be used as a template, and carrying out in vitro amplification by using a primer U6-BmDES3-F (SEQ ID No.11) and a primer U6-BmDES3-R3(SEQ ID No.14) for the third time to obtain the amplification product. The amplification product was recovered according to TAKARA gel recovery (miniprep) kit instructions and the product was recovered by double digestion with NcoI and EcoRI and filled and dephosphorylated. Obtaining an expression cassette U6-BmDES3sgRNA1 for expressing BmDES3 gene Target1 sgRNA.

Similarly, a primer U6-BmDES3-F (SEQ ID No.11) and a primer U6-BmDES3-R21(SEQ ID No.15) are used for in vitro amplification by taking a plasmid pMD19-T-U6 as a template to obtain an amplification product; diluting the obtained amplification product by 50 times to be used as a template, and performing in vitro amplification by using a primer U6-BmDES3-F (SEQ ID No.11) and a primer U6-BmDES3-R2(SEQ ID No.13) to obtain an amplification product; diluting the obtained amplification product by 50 times to be used as a template, and carrying out in vitro amplification by using a primer U6-BmDES3-F (SEQ ID No.11) and a primer U6-BmDES3-R3(SEQ ID No.14) for the third time to obtain the amplification product. The amplification product was recovered according to TAKARA gel recovery (miniprep) kit instructions and the product was recovered by double digestion with NcoI and EcoRI and filled and dephosphorylated. Obtaining an expression cassette U6-BmDES3sgRNA2 for expressing BmDES3 gene Target2 sgRNA.

The required PCR reaction procedures were: pre-denaturation at 94 ℃ for 4min, denaturation at 94 ℃ for 40s, annealing at 60 ℃ for 40s, extension at 72 ℃ for 40s, and returning to the step (c) for 30 cycles, final extension at 72 ℃ for 10min, and Forever at 12 ℃.

U6-BmDES3-F(SEQ ID No.11)：5’-GCGAATTCAGGTTATGTAGTACACATT-3’

U6-BmDES3-R11(SEQ ID No.12)：

5’-TATTTCTAGCTCTAAAACTTATGCACTCGCCATAAGCCACTTGTAGAGCACGAT ATT-3’

U6-BmDES3-R2(SEQ ID No.13)：

5’-CAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACA-3’

U6-BmDES3-R3(SEQ ID No.14)：

5’-GCCATGGAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTA G-3’

U6-BmDES3-R21(SEQ ID No.15)：

5’-TATTTCTAGCTCTAAAACAAACATATCCCGAGTTACGCACTTGTAGAGCACGAT ATT-3’

Step S4, preparing a carrier skeleton

The vector pBac [3 XP 3-DsRed ] is subjected to single enzyme digestion by BglII restriction enzyme according to the instructions of a TAKARA gel recovery (small amount) kit to recover the vector skeleton and fill up and remove the phosphorylation, so as to obtain the vector skeleton fragment.

Step S5, preparing target vectors pBac [3 XP 3-DsRed + U6-BmDES3sgRNA1] and pBac [3 XP 3-DsRed + U6-BmDES3sgRNA2]

The expression cassette fragments U6-BmDES3sgRNA1 and U6-BmDES3sgRNA2 prepared in the step S3 are respectively connected with the pBac [3 xP 3-DsDed ] vector skeleton fragment prepared in the step S5 according to the TAKARA DNA ligation kit Ver2.1 instructions to obtain target vectors pBac [3 xP 3-DsRed + U6-BmDES3sgRNA1] and pBac [3 xP 3-DsRed + U6-BmDES3sgRNA2 ].

The transgenic recombinant vector constructed in this example uses an expression cassette of red fluorescent protein (DsDed) started by eye and nerve specific promoter 3 XP 3, the red fluorescent protein is used as a screening marker, and then contains an expression cassette of sgRNA started by U6 promoter.

Example four

And breeding transgenic silkworm strains of sgRNA1 and sgRNA2 expressing silkworm endogenous gene BmDES 3.

The commercial multivariable silkworm strain 305 is used as an initial material, and parent silkworm eggs are raised through normal mulberry leaves until eclosion, mating and spawning.

The recombinant vectors pBac [3 XP 3-DsRed + U6-BmDES3sgRNA1] and pBac [3 XP 3-DsRed + U6-BmDES3sgRNA2] prepared in the third example and having a concentration of 10 nL-15 nL of 400 ng/uL were mixed with the helper plasmid pHA3PIG, respectively. The mixed solution is respectively injected into the silkworm eggs laid by 400 female moths of the silkworm strain 305 for 2 to 6 hours, sealed by using non-toxic glue and then placed in an environment with the temperature of 25 ℃ and the relative humidity of 85 percent for hatching. After incubation, 79 heads of G0 generation silkworms injected with pBac [3 XP 3-DsRed + U6-BmDES3sgRNA1] plasmid and 93 heads of G0 generation silkworms injected with pBac [3 XP 3-DsRed + U6-BmDES3sgRNA2] plasmid were obtained.

The obtained silkworm is bred with mulberry leaf until emergence to form moth, and the silkworm moth is backcrossed or selfed. 24 moth rings were obtained from pBac [3 XP 3-DsRed + U6-BmDES3sgRNA1], and 31 moth rings were obtained from pBac [3 XP 3-DsRed + U6-BmDES3sgRNA2 ].

Moth ring G1 generation silkworm egg, use

Observed by an electric macroscopic fluorescence microscope, and screened by pBac (3 XP 3-DsRed + U6-BmDES3sgRNA1]9 moth rings with red fluorescence on eyes are obtained, and the conversion efficiency is37.5％，pBac[3×P3-DsRed+U6-BmDES3sgRNA2]13 moth rings with red fluorescence on eyes are obtained, and the transformation efficiency is 41.94%.

The obtained positive transgenic silkworm is bred to eclosion into a moth and further self-crossed and purified to obtain transgenic silkworm strains which can express sgRNA1 and sgRNA2 of silkworm endogenous genes BmDES3 in the stably inherited silkworm, namely a U6-BmDES3sgRNA1 transgenic silkworm line and a U6-BmDES3sgRNA2 transgenic silkworm line.

FIG. 4 shows fluorescence maps of sgRNA-expressing transgenic silkworm lines obtained from expression vector pBac [3 XP 3-DsRed + U6-BmDES3sgRNA1] at various stages. The fluorescence patterns of the transgenic silkworm strains obtained by the expression vector pBac [3 XP 3-DsRed + U6-BmDES3sgRNA2] at each period are similar to those in figure 4.

Test example 1

The IE1-Cas9-SV40 transgenic silkworm line obtained in the second example and the U6-BmDES3sgRNA1 transgenic silkworm line obtained in the fourth example were hybridized, and the silkworm eggs were used

Observing with an electric macroscopic fluorescence microscope, screening silkworm eggs with red fluorescence and green fluorescence on eyes, and feeding the silkworm eggs with fresh mulberry leaves to the age of 4 years. Randomly selecting 5 individuals, respectively extracting genomes, amplifying by using specific primers and sequencing, wherein deletions with different base numbers are formed near the targeting site 1 (20 bp in front of the PAM motif) of all the individuals, the size of the deletions is between 2 and 14 bases, and the sequences are shown in figure 7.

Test example two

The IE1-Cas9-SV40 transgenic silkworm line obtained in the second example and the U6-BmDES3sgRNA2 transgenic silkworm line obtained in the fourth example were hybridized, and the silkworm eggs were used

Observing with an electric macroscopic fluorescence microscope, screening silkworm eggs with red fluorescence and green fluorescence on eyes, and feeding the silkworm eggs with fresh mulberry leaves to the age of 4 years. Randomly selecting 5 individuals, respectively extracting genomes, amplifying by using specific primers and sequencing, wherein deletions with different base numbers are formed near all individual targeting sites 2 (20 bp in front of PAM motif), the size is 1 to 9 bases, one individual has base substitution, and the sequence is shown in figure 8.

In the embodiment, the CRISPR/Cas9 genome site-directed editing technology is combined with the piggyBac transposon mediated gene insertion technology, namely, stable transgenic silkworm gene lines of Cas9 and sgRNA are obtained respectively, and then silkworm individuals expressing Cas9 and sgRNA simultaneously are obtained in a hybridization mode, so that the target gene knockout efficiency can be effectively improved. Compared with the prior expression vector technology for directly injecting sgRNA mixed and purified Cas9 protein and mRNA or transcribing the protein and mRNA into Cas9mRNA, the method simplifies the vector construction technology, improves the injection efficiency, and can continuously edit the target sequence after fertilization is finished, thereby ensuring the editing efficiency.

In conclusion, the invention provides an efficient and stable Cas 9-mediated target gene editing method. The transgenic silkworm lines which independently express the Cas9 protein and the sgRNA are obtained firstly, and then the Cas9 mediated target gene editing is carried out more efficiently in a hybridization mode, so that the problem that the efficiency of directly screening positive individuals is low after the existing expression vector is injected is solved, the target gene knockout efficiency in co-expression positive individuals reaches 100%, and therefore the transgenic silkworm lines can better serve for gene function research and play an important role in gene engineering breeding.

The invention is applicable to a wide range of species, and each species is found to have a U6 promoter corresponding to the species, can be used for constructing a pBac [3 xP 3-DsRed + U6-sgRNA ] expression vector and has the potential of being applicable to all species.

The foregoing embodiments are merely illustrative of the principles and utilities of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.

SEQUENCE LISTING

<110> university of southwest

<120> gene knockout method, sgRNA fragment and application thereof

<130> 2017

<160> 15

<170> PatentIn version 3.5

<210> 1

<211> 4272

<212> DNA

<213> Artificial

<220>

<223> Cas9

<400> 1

atggactata aggaccacga cggagactac aaggatcatg atattgatta caaagacgat 60

gacgataaga tggccccaaa gaagaagcgg aaggtcggta tccacggagt cccagcagcc 120

gacaagaagt acagcatcgg cctggacatc ggcaccaact ctgtgggctg ggccgtgatc 180

accgacgagt acaaggtgcc cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac 240

agcatcaaga agaacctgat cggagccctg ctgttcgaca gcggcgaaac agccgaggcc 300

acccggctga agagaaccgc cagaagaaga tacaccagac ggaagaaccg gatctgctat 360

ctgcaagaga tcttcagcaa cgagatggcc aaggtggacg acagcttctt ccacagactg 420

gaagagtcct tcctggtgga agaggataag aagcacgagc ggcaccccat cttcggcaac 480

atcgtggacg aggtggccta ccacgagaag taccccacca tctaccacct gagaaagaaa 540

ctggtggaca gcaccgacaa ggccgacctg cggctgatct atctggccct ggcccacatg 600

atcaagttcc ggggccactt cctgatcgag ggcgacctga accccgacaa cagcgacgtg 660

gacaagctgt tcatccagct ggtgcagacc tacaaccagc tgttcgagga aaaccccatc 720

aacgccagcg gcgtggacgc caaggccatc ctgtctgcca gactgagcaa gagcagacgg 780

ctggaaaatc tgatcgccca gctgcccggc gagaagaaga atggcctgtt cggaaacctg 840

attgccctga gcctgggcct gacccccaac ttcaagagca acttcgacct ggccgaggat 900

gccaaactgc agctgagcaa ggacacctac gacgacgacc tggacaacct gctggcccag 960

atcggcgacc agtacgccga cctgtttctg gccgccaaga acctgtccga cgccatcctg 1020

ctgagcgaca tcctgagagt gaacaccgag atcaccaagg cccccctgag cgcctctatg 1080

atcaagagat acgacgagca ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag 1140

cagctgcctg agaagtacaa agagattttc ttcgaccaga gcaagaacgg ctacgccggc 1200

tacattgacg gcggagccag ccaggaagag ttctacaagt tcatcaagcc catcctggaa 1260

aagatggacg gcaccgagga actgctcgtg aagctgaaca gagaggacct gctgcggaag 1320

cagcggacct tcgacaacgg cagcatcccc caccagatcc acctgggaga gctgcacgcc 1380

attctgcggc ggcaggaaga tttttaccca ttcctgaagg acaaccggga aaagatcgag 1440

aagatcctga ccttccgcat cccctactac gtgggccctc tggccagggg aaacagcaga 1500

ttcgcctgga tgaccagaaa gagcgaggaa accatcaccc cctggaactt cgaggaagtg 1560

gtggacaagg gcgcttccgc ccagagcttc atcgagcgga tgaccaactt cgataagaac 1620

ctgcccaacg agaaggtgct gcccaagcac agcctgctgt acgagtactt caccgtgtat 1680

aacgagctga ccaaagtgaa atacgtgacc gagggaatga gaaagcccgc cttcctgagc 1740

ggcgagcaga aaaaggccat cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg 1800

aagcagctga aagaggacta cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc 1860

ggcgtggaag atcggttcaa cgcctccctg ggcacatacc acgatctgct gaaaattatc 1920

aaggacaagg acttcctgga caatgaggaa aacgaggaca ttctggaaga tatcgtgctg 1980

accctgacac tgtttgagga cagagagatg atcgaggaac ggctgaaaac ctatgcccac 2040

ctgttcgacg acaaagtgat gaagcagctg aagcggcgga gatacaccgg ctggggcagg 2100

ctgagccgga agctgatcaa cggcatccgg gacaagcagt ccggcaagac aatcctggat 2160

ttcctgaagt ccgacggctt cgccaacaga aacttcatgc agctgatcca cgacgacagc 2220

ctgaccttta aagaggacat ccagaaagcc caggtgtccg gccagggcga tagcctgcac 2280

gagcacattg ccaatctggc cggcagcccc gccattaaga agggcatcct gcagacagtg 2340

aaggtggtgg acgagctcgt gaaagtgatg ggccggcaca agcccgagaa catcgtgatc 2400

gaaatggcca gagagaacca gaccacccag aagggacaga agaacagccg cgagagaatg 2460

aagcggatcg aagagggcat caaagagctg ggcagccaga tcctgaaaga acaccccgtg 2520

gaaaacaccc agctgcagaa cgagaagctg tacctgtact acctgcagaa tgggcgggat 2580

atgtacgtgg accaggaact ggacatcaac cggctgtccg actacgatgt ggaccatatc 2640

gtgcctcaga gctttctgaa ggacgactcc atcgacaaca aggtgctgac cagaagcgac 2700

aagaaccggg gcaagagcga caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac 2760

tactggcggc agctgctgaa cgccaagctg attacccaga gaaagttcga caatctgacc 2820

aaggccgaga gaggcggcct gagcgaactg gataaggccg gcttcatcaa gagacagctg 2880

gtggaaaccc ggcagatcac aaagcacgtg gcacagatcc tggactcccg gatgaacact 2940

aagtacgacg agaatgacaa gctgatccgg gaagtgaaag tgatcaccct gaagtccaag 3000

ctggtgtccg atttccggaa ggatttccag ttttacaaag tgcgcgagat caacaactac 3060

caccacgccc acgacgccta cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac 3120

cctaagctgg aaagcgagtt cgtgtacggc gactacaagg tgtacgacgt gcggaagatg 3180

atcgccaaga gcgagcagga aatcggcaag gctaccgcca agtacttctt ctacagcaac 3240

atcatgaact ttttcaagac cgagattacc ctggccaacg gcgagatccg gaagcggcct 3300

ctgatcgaga caaacggcga aaccggggag atcgtgtggg ataagggccg ggattttgcc 3360

accgtgcgga aagtgctgag catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag 3420

acaggcggct tcagcaaaga gtctatcctg cccaagagga acagcgataa gctgatcgcc 3480

agaaagaagg actgggaccc taagaagtac ggcggcttcg acagccccac cgtggcctat 3540

tctgtgctgg tggtggccaa agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa 3600

