CN103160534B - Universal type bovine beta-casein site gene targeting vector and preparation method thereof - Google Patents

Abstract

The invention discloses a universal type bovine beta-casein site gene targeting vector and a construction method thereof. The constructed vector comprises a 5' homologous arm and a 3' homologous arm, wherein upstream and downstream of a zinc finger nuclease recognition site of a bovine beta-casein site intron 2 extend by 700-850bp to form homologous sequences, and the homologous sequences are taken as the 5' homologous arm and the 3' homologous arm. According to the universal type bovine beta-casein site gene targeting vector, a notch is generated on a specific site of DNA (Deoxyribonucleic Acid) through zinc finger nuclease, and gene knockout is realized through homologous recombination terminal joint, thus greatly improving the efficiency of gene knockout; and then target genes are integrated on a target site of a somatic cell by utilizing a homologous recombination method, and a Loxp sequence is respectively added at the two ends of a screening gene and a marker gene of the targeting vector so as to conveniently remove the screening gene and the marker gene in the subsequent work, thus improving the efficiency of somatic cell clone.

Description

A kind of universal cattle beta-casein locus gene targeting vector and preparation method thereof

Technical field

The invention belongs to genetically engineered field, relate to a kind of gene targeting carrier, particularly one universal cattle beta-casein locus gene targeting vector.

Background technology

Transgenic animal PRODUCTION TRAITS is in modern cattle breeding, and there is important meaning in the fields such as animal disease model research and gene functional research.Since Hammer in 1985 etc. produce transgene rabbit by procaryotic injection method, procaryotic injection method is the main method of producing transgenic animal always, but procaryotic injection method exists and can only operate the early stage cell of fetal development, the problems such as integration efficiency is low, multiple copied radom insertion.While procaryotic injection method occurs, the technology of embryonic stem cell being carried out to genetic modification is also grown up, and produce some transgenic animal, but the embryonic stem cell of large domestic animal is not yet built so far and is.The birth of the many jasmines of clone sheep in 1997 make with somatocyte be genetic manipulation unit transgenic animal produce become a reality.Genetic engineering technique syncaryon implantation technique produces transgenic animal method has become the main method of producing transgenic animal, and report produces transgenic cattle, the animals such as transgenic sheep in this way both at home and abroad.

Syncaryon implantation technique is produced in transgenic animal, Chinese scholars applies adenovirus carrier method, adeno-associated virus (AAV) support methods, lentiviral vectors method, a series of methods such as ordinary plasmids support methods are carried out genetic manipulation to nuclear transfer donor cell and have produced multiple transgenic animal.But due to the randomness that the complicacy of gene expression regulation itself and the foreign gene of these methods mediation are integrated in Animal genome, make the expression level of foreign gene in host animal body mostly rest on a lower level, and between individuality, expression level is widely different.

Gene targeting is the laboratory facilities of a kind of directed change cell or biont genetic information, by foreign gene and genomic gene homologous recombination, single copy gene locator qualification technology is carried out to cell, therefore the problem of random integration can be overcome, since reported first gene targeting in 1987 carries out genetic modification to mouse ES cells, multiple transgenic animal are produced by gene targeting method up to now.

Gene targeting, also referred to as gene site-directed homologous recombination, refers to and carrys out modifying gene group specific site by the restructuring between foreign DNA and chromosomal DNA homologous sequence, thus changes the method for biological heredity characteristic.The spontaneous mutation on karyomit(e) specific site can be corrected by gene targeting, recover the normal physiological function of cell; Also ideal abrupt can be incorporated into genomic a certain site, make it stably heredity and go down.The concept of gene targeting grows up in yeast research early 1970s, until the ability such as Smithies in 1985 reported first realizes the homologous recombination between artificial targeting vector and endogenous beta globin gene in tumour cell, the research group of Smithies and Capecchi in 1987 achieves fixed point at mouse embryo stem cell and rejects, and present gene targeting has application in multiple fields of life science.Along with the development of gene targeting, occur that some new technology are as ZFN technology and TALE technology, scientist utilizes ZFN technology and TALE technology to produce double-strand break (DSB) at genome specific site, and the generation of DSB substantially increases the efficiency of somatocyte homologous recombination.

The key of gene targeting is the structure of targeting vector, the structure of many gene targeting carriers is had in the patent application of having announced, these carriers are the efficiency being improved homologous recombination by the length of increase homology arm mostly, will certainly reduce the ability of targeting vector load external source goal gene like this.Screening-gene in gene targeting carrier enters in genome with homology arm together with marker gene is while screening is integrated into cell, the physiological situation entering growth and the transgenic animal individuality that will affect transgenic cloned embryos of screening-gene and marker gene, thus affect this technology and apply aborning.

Summary of the invention

The problem that the present invention solves is to provide a kind of universal cattle beta-casein locus gene targeting vector, the homology arm of screening appropriate length, be conducive to interested goal gene to be inserted in the middle of the homology arm of targeting vector, can be used for producing galactophore biological reactor transgenic and cloned animal.

The present invention is achieved through the following technical solutions:

A kind of universal cattle beta-casein locus gene targeting vector, comprise 5 ' homology arm and 3 ' homology arm, respectively extend the homologous sequence of 700 ~ 850bp as 5 ' homology arm and 3 ' homology arm using the upstream and downstream of cattle beta-casein site intron 2 Zinc finger nuclease recognition site.

The nucleotide sequence of 5 ' described homology arm is as shown in SEQ.ID.NO.1, and the nucleotide sequence of 3 ' homology arm is as shown in such as SEQ.ID.NO.2.

The downstream of 5 ' described homology arm is also connected with the sequence comprising and shear splicing site SA, multiple clone site and two Loxp in the same way.

The sequence of the downstream connection of 5 ' described homology arm is as shown in SEQ.ID.NO.3.

SV40PolyA sequence is also inserted with between described polyclone position.

Also following element is provided with successively: PTK promotor, antibiotic-screening gene, PolyA, CMV promoter, fluorescent marker gene and SV40PolyA between the sequence of described two Loxp in the same way.

5 ' described homology arm and 3 ' homology arm are implemented on pMD19-T carrier, between 5 ' homology arm and 3 ' homology arm, be also provided with following element successively: shear splicing site SA, multiple clone site, SV40PolyA, Loxp1, PTK promotor, antibiotic-screening gene, PolyA, CMV promoter, fluorescent marker gene, SV40PolyA and Loxp2.

Described antibiotic-screening gene is neo, and fluorescent marker gene is EGFP.

A construction process for universal cattle beta-casein locus gene targeting vector, comprises the following steps:

1) using primer P5HA1, P5HA2 as primer pair, with cow genome group for template amplification 5 ' homology arm sequence, gel reclaims PCR primer; Double digestion PCR primer is connected with T4DNA ligase enzyme after pMD19-T carrier, carrier construction p5HA;

2) using primer P3HA1, P3HA2 as primer pair, with cow genome group for template amplification 3 ' homology arm sequence, gel reclaims PCR primer; Double digestion PCR primer is connected with T4DNA ligase enzyme after carrier p5HA, carrier construction pHA;

3) sequence of synthesis as shown in SEQ.ID.NO.3, and by the downstream of 5 ' homology arm in this sequence clone to carrier pHA, carrier construction pHA-SM;

4) the screening-gene neo in cloning vector pMCIneoployