CN110468132B - sgRNA, transgenic expression vector, expression strain and screening method - Google Patents
sgRNA, transgenic expression vector, expression strain and screening method Download PDFInfo
- Publication number
- CN110468132B CN110468132B CN201910755532.9A CN201910755532A CN110468132B CN 110468132 B CN110468132 B CN 110468132B CN 201910755532 A CN201910755532 A CN 201910755532A CN 110468132 B CN110468132 B CN 110468132B
- Authority
- CN
- China
- Prior art keywords
- silk gland
- strain
- silk
- knockout
- sgrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 108091027544 Subgenomic mRNA Proteins 0.000 title claims abstract description 67
- 238000012216 screening Methods 0.000 title claims abstract description 46
- 238000000034 method Methods 0.000 title claims abstract description 37
- 238000012250 transgenic expression Methods 0.000 title claims abstract description 16
- 239000013604 expression vector Substances 0.000 title abstract description 19
- 210000004907 gland Anatomy 0.000 claims abstract description 94
- 108091073704 let-7c stem-loop Proteins 0.000 claims abstract description 60
- 241000255789 Bombyx mori Species 0.000 claims abstract description 57
- 108091033409 CRISPR Proteins 0.000 claims abstract description 51
- 238000010354 CRISPR gene editing Methods 0.000 claims abstract description 14
- 230000001965 increasing effect Effects 0.000 claims abstract description 12
- 238000009395 breeding Methods 0.000 claims abstract description 11
- 230000001488 breeding effect Effects 0.000 claims abstract description 9
- 108091023663 let-7 stem-loop Proteins 0.000 claims abstract description 6
- 108091063478 let-7-1 stem-loop Proteins 0.000 claims abstract description 6
- 108091049777 let-7-2 stem-loop Proteins 0.000 claims abstract description 6
- 238000011161 development Methods 0.000 claims abstract description 5
- 239000013598 vector Substances 0.000 claims description 23
- 235000013601 eggs Nutrition 0.000 claims description 21
- 108020004414 DNA Proteins 0.000 claims description 18
- 239000013612 plasmid Substances 0.000 claims description 16
- 235000008708 Morus alba Nutrition 0.000 claims description 11
- 240000000249 Morus alba Species 0.000 claims description 11
- 238000012217 deletion Methods 0.000 claims description 11
- 230000037430 deletion Effects 0.000 claims description 11
- 238000012163 sequencing technique Methods 0.000 claims description 10
- 108020005004 Guide RNA Proteins 0.000 claims description 9
- 230000009261 transgenic effect Effects 0.000 claims description 9
- 230000008859 change Effects 0.000 claims description 7
- 108700008625 Reporter Genes Proteins 0.000 claims description 6
- 238000011534 incubation Methods 0.000 claims description 6
- 238000002347 injection Methods 0.000 claims description 6
- 239000007924 injection Substances 0.000 claims description 6
- 210000001161 mammalian embryo Anatomy 0.000 claims description 6
- 238000000520 microinjection Methods 0.000 claims description 6
- 108010048367 enhanced green fluorescent protein Proteins 0.000 claims description 5
- 238000009396 hybridization Methods 0.000 claims description 5
- 239000000463 material Substances 0.000 claims description 5
- 230000018109 developmental process Effects 0.000 claims description 4
- 238000002474 experimental method Methods 0.000 claims description 4
- 238000007400 DNA extraction Methods 0.000 claims description 3
- 102000008579 Transposases Human genes 0.000 claims description 3
- 108010020764 Transposases Proteins 0.000 claims description 3
- 150000001875 compounds Chemical class 0.000 claims description 3
- 239000013613 expression plasmid Substances 0.000 claims description 3
- 239000003292 glue Substances 0.000 claims description 3
- 230000012447 hatching Effects 0.000 claims description 3
- 238000002156 mixing Methods 0.000 claims description 3
- 231100000252 nontoxic Toxicity 0.000 claims description 3
- 230000003000 nontoxic effect Effects 0.000 claims description 3
- 230000017448 oviposition Effects 0.000 claims description 3
- 238000007789 sealing Methods 0.000 claims description 3
- 238000011144 upstream manufacturing Methods 0.000 claims description 3
- 230000001133 acceleration Effects 0.000 claims description 2
- 238000001035 drying Methods 0.000 claims 1
- 230000013011 mating Effects 0.000 claims 1
- 108090000623 proteins and genes Proteins 0.000 abstract description 25
- 102000004169 proteins and genes Human genes 0.000 abstract description 8
- 238000010353 genetic engineering Methods 0.000 abstract description 5
- 108700011259 MicroRNAs Proteins 0.000 description 14
- 239000002679 microRNA Substances 0.000 description 13
- 125000006850 spacer group Chemical group 0.000 description 10
- 238000001976 enzyme digestion Methods 0.000 description 6
- 230000033822 gland development Effects 0.000 description 6
- 230000014616 translation Effects 0.000 description 6
- 108700019146 Transgenes Proteins 0.000 description 5
- 230000035772 mutation Effects 0.000 description 5
- 238000001243 protein synthesis Methods 0.000 description 5
- 238000000137 annealing Methods 0.000 description 4
- 230000008901 benefit Effects 0.000 description 4
- 238000010586 diagram Methods 0.000 description 4
- 230000000694 effects Effects 0.000 description 4
- 238000005516 engineering process Methods 0.000 description 4
- 239000012634 fragment Substances 0.000 description 4
- 231100000350 mutagenesis Toxicity 0.000 description 4
- 241000894007 species Species 0.000 description 4
- 238000009987 spinning Methods 0.000 description 4
- 230000008685 targeting Effects 0.000 description 4
- 230000015572 biosynthetic process Effects 0.000 description 3
- 238000010276 construction Methods 0.000 description 3
- 230000029087 digestion Effects 0.000 description 3
- 230000003828 downregulation Effects 0.000 description 3
- 230000002068 genetic effect Effects 0.000 description 3
- 230000006872 improvement Effects 0.000 description 3
- 108091070501 miRNA Proteins 0.000 description 3
- 238000002703 mutagenesis Methods 0.000 description 3
- 108091027963 non-coding RNA Proteins 0.000 description 3
- 102000042567 non-coding RNA Human genes 0.000 description 3
- 238000003786 synthesis reaction Methods 0.000 description 3
- 241000255777 Lepidoptera Species 0.000 description 2
- 230000000295 complement effect Effects 0.000 description 2
- 230000001276 controlling effect Effects 0.000 description 2
- 238000001816 cooling Methods 0.000 description 2
- 238000009402 cross-breeding Methods 0.000 description 2
- 238000004925 denaturation Methods 0.000 description 2
- 230000036425 denaturation Effects 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 231100000221 frame shift mutation induction Toxicity 0.000 description 2
- 230000037433 frameshift Effects 0.000 description 2
- 238000003209 gene knockout Methods 0.000 description 2
- 238000010362 genome editing Methods 0.000 description 2
- 239000003550 marker Substances 0.000 description 2
- 108020004999 messenger RNA Proteins 0.000 description 2
- 210000005036 nerve Anatomy 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 230000009467 reduction Effects 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 230000002194 synthesizing effect Effects 0.000 description 2
- 108020005345 3' Untranslated Regions Proteins 0.000 description 1
- 241000203069 Archaea Species 0.000 description 1
- 241000894006 Bacteria Species 0.000 description 1
- 102000053602 DNA Human genes 0.000 description 1
- 241000238631 Hexapoda Species 0.000 description 1
- 108091007773 MIR100 Proteins 0.000 description 1
- 125000003275 alpha amino acid group Chemical group 0.000 description 1
- 230000008827 biological function Effects 0.000 description 1
- 230000033228 biological regulation Effects 0.000 description 1
- 230000015556 catabolic process Effects 0.000 description 1
- 238000003776 cleavage reaction Methods 0.000 description 1
- 238000004891 communication Methods 0.000 description 1
- 230000008260 defense mechanism Effects 0.000 description 1
- 238000006731 degradation reaction Methods 0.000 description 1
- 230000002349 favourable effect Effects 0.000 description 1
- 230000006870 function Effects 0.000 description 1
- 230000001939 inductive effect Effects 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 230000009545 invasion Effects 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 108091086069 miR-2795 stem-loop Proteins 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 210000000056 organ Anatomy 0.000 description 1
- 238000004634 pharmacological analysis method Methods 0.000 description 1
- 230000008092 positive effect Effects 0.000 description 1
- 239000002243 precursor Substances 0.000 description 1
- 230000001105 regulatory effect Effects 0.000 description 1
- 230000008263 repair mechanism Effects 0.000 description 1
- 230000008439 repair process Effects 0.000 description 1
- 238000012827 research and development Methods 0.000 description 1
- 230000007017 scission Effects 0.000 description 1
- 230000003248 secreting effect Effects 0.000 description 1
- 238000004088 simulation Methods 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 238000007619 statistical method Methods 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000013518 transcription Methods 0.000 description 1
- 230000035897 transcription Effects 0.000 description 1
- 238000013519 translation Methods 0.000 description 1
- 230000003612 virological effect Effects 0.000 description 1
- 238000005303 weighing Methods 0.000 description 1
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/033—Rearing or breeding invertebrates; New breeds of invertebrates
- A01K67/04—Silkworms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/072—Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/02—Animal zootechnically ameliorated
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Environmental Sciences (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Animal Behavior & Ethology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of silkworm genetic engineering and artificial breeding, and discloses a sgRNA, a transgenic expression vector, an expression strain and a screening method. Firstly establishing a strain for expressing let-7Complex/Cluster (let-7C) to knock out used sgRNA by using a CRISPR/Cas9 system, and hybridizing the strain with a specific Cas9 expression strain to realize the knock-out of the let-7C in the silk gland of the silkworm; and (3) hybridizing the sgRNA expression strain with a middle silk gland and a rear silk gland Cas9 expression strain respectively to obtain a strain with let-7C specifically knocked out in the middle silk gland and a strain with let-7C specifically knocked out in the rear silk gland. According to the invention, the silkworm silk gland let-7 is knocked out through the CRISPR/Cas9, the development of silk glands can be promoted, the expression of silk protein is increased, and the silk yield of silkworms is improved.
Description
Technical Field
The invention belongs to the technical field of artificial mutation breeding, and particularly relates to an sgRNA, a transgenic expression vector, an expression strain and a screening method, in particular to an sgRNA of a let-7microRNA complex/cluster, a transgenic expression vector thereof and a knockout strain screening method of the let-7 complex/cluster.
Background
Conventional breeding methods commonly used include artificial mutagenesis and crossbreeding. Artificial mutation breeding refers to treating organisms by means of chemical mutagenesis or physical mutagenesis, inducing the genetic characters of the organisms to generate mutation, and screening out valuable mutants. Although artificial mutation increases the frequency of genetic trait variation, the induced mutation is non-directional, favorable variation is few, and the breeding process needs to process a large amount of mutant varieties or materials, so that the workload is large. Meanwhile, cross breeding refers to a breeding method in which different varieties within a species or different species with close relationships are crossed to obtain heterosis. The hybrid breeding can lead the dominant traits among different varieties to be continuously accumulated in hybrid varieties, but the hybridization and the screening both need to consume a large amount of time, and the obtained related traits are unstable in filial generations. Silkworm is an important economic insect and has the capability of quickly synthesizing a large amount of silk protein. The silk gland is an important organ for synthesizing and secreting silk protein of the silkworm, and the silk gland rapidly grows and synthesizes a large amount of silk protein in the period of five-instar larva of the silkworm. After the frame map and the fine map of the silkworm genome are published, people expect to obtain silkworm varieties with high spinning quantity by controlling key genes of silk gland development and silk protein synthesis. With the development of molecular biology and genetic engineering technology, the genes are expected to be controlled by using a gene editing means so as to improve the economic traits of silkworms.
CRISPR/Cas9 is a defense mechanism acquired by bacteria and archaea during long-term evolution to resist viral or foreign DNA invasion. The foreign DNA is integrated with the CRISPR through local sequence complementary pairing, the CRISPR transcribes to form pre-crRNA, which is then cleaved to crRNA, and the complex formed by the crRNA and trans-actangcrrna (tracrRNA) can guide the Cas9 protein to cleave the double strand of the foreign DNA complementarily paired with the crRNA. Based on this principle, the crRNA/tracrRNA complex was replaced with an artificially synthesized sgRNA to guide Cas9 endonuclease to perform site-directed cleavage of the foreign DNA. Under repair of a non-homologous end repair mechanism in an organism, the cleaved double-stranded DNA is re-ligated, but base deletion, insertion, substitution, and the like occur. For coding genes, the changes probably cause frame shift mutation of the genes, thereby achieving the aim of gene knockout. Because sgRNA has the advantages of simple design, rapid synthesis, high binding efficiency with Cas9 and the like, CRISPR/Cas9 has been widely applied to gene function research and variety improvement.
The CRISPR/Cas9 gene editing system consists of two parts: sgRNA and endonuclease Cas9. The scaffold sequence (sgRNA scaffold) in sgRNA is a relatively conserved stretch of sequence that can bind Cas9. Site-specific knockdown of CRISPR/Cas9 depends on the sgRNA spacer sequence, about 20nt long in the sgRNA, which is a specific sequence that complementarily pairs with a target site on the genome. Specific knockout of CRISPR/Cas9 to specific sites can be realized by designing sgRNA spacers of the specific sites of the genome. sgRNA spacer needs to satisfy the sequence format of G (N19) NGG. With the help of online software, sgRNA spacers satisfying the conditions in the target sequence can be found. The designed sgRNA sequence can be subjected to transcription synthesis and then mixed with a commercialized Cas9 protein for injection, so that specific gene knockout can be realized.
The difficulty of solving the technical problems is as follows:
whether the important genes for regulating and controlling the silk gland development and silk protein synthesis can be found is a prerequisite for innovating silkworm varieties, improving silk performance and increasing silk yield through genetic engineering. Silkworm genome contains tens of thousands of protein coding genes and also contains a large number of non-coding RNAs. To find key or important factors that promote silk gland development and silk protein synthesis from these large populations of genes and non-coding RNAs requires extensive experimental research.
microRNA is a non-coding RNA with the length of about 22nt, participates in regulation of various vital activities, and promotes target mRNA degradation or inhibits target gene translation through reverse complementary pairing with the 3' UTR of the target gene mRNA. If the negative regulation effect of microRNA in silk gland can be relieved, the development of silk gland and the expression of silk protein can be promoted. However, microRNA is different from protein coding genes, has no triplet genetic code, cannot generate frame shift mutation, is probably not enough to influence the generation of microRNA due to the loss or mutation of a single base, and the deletion of the microRNA is best to delete the whole microRNA mature body sequence on a genome.
micrornas exist in two forms on the genome: single microRNA and microRNA cluster. The former means that the same locus (locus) within 10kb on the genome only generates a single microRNA; the latter means that more than two microRNAs are generated at the same site within 10kb on a genome, and the microRNAs have common expression patterns and similar biological functions. Knockout of microRNA cluster on genome can be achieved by simultaneously acting multiple pairs of sgRNAs located at microRNA cluster precursor positions on genome and guiding Cas9 protein to cut off sequences between microRNAs at two ends of cluster on genome.
The significance of solving the technical problems is as follows:
the significance of the technology of the invention is that: the integral knockout of let-7microRNA complex/cluster (let-7C) is realized in the middle and rear silk glands of the silkworm. The method does not modify coding genes and introduce new foreign genes, only deletes let-7CmiRNAs in silkworm silk gland cells by using CRISPR/Cas9 technology, removes the negative regulation and control effects of the let-7CmiRNAs on silk gland development and silk protein synthesis, and realizes the increase of the length of the silkworm silk glands and the improvement of silk output. Specifically, after the let-7C of the middle silk gland is knocked out, the middle section and the rear section of the middle silk gland are expanded, but the surfaces of the middle silk gland and the rear section are both in an uneven tooth shape, and the DNA content of the middle silk gland is increased by 120%; after the let-7C of the posterior silk gland of the silkworm is knocked out, the amount of DNA in the posterior silk gland cell is increased by 120%, the length of the posterior silk gland is increased by 60%, the weight is increased by 150%, and the silk is weighed after silk spitting and found to be increased by 10%.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides an sgRNA, a transgenic expression vector, an expression strain and a screening method.
The invention is realized by a sgRNA, the sequence of the sgRNA is as follows: the amino acid sequence of SEQ ID NO:5.
another object of the present invention is to provide a transgenic expression vector constructed from the sgRNA.
Another object of the present invention is to provide a method for constructing the transgenic expression vector, which comprises:
(1) Finding a proper sgRNA targeting site on a genome where let-7C is located, wherein the sgRNA targeting site conforms to a G (N20) GG structure;
(2) The sgRNA expression vector simultaneously expresses two sgRNAs by using a U6 promoter, a promoter 3XP3 specifically expressed in eyes and nerves is selected as a screening marker to start green fluorescent EGFP, and a lepidoptera insect transposon piggyBac is used as a basic skeleton of the transgene by using the transgene vector.
Further, the construction method of the sgRNA transgenic expression vector specifically comprises the following steps:
1) Predicting sgRNA spacers required by knockout of let-7C by using an online prediction website CCtop, inputting a genome sequence where the let-7C is located, and searching the gRNA spacers in the sequence by using the structure of G (N20) GG to avoid a sequence with high miss ratio; adding corresponding basic groups at the 5' end of the sgRNA spacer sequence, wherein TGCA and AAAC are used for connection after AarI enzyme digestion, and TCCG and AAAC are used for connection after BbaI enzyme digestion;
2) The primers were annealed to form double strands under the following conditions: denaturation at 95 ℃ for 5min, gradient cooling at 95 ℃ to 25 ℃, reduction by 0.1 ℃ per second, and 700 cycles;
3) Preparing the following system, digesting at 37 ℃ overnight, and recovering a pUC57[ U6-2gRNA ] vector framework:
4) Connecting a double chain formed by annealing sgRNA1-spacer to a pUC57[ U6-2gRNA ] vector framework to construct a pUC57[ U6-sgRNA1] plasmid;
5) The following system was prepared, and after digestion at 37 ℃ for 4h, the pUC57[ U6-sgRNA1] vector backbone was recovered:
6) Connecting a double chain formed by annealing sgRNA2-spacer to a pUC57[ U6-sgRNA1] vector framework to construct a pUC57[ U6, let-7C-2gRNA ] plasmid;
7) Preparing the following system, carrying out enzyme digestion at 37 ℃ for 4h, and recovering a [ U6, let-7C-2gRNA ] fragment:
8) Connecting the recovered let-7C knockout double sgRNA expression fragment [ U6, let-7C-2gRNA ] to a piggyBac [3xP3-EGFP ] vector to construct a let-7C knockout double gRNA transgenic expression vector: pBac [3xp3-EGFP, let-7C-2gRNA ].
The invention also aims to provide a sgRNA expression strain screening method based on the transgenic expression vector constructed by the sgRNA. The sgRNA expression strain screening method utilizes a CRISPR/Cas9 system, firstly establishes a strain for knocking out sgRNA used by let-7C, and hybridizes the strain with a specific Cas9 expression strain to realize the knocking-out of let-7C in the silk gland of the silkworm; specifically, sgRNA expression strains are respectively hybridized with middle silk gland and rear silk gland Cas9 expression strains, and a strain with let-7C specifically knocked out in the middle silk gland [ delta let-7C-MSG ] and a strain with let-7C specifically knocked out in the rear silk gland [ delta let-7C-PSG ] are obtained.
Further, the sgRNA expression line screening method specifically includes:
step one, double gRNA transgenic vector injection and positive individual screening. The sgRNA transgene expression plasmid is injected into newly laid silkworm eggs by a microinjection method, larvae which can be successfully hatched are fed by fresh mulberry leaves to obtain G0 generation adults, and the G0 generation adults are mated to obtain G1 generation silkworm eggs. Carrying out green fluorescence screening when the silkworm eggs are induced to be green for 5-6 days; A. a # represents positive silkworm eggs screened in G1 generation and emitting green light to eyes; B. b # represents positive imago of G1 generation;
step two, hybridizing the sgRNA expression strain and the Cas9 expression strain, and screening a let-7C knockout strain;
(1) [ let-7C-2gRNA ] individuals; a [ Cas9-MSG ] individual; C. the individuals expressing green light and red light simultaneously are hybrid individuals, namely let-7C middle silk gland knockout individuals [ delta let-7C-MSG ];
(2) A. [ let-7C-2gRNA ] individuals; a [ Cas9-PSG ] individual; C. the individuals expressing green light and red light simultaneously are hybrid individuals, namely let-7C rear silk gland knockout individuals [ delta let-7C-PSG ];
thirdly, sequencing to verify sequence change on the genome and prove that the let-7C is knocked out; designing primers at the upstream and downstream of let-7C, amplifying the sequence, and identifying the change of the silkworm silk gland cell genome DNA by a sequencing method; compared with a normal sequence, the two different sgRNA targets have different forms of base deletion, and the deletion is different from 2 to 83 bases.
Further, the first step specifically includes:
(1) Extracting pBac [3xp3-EGFP, let-7C-2gRNA ] ultrapure plasmids, and mixing the plasmids with an auxiliary vector pHA3PIG ultrapure plasmid which is stored in a laboratory and expresses piggyBac transposase according to a molar ratio of 1; injecting the mixed plasmid into D9L silkworm eggs within one hour after egg laying by using a microinjection instrument, and then sealing an injection hole by using non-toxic instantaneous-dry glue;
(2) Putting the injected silkworm eggs into a biochemical incubator with the temperature of 25 ℃ and the relative humidity of 90 percent for hatching, and feeding the silkworm larvae with fresh mulberry leaves after 9-10 days to obtain G0 generation larvae;
(3) Breeding the G0 generation larvae to adults and selfing to obtain G1 generation spawning, carrying out green acceleration to 5-6 days, and screening transgenic positive individuals by using a macroscopic electric fluorescence microscope; EGFP fluorescent protein is adopted as a reporter gene, so that green light emitted by embryo eyes in the G1 generation is a positive individual, and the positive individual is named as [ let-7C-2gRNA ];
(4) G1 generation is raised to adult, green fluorescence screening is carried out on adult compound eyes again, and screened positive individuals are used for subsequent hybridization experiments.
Further, the second step specifically includes:
1) Hybridizing the [ let-7C-2gRNA ] strain with a middle silk gland Cas9 expression strain [ Cas9-MSG ] and a rear silk gland Cas9 expression strain [ Cas9-PSG ] respectively;
2) Placing the hybridized F1 generation silkworm eggs into a biochemical incubator with the temperature of 25 ℃ and the relative humidity of 90% for carrying out incubation, and screening the reporter gene by using a macroscopic electric fluorescence microscope when the incubation is carried out for 5-6 days; the F1 generation embryo eyes emit green light and red light simultaneously, namely a let-7C middle part silk gland knockout individual [ delta let-7C-MSG ] and a let-7 rear part silk gland knockout individual [ delta let-7C-PSG ].
Further, the third step specifically includes:
(1) Feeding the screened [ delta let-7C-MSG ] and [ delta let-7C-PSG ] larvae to five instars by using fresh mulberry leaves, and dissecting to obtain silk gland materials;
(2) Extracting total DNA of silk gland cells by using a tissue DNA extraction kit;
(3) Designing a primer to amplify a target site sequence, and connecting the target site sequence to a pMD-19-Tsimple vector for sequencing;
(4) The sequences were aligned and analyzed using BioEidt software to identify the number of base deletions.
The invention also aims to provide application of the sgRNA expression strain screening method in improving the development and the spinning quantity of silkworm silk glands, and a strain [ delta let-7C-MSG ] with let-7C specifically knocked out in the middle part of the silk gland and a strain [ delta let-7C-PSG ] with let-7C specifically knocked out in the rear part of the silk gland are obtained.
In summary, the advantages and positive effects of the invention are: the silk gland of the silkworm is expected to be modified through genetic engineering so as to improve the silk yield and the variety of the silkworm, but the silk gland is not provided with an ideal molecular target and a scientific genetic engineering means. The invention realizes the integral knockout of let-7Cluster miRNAs (let-7, miR-100 and miR-2795) at different parts of the silk gland (middle silk gland and rear silk gland) for the first time. The method does not modify or change any protein coding gene and introduce a new foreign gene, but deletes all miRNAs of the let-7Cluster in the silk gland cells of the silkworms by using the CRISPR/Cas9 technology, removes the negative regulation and control effect of the let-7C on the silk gland development and silk protein synthesis, and realizes the improvement of the silk yield of the silkworms. Since the silk gland can complete tissue digestion immediately after silking of the silkworm until the tissue digestion completely disappears, the knockout of let-7C miRNAs in the silk gland is not transmitted to offspring, and other species are not influenced by gene communication among the species. Therefore, the technology is safe and reliable in production and has more advantages.
Drawings
Fig. 1 is a flowchart of a sgRNA expression line screening method provided in an embodiment of the present invention.
Fig. 2 is a schematic diagram of the construction of a sgRNA transgenic expression vector provided in an embodiment of the present invention.
Fig. 3 is a flowchart of a sgRNA expression line screening method provided in an embodiment of the present invention.
FIG. 4 is a schematic diagram of a let-7C knockout line screening method provided in an embodiment of the invention.
FIG. 5 is a schematic representation of the identification of a knockout form provided by embodiments of the invention.
FIG. 6 is a schematic diagram of a silk gland phenotype observation after a let-7C knockout is provided by an embodiment of the invention.
FIG. 7 is a schematic diagram of the statistical analysis of silk gland length, weight and cocoon weight provided by the embodiment of the invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
According to the invention, a CRISPR/Cas9 system is utilized, firstly, a strain for knocking out sgRNA used by let-7C is established, and the strain is hybridized with a specific Cas9 expression strain to realize the knocking-out of let-7C in the silk gland of the silkworm; specifically, sgRNA expression strains are respectively crossed with middle silk gland and rear silk gland Cas9 expression strains to obtain a strain with let-7C specifically knocked out in the middle silk gland [ delta let-7C-MSG ] and a strain with let-7C specifically knocked out in the rear silk gland [ delta let-7C-PSG ]; the silkworms of these strains have changed in silk gland development and silk output.
The following detailed description of the principles of the invention is provided in connection with the accompanying drawings.
As shown in fig. 1, the sgRNA expression line screening method provided in the embodiment of the present invention includes the following steps:
s101: designing sgRNA and constructing a transgenic expression vector;
s102: injecting double gRNA transgenic vectors and screening positive individuals;
s103: hybridizing the sgRNA expression strain and the Cas9 expression strain, and screening a let-7C knockout strain;
s104: sequencing to verify sequence change on the genome and prove that the let-7C is knocked out;
s105: dissecting silk glands, observing phenotypes and taking pictures when the larvae are in the fifth instar;
s106: detecting the length and weight of the fifth-instar 5-6 th day silk gland; counting the cocoon weight after the silkworms are cocooned.
The application of the principles of the present invention will now be described in further detail with reference to the accompanying drawings.
The sgRNA expression strain screening method provided by the embodiment of the invention comprises the following steps:
the first step is as follows: sgRNA design and transgene expression vector construction (as shown in fig. 2):
(1) Finding a proper sgRNA targeting site on a genome where let-7C is located, wherein the sgRNA targeting site conforms to a G (N20) GG structure;
(2) The sgRNA expression vector simultaneously expresses two sgRNAs by using a U6 promoter, a promoter 3XP3 specifically expressed in eyes and nerves is selected as a screening marker to start green fluorescent EGFP, and a transgenic vector takes lepidoptera insect transposon piggyBac as a transgenic basic skeleton;
the method specifically comprises the following steps:
1) The sgRNA spacer required for knocking out let-7C is predicted by using an online prediction website CCtop (https:// crispr. Cos. Uni-heidelberg. De /). Inputting a genome sequence (about 3000 bp) where let-7C is located, and searching a gRNA spacer in the sequence by using the structure of G (N20) GG to avoid a sequence with high off-target rate; adding corresponding bases (TGCA and AAAC are used for connection after AarI enzyme digestion, TCCG and AAAC are used for connection after BbaI enzyme digestion) at the 5' end of the sgRNA spacer sequence, sending a Huada gene synthesis primer:
2) The primers were annealed to form double strands under the following conditions: denaturation at 95 ℃ for 5min, gradient cooling at 95 ℃ to 25 ℃, reduction by 0.1 ℃ per second, and 700 cycles;
3) Preparing the following system, digesting at 37 ℃ overnight, and recovering a pUC57[ U6-2gRNA ] (the vector is a double gRNA expression vector) vector framework:
4) Connecting a double chain formed by annealing the sgRNA1-spacer to a pUC57[ U6-2gRNA ] vector framework to construct a pUC57[ U6-sgRNA1] plasmid;
5) Preparing the following system, digesting for 4h at 37 ℃, and recovering a pUC57[ U6-sgRNA1] vector framework:
6) Connecting a double chain formed by annealing sgRNA2-spacer to a pUC57[ U6-sgRNA1] vector framework to construct a pUC57[ U6, let-7C-2gRNA ] plasmid;
7) Preparing the following system, carrying out enzyme digestion at 37 ℃ for 4h, and recovering a [ U6, let-7C-2gRNA ] fragment:
8) Connecting the recovered let-7C knockout double sgRNA expression fragment [ U6, let-7C-2gRNA ] to a piggyBac [3xP3-EGFP ] vector to construct a let-7C knockout double gRNA transgenic expression vector: pBac [3xp3-EGFP, let-7C-2gRNA ].