gagctgctgg ggatcaccat catggaaaga agcagcttcg agaagaatcc catcgacttt 3660

ctggaagcca agggctacaa agaagtgaaa aaggacctga tcatcaagct gcctaagtac 3720

tccctgttcg agctggaaaa cggccggaag agaatgctgg cctctgccgg cgaactgcag 3780

aagggaaacg aactggccct gccctccaaa tatgtgaact tcctgtacct ggccagccac 3840

tatgagaagc tgaagggctc ccccgaggat aatgagcaga aacagctgtt tgtggaacag 3900

cacaagcact acctggacga gatcatcgag cagatcagcg agttctccaa gagagtgatc 3960

ctggccgacg ctaatctgga caaagtgctg tccgcctaca acaagcaccg ggataagccc 4020

atcagagagc aggccgagaa tatcatccac ctgtttaccc tgaccaatct gggagcccct 4080

gccgccttca agtactttga caccaccatc gaccggaaga ggtacaccag caccaaagag 4140

gtgctggacg ccaccctgat ccaccagagc atcaccggcc tgtacgagac acggatcgac 4200

ctgtctcagc tgggaggcga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 4260

aagaaaaagt aa 4272

<210> 2

<211> 638

<212> DNA

<213> Artificial

<220>

<223> IE1 promoter

<400> 2

ttgcagttcg ggacataaat gtttaaatat atcaatgtct ttgtgatgcg cgcgacattt 60

ttgtaagtta ttaataaaat gcaccgacac gttgcccgac attatcatta aatccttggc 120

gtagaatttg tcgggtccgt tgtccgtgtg cgctagcatg cccgtaacgg accttgagct 180

tttggcttca aaggttttgc gcacagacaa aatgtgccac acttgcagct ctgcttgtgt 240

acgcgttacc acaaatccca acggcgcagt gtacttgtta tatgtaaata aatctcgata 300

aaggcgcggc gcgcgaatgc agctgatcac gtacgctcct cgtgttccgt tcaaggacgg 360

tgttatcgac ctcagattaa tatttatcgg ccgactgttt tcgtatccgc tcaccaaacg 420

ggtttttgca ttaacattgt atgtcggcgg atgttctgta tctaatttga ataaataaat 480

gataaccgca ttggttttag agggcataat aaaaaaaata ttattatcgt gttcgccatt 540

ggggcagtat aaattgacgt tcatgttgaa tattgtttca gttgcaagtt gacattggcg 600

gcgacacgat cgtgaacaac caaacgacta gggatcta 638

<210> 3

<211> 29

<212> DNA

<213> Artificial

<220>

<223> IE1-F

<400> 3

cgaagctttt gcagttcggg acataaatg 29

<210> 4

<211> 28

<212> DNA

<213> Artificial

<220>

<223> IE1-R

<400> 4

cgatcgatta gatccctagt cgtttggt 28

<210> 5

<211> 1359

<212> DNA

<213> Artificial

<220>

<223> BmDES3

<400> 5

atggcgccta aaaatgttga atatattgaa atagctcatc gaagagcagc agaaaagaaa 60

actcatgtca gttttcctca actcaaatac ccctcgctaa gggacgaagg gttaagagac 120

ccggtacaat ggttaatcgg gaaatccatg gacgacggag cagaaggctt atggcgagtg 180

cataatggga tttacaattt caatgatttc ctcgagaagc atcccggtgg ggcggagtgg 240

ttggagctct ctaagggtac cgatatcaca gaagccttcg aaagtcatca cctcaattcg 300

tctgtgaata aagttctcga gaaatattac gttagggaag ctaaaacacc taggaattcg 360

ccttttactt ttgaagatga tggattctac cgcacattga aaagagcggt cgttgaagaa 420

ttaaaaaaag ttcctaaaca tatcccgagt tacgctgata tgatcatcga tggtctcttc 480

gcgactttgc tcatatcttc agcggtttca tgttgggcca acgattattg ggtggtaatg 540

tcagcgtatt tgatcgcctc gttgagtttg gcatgggtca cagttgccgc tcacaattac 600

atccacagga aaactaattg gagaatgtac ttgttcaatt tgagtttgtg gtcttatagg 660

gatttcagag tatcacacgc cctttctcac catctttatc cgaacaccct tatggattta 720

gaagttagcg gatttgagcc tttagtgatt tggaatccga ggaaaaagcc ggtacatgcc 780

aaatttgctt ttttgattga acagattaca ttcccgtttc tgttcgtttt aaatttcctg 840

aagcggttaa ttttaaattt cctacgcgaa ggattcttca ccgagcacta ccgttggcat 900

gatggtgtag ggttcacttt acctgtctgg atgtggctcg tgagcggttg cagtttctac 960

gaagcagcgg tgatgtggtt gtggattgtg tgcaccgcga gctacatatt ctttagcatc 1020

ggatcgaatg ctgctcacca ccatcctgac atctttaagg acggtgacca agttagggac 1080

gttacacctg actggggtat gcacgaactg gaggctgtga tggatcgcac cgacattaat 1140

ggaaaccttt tcaaggtgat gacgtttttc ggagaccacg cccttcatca tctgttcccg 1200

acattggatc acgccgtgtt accctatctg tatccagttt tcttagattt atgtcagaag 1260

tatcgcgcca attttagaat gacatcgtca ttggatttgt ttataggaca gattaagatg 1320

acgcttaaga cggaacctaa tatattagat aataactaa 1359

<210> 6

<211> 467

<212> DNA

<213> Artificial

<220>

<223> U6 promoter

<400> 6

aggttatgta gtacacattg ttgtaaatca ctgaattgtt ttagatgatt ttaacaatta 60

gtacttatta atattaaata agtacatacc ttgagaattt aaaaatcgtc aactataagc 120

catacgaatt taagcttggt acttggctta tagataagga cagaataaga attgttaacg 180

tgtaagacaa ggtcagatag tcatagtgat tttgtcaaag taataacaga tggcgctgta 240

caaaccataa ctgttttcat ttgtttttat ggattttatt acaaattcta aaggttttat 300

tgttattatt taatttcgtt ttaattatat tatatatctt taatagaata tgttaagagt 360

ttttgctctt tttgaataat ctttgtaaag tcgagtgttg ttgtaaatca cgctttcaat 420

agtttagttt ttttaggtat atatacaaaa tatcgtgctc tacaagt 467

<210> 7

<211> 18

<212> DNA

<213> Artificial

<220>

<223> U6-F

<400> 7

aggttatgta gtacacat 18

<210> 8

<211> 18

<212> DNA

<213> Artificial

<220>

<223> U6-R

<400> 8

acttgtagag cacgatat 18

<210> 9

<211> 20

<212> DNA

<213> Artificial

<220>

<223> Target1

<400> 9

ggcttatggc gagtgcataa 20

<210> 10

<211> 20

<212> DNA

<213> Artificial

<220>

<223> Target2

<400> 10

gcgtaactcg ggatatgttt 20

<210> 11

<211> 27

<212> DNA

<213> Artificial

<220>

<223> U6-BmDES3-F

<400> 11

gcgaattcag gttatgtagt acacatt 27

<210> 12

<211> 57

<212> DNA

<213> Artificial

<220>

<223> U6-BmDES3-R11

<400> 12

tatttctagc tctaaaactt atgcactcgc cataagccac ttgtagagca cgatatt 57

<210> 13

<211> 54

<212> DNA

<213> Artificial

<220>

<223> U6-BmDES3-R2

<400> 13

caagttgata acggactagc cttattttaa cttgctattt ctagctctaa aaca 54

<210> 14

<211> 55

<212> DNA

<213> Artificial

<220>

<223> U6-BmDES3-R3

<400> 14

gccatggaaa aaagcaccga ctcggtgcca ctttttcaag ttgataacgg actag 55

<210> 15

<211> 57

<212> DNA

<213> Artificial

<220>

<223> U6-BmDES3-R21

<400> 15

tatttctagc tctaaaacaa acatatcccg agttacgcac ttgtagagca cgatatt 57

Claims

1. A method of gene knock-out comprising: inserting a Cas9 gene into a multiple cloning site of a starting vector pSL1180 to obtain an intermediate vector, then inserting a complete expression cassette IE1-Cas9-SV40 containing a Cas9 gene into a final vector pBac [3 xP 3-EGFP ], obtaining a recombinant expression vector pBac [3 xP 3-EGFP + IE1-Cas9-SV40], mixing the recombinant expression vector with an auxiliary plasmid, injecting a mixed solution into eggs of silkworm moths, hatching to obtain G0 generation silkworm, eclosion the silkworm to obtain silkworm moths, backcrossing or selfing the silkworm moths to obtain G1 generation moths, taking positive transgenic silkworms in the G1 generation silkworm moths, culturing to eclosion, and self-selecting to obtain transgenic silkworms expressing the Cas9 protein; the specific target sequence of the silkworm endogenous fatty acid desaturase gene BmDES3 is connected with a silkworm endogenous U6 promoter, then a sgRNA sequence is connected to a U6 promoter to obtain a U6-sgRNA expression cassette, the U6-sgRNA expression cassette is inserted into a vector pBac (3 XP 3-DsRed) to obtain a recombinant expression vector, the recombinant expression vector is mixed with an auxiliary plasmid, the mixed solution is injected into eggs of silkworm moths, G0 generation silkworm is obtained by incubation, the silkworm is hatched into a silkworm moth, the silkworm moth is backcrossed or selfed to obtain a G1 generation moth ring, a positive transgenic silkworm in the G1 generation moth ring is taken and cultivated to be feathered, and the transgenic silkworm expressing the sgRNA is obtained by self-selection; hybridizing a transgenic silkworm expressing Cas9 protein with a transgenic silkworm expressing sgRNA to obtain a co-expression positive individual; the sgRNA sequence is shown in SEQ ID No.9 or SEQ ID No.10, and the U6 promoter sequence is shown in SEQ ID No. 6.