The second step is that: double gRNA transgenic vector injection and positive individual screening (as shown in figure 3):
the sgRNA transgene expression plasmid is injected into newly laid silkworm eggs by a microinjection method, larvae which can be successfully hatched are fed by fresh mulberry leaves to obtain G0 generation adults, and the G0 generation adults are mated to obtain G1 generation silkworm eggs. Carrying out green fluorescence screening when the silkworm eggs are induced to be green for 5-6 days. A. A # represents positive eggs screened in G1 generation and emitting green light to eyes. B. B # represents positive imago of G1 generation; the method specifically comprises the following steps:
(1) Extracting pBac [3xp3-EGFP, let-7C-2gRNA ] ultrapure plasmids, and mixing the plasmids with an auxiliary vector pHA3PIG ultrapure plasmid which is stored in a laboratory and expresses piggyBac transposase according to a molar ratio of 1; injecting the mixed plasmid into D9L silkworm eggs within one hour after egg laying by using a microinjection instrument, and then sealing an injection hole by using non-toxic instantaneous-dry glue;
(2) Putting the injected silkworm eggs into a biochemical incubator with the temperature of 25 ℃ and the relative humidity of 90 percent for hatching, and feeding the silkworm larvae with fresh mulberry leaves after 9-10 days to obtain G0 generation larvae;
(3) And breeding the G0 generation larvae to adults and selfing to obtain G1 generation eggs, carrying out green-forcing till 5-6 days, and screening transgenic positive individuals by using a macroscopic electric fluorescence microscope (Olympus MVX 10). Because EGFP fluorescent protein is adopted as a reporter gene, green light emitting individuals of embryo eyes in G1 generation are positive individuals and are named as [ let-7C-2gRNA ];
(4) G1 generation is raised to adult, green fluorescence screening is carried out on adult compound eyes again, and screened positive individuals are used for subsequent hybridization experiments.
The third step: the sgRNA expression line was crossed with the Cas9 expression line and the let-7C knockout line was screened (as shown in fig. 4):
(1) [ let-7C-2gRNA ] individuals; a [ Cas9-MSG ] individual; C. the individuals expressing green light and red light simultaneously are hybrid individuals, namely let-7C middle silk gland knockout individuals [ delta let-7C-MSG ];
(2) [ let-7C-2gRNA ] individuals; a [ Cas9-PSG ] individual; C. the individuals expressing green light and red light simultaneously are hybrid individuals, namely let-7C rear silk gland knockout individuals [ delta let-7C-PSG ];
the method specifically comprises the following steps:
1) Hybridizing the [ let-7C-2gRNA ] strain with a middle silk gland Cas9 expression strain [ Cas9-MSG ] and a rear silk gland Cas9 expression strain [ Cas9-PSG ] respectively;
2) And (3) placing the F1 generation silkworm eggs obtained by hybridization into a biochemical incubator with the temperature of 25 ℃ and the relative humidity of 90% for incubation, and screening the reporter genes by using a macroscopic electric fluorescence microscope (Olympus MVX 10) when the incubation is carried out for 5-6 days. The F1 generation embryo eyes emit green light and red light simultaneously, namely a let-7C middle part silk gland knockout individual [ delta let-7C-MSG ] and a let-7 rear part silk gland knockout individual [ delta let-7C-PSG ].
The fourth step: sequencing verified sequence changes on the genome, demonstrating that let-7C was knocked out (as shown in figure 5).
Primers are designed at the upstream and the downstream of let-7C, the sequence is amplified, and the change of the silkworm silk gland cell genome DNA is identified by a sequencing method. Compared with a normal sequence, the two different sgRNA targets are subjected to different forms of base deletion, and the deletion is different from 2 to 83 bases;
the method specifically comprises the following steps:
(1) Feeding the screened [ delta let-7C-MSG ] and [ delta let-7C-PSG ] larvae to five instars by using fresh mulberry leaves, and dissecting to obtain silk gland materials;
(2) Extracting total DNA of silk gland cells by using a tissue DNA extraction kit (Omega, D3396-02);
(3) Primers were designed to amplify the target site sequence and ligated into the pMD-19-Tsimple vector for sequencing. SEQ ID NO:3: let-7C-KO-F: GTCAACGCGCCTAAAGAA; SEQ ID NO:4 let-7C-KO-R: TTTAGTGGTCTTGTGAGGAATG;
(4) The sequences were aligned and analyzed using BioEidt software to identify the number of base deletions.
The fifth step: at the fifth instar of the larvae, silk glands were dissected, phenotypes observed and photographed (as shown in fig. 6):
(1) After the [ let-7C-2gRNA ] individual is hybridized with the [ Cas9-MSG ] individual, four different light-emitting forms appear, and comparison of the central silk glands of the four different light-emitting forms shows that: the middle and the back of the silk gland of the [ delta let-7C-MSG ] individual are obviously enlarged, which shows that the silk gland is in a sawtooth bulge;
(2) After the [ let-7C-2gRNA ] individuals and the [ Cas9-PSG ] individuals are hybridized, four different light-emitting forms appear, and the comparison of the rear silk glands of the four different light-emitting forms shows that: the [ Delta let-7C-PSG ] individual posterior silk gland is obviously lengthened and thickened, which shows that the silk gland is jagged and convex, and the curling degree is increased;
the method specifically comprises the following steps:
1) Breeding the screened [ delta let-7C-MSG ] and [ delta let-7C-PSG ] larvae with fresh mulberry leaves until the fifth instar is from 5 days to 6 days to the sixth day;
2) The silk glands were dissected to observe the phenotype and photographed with a camera.
And a sixth step: detecting the length and weight of the fifth-instar 5-6 th day silk gland; after silkworms are cocooned, cocoon weights are counted (as shown in fig. 7):
(1) [ Delta let-7C-PSG ] the posterior silk gland length of the individual is increased by 60%; [ Delta let-7C-PSG ] increased 100% of individual posterior silk gland weight;
(2) The weight of the individual silkworm cocoon of [ delta let-7-PSG ] is increased by 12 percent; d, [ delta let-7C-MSG ] individual silkworm cocoon weight is reduced by 15%;
the method specifically comprises the following steps:
1) Feeding the screened larvae of [ delta let-7C-MSG ] and [ delta let-7C-PSG ] with fresh mulberry leaves till the fifth instar is from 5 th to 6 th days;
2) Dissecting a posterior silk gland to measure the length and the weight of the posterior silk gland;
3) Continuously feeding the screened [ delta let-7C-MSG ] and [ delta let-7C-PSG ] larvae to spinning and cocooning; pupating the larva, weighing and comparing the weight of the silkworm cocoon after spinning is finished.
Proof part (concrete examples/experiment/simulation/pharmacological analysis/positive experimental data, evidence material, appraisal report, business data, research and development evidence, business cooperation evidence, etc. capable of proving inventiveness of the present invention)
The above description is intended to be illustrative of the preferred embodiment of the present invention and should not be taken as limiting the invention, but rather, the intention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the invention.
Sequence listing
<110> university of southwest
<120> sgRNA, transgenic expression vector, expression strain and screening method
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 48
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tgcagcgcac aagttcggat ctacaaacgt agatccgaac ttgtgcgc 48
<210> 2
<211> 46
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tccggtcagc tcggaaagtt agcaaacgct aactttccga gctgac 46
<210> 3
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gtcaacgcgc ctaaagaa 18
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tttagtggtc ttgtgaggaa tg 22
<210> 5
<211> 386
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
aagtgatccg tggcttataa gcatcggtgg ttcagtggta gaatgctcgc ctgccacgcg 60
ggcggcccgg gttcgattcc cggccgatgc agcgcacaag ttcggatcta cgttttagag 120
ctagaaatag caagttaaaa taaggctagt ccgttatcaa cttgaaaaag tggcaccgag 180
tcggtgcaac aaaggaaacc tgatcatgta gatcgaatgg actctaaatc cgttcagccg 240
ggttagattc ccggggtttc cggtcagctc ggaaagttag cgttttagag ctagaaatag 300
caagttaaaa taaggctagt ccgttatcaa cttgaaaaag tggcaccgag tcggtgcttt 360
ttttctagaa caattttata acatac 386
Claims (6)
1. A let-7C silk gland knockout strain screening method is characterized in that a strain for expressing sgRNA used for let-7C knockout is established by using a CRISPR/Cas9 system, and the strain is hybridized with a specific Cas9 expression strain to realize the knockout of let-7C in silk glands of silkworms; specifically, sgRNA expression strains and rear silk gland Cas9 expression strains are respectively hybridized to obtain let-7C rear silk gland specific knockout strains [ delta let-7C-PSG ].
2. The let-7C silk gland knockout line screening method of claim 1, wherein the let-7C knockout line screening method specifically comprises:
injecting double gRNA transgenic vectors and screening positive individuals, injecting sgRNA transgenic expression plasmids into newly-born silkworm eggs by a microinjection method, feeding successfully hatched larvae with fresh mulberry leaves to obtain G0-generation adults, and mating the G0-generation adults to obtain G1-generation silkworm eggs; carrying out green fluorescence screening when the silkworm eggs are induced to be green for 5-6 days;
step two, hybridizing the sgRNA expression strain and the Cas9 expression strain, and screening a let-7C knockout strain;
a. [ let-7C-2gRNA ] individuals; a [ Cas9-PSG ] individual; C. the individuals expressing green light and red light simultaneously are hybrid individuals, namely let-7C rear silk gland knockout individuals [ delta let-7C-PSG ];
thirdly, sequencing to verify sequence change on the genome and prove that let-7C is knocked out; designing primers on the upstream and downstream of let-7C, amplifying the sequence, and identifying the change of the silkworm silk gland cell genome DNA by a sequencing method; compared with a normal sequence, different forms of base deletion occur at two different sgRNA target points, and the deletion is different from 2 to 83 bases.
3. The let-7C silk gland knockout line screening method of claim 2, wherein the first step specifically comprises:
(1) Extracting pBac [3xp3-EGFP, let-7C-2gRNA ] ultrapure plasmids, and mixing the plasmids with an auxiliary vector pHA3PIG ultrapure plasmid which is stored in a laboratory and expresses piggyBac transposase according to a molar ratio of 1; injecting the mixed plasmid into D9L silkworm eggs within one hour after egg laying by using a microinjection instrument, and then sealing an injection hole by using non-toxic instantaneous-drying glue;
(2) Putting the injected silkworm eggs into a biochemical incubator with the temperature of 25 ℃ and the relative humidity of 90 percent for hatching, and feeding the silkworm larvae with fresh mulberry leaves after 9-10 days to obtain G0 generation larvae;
(3) Breeding the G0 generation larvae to adults and selfing to obtain G1 generation spawning, carrying out green acceleration to 5-6 days, and screening transgenic positive individuals by using a macroscopic electric fluorescence microscope; EGFP fluorescent protein is adopted as a reporter gene, so that green light emitted by embryo eyes in the G1 generation is a positive individual, and the positive individual is named as [ let-7C-2gRNA ];
(4) G1 generation is raised to adult, green fluorescence screening is carried out on adult compound eyes again, and screened positive individuals are used for subsequent hybridization experiments.
4. The let-7C silk gland knockout line screening method of claim 2, wherein the second step specifically comprises:
1) Respectively hybridizing the [ let-7C-2gRNA ] strain with a posterior silk gland Cas9 expression strain [ Cas9-PSG ];
2) Placing the hybridized F1 generation silkworm eggs into a biochemical incubator with the temperature of 25 ℃ and the relative humidity of 90% for carrying out incubation, and screening the reporter gene by using a macroscopic electric fluorescence microscope when the incubation is carried out for 5-6 days; the F1 generation embryo eye emitting green light and red light simultaneously is a let-7 rear silk gland knockout individual [ delta let-7C-PSG ].
5. The let-7C silk gland knockout line screening method of claim 2, wherein the third step specifically comprises:
(1) Feeding the screened [ delta let-7C-PSG ] larvae with fresh mulberry leaves to five instars, and dissecting to obtain silk gland materials;
(2) Extracting total DNA of the silk gland cell by using a tissue DNA extraction kit;
(3) Designing a primer to amplify a target site sequence, and connecting the target site sequence to a pMD-19-T simple vector for sequencing;
(4) The sequences were aligned and analyzed using BioEidt software to identify the number of base deletions.
6. Use of the let-7C silk gland knockout strain screening method of any one of claims 1 to 5 for increasing development and silk spitting amount of silkworm silk glands, wherein a let-7C posterior silk gland specific knockout strain [ Δ let-7C-PSG ] is obtained.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910755532.9A CN110468132B (en) | 2019-08-15 | 2019-08-15 | sgRNA, transgenic expression vector, expression strain and screening method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910755532.9A CN110468132B (en) | 2019-08-15 | 2019-08-15 | sgRNA, transgenic expression vector, expression strain and screening method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110468132A CN110468132A (en) | 2019-11-19 |
| CN110468132B true CN110468132B (en) | 2022-11-25 |
Family
ID=68510271
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910755532.9A Active CN110468132B (en) | 2019-08-15 | 2019-08-15 | sgRNA, transgenic expression vector, expression strain and screening method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110468132B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112369376B (en) * | 2020-11-27 | 2022-04-26 | 江苏科技大学 | Breeding method of silkworm with densonucleosis resistance |
| CN114540421B (en) * | 2022-03-04 | 2024-04-16 | 西南大学 | Controllable editing method for silkworm MSG and PSG expression genes |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107043782A (en) * | 2017-04-10 | 2017-08-15 | 西南大学 | A kind of gene knockout method and its sgRNA fragments and application |
| CN108849774A (en) * | 2018-07-19 | 2018-11-23 | 西南大学 | A kind of method and its cultivated silkworm breed variety for blocking silkworm moth to go out cocoon |
| CN108884448A (en) * | 2016-01-27 | 2018-11-23 | 昂克诺斯公司 | oncolytic virus carrier and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110023154A1 (en) * | 2008-12-04 | 2011-01-27 | Sigma-Aldrich Co. | Silkworm genome editing with zinc finger nucleases |
-
2019
- 2019-08-15 CN CN201910755532.9A patent/CN110468132B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108884448A (en) * | 2016-01-27 | 2018-11-23 | 昂克诺斯公司 | oncolytic virus carrier and application thereof |
| CN107043782A (en) * | 2017-04-10 | 2017-08-15 | 西南大学 | A kind of gene knockout method and its sgRNA fragments and application |
| CN108849774A (en) * | 2018-07-19 | 2018-11-23 | 西南大学 | A kind of method and its cultivated silkworm breed variety for blocking silkworm moth to go out cocoon |
Non-Patent Citations (4)
| Title |
|---|
| "Let-7 microRNA is a critical regulator in controlling the growth and function of silk gland in the silkworm";Wei Wang等;《RNA biology》;20200210;第17卷(第5期);703-717 * |
| "let-7 microRNA调控家蚕丝腺发育的分子机制";王伟;《中国优秀博硕士学位论文全文数据库(博士)农业科技辑》;20200515(第05期);D051-2 * |
| "利用Bac-to-Bac 杆状病毒系统超量表达家蚕let-7 簇microRNAs";何婷等;《中国农业科学》;20160201;第49卷(第3期);第589页左栏第2段 * |
| 何婷等."利用Bac-to-Bac 杆状病毒系统超量表达家蚕let-7 簇microRNAs".《中国农业科学》.2016,第49卷(第3期),第581-592页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110468132A (en) | 2019-11-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106047930B (en) | Preparation method of Flox rat with conditional knockout of PS1 gene | |
| CN108441520B (en) | Gene conditional knockout method constructed by using CRISPR/Cas9 system | |
| CN110551759B (en) | Composition and method for improving recombination efficiency of transgenic cells | |
| CN107043782B (en) | Gene knockout method, sgRNA fragment and application thereof | |
| CN107326046A (en) | A kind of method for improving foreign gene homologous recombination efficiency | |
| CN110305896B (en) | Construction method of zebra fish kidney progenitor cell marker transgenic line | |
| CN106282231B (en) | Construction method and application of mucopolysaccharide storage disease type II animal model | |
| CN110684777B (en) | Application of isolated nucleotide sequence in construction of zebra fish with reduced intramuscular stings | |
| CN110468132B (en) | sgRNA, transgenic expression vector, expression strain and screening method | |
| CN113755498A (en) | gRNA of targeted mouse Ube3a gene and method for constructing AS disease mouse model | |
| CN103160534B (en) | Universal type bovine beta-casein site gene targeting vector and preparation method thereof | |
| CN110643636A (en) | Megalobrama amblycephala MSTNa & b gene knockout method and application | |
| CN105274141A (en) | Transgenic vector for target mutation of primordial germ cells, method for preparing transgenic vector and application thereof | |
| CN103232977B (en) | Application of phiC31 recombinase system and piggyBac transposon and fixed point transgenetic system of silkworm and preparation method of fixed point transgenetic system | |
| CN110791528B (en) | microRNA gene editing method for improving silk yield and optimizing silkworm variety | |
| CN105463022B (en) | The method for synthesizing secretion latrodectus mactans traction silk-fibroin 2 using domestic natural silk gland bioreactor | |
| CN105440111B (en) | Pair of transcription activator-like effector nucleases (CTFs), coding sequences and application thereof | |
| CN112695034A (en) | Preparation method of zebra fish with ApoE gene deletion | |
| Piedrahita et al. | Use of embryonic and somatic cells for production of transgenic domestic animals | |
| CN111549070A (en) | Method for editing X chromosome multi-copy gene to realize animal sex control | |
| CN114891786B (en) | Dog Rosa26 gene and application thereof | |
| CN114606270B (en) | Construction method of Mia3 conditional gene knockout mouse model | |
| WO2019040744A1 (en) | Methods and compositions for in situ germline genome engineering | |
| CN114891791B (en) | sgRNA of specific targeting canine Rosa26 gene and application thereof | |
| CN114592011B (en) | Construction method of PTDSS2 conditional gene knockout mouse model |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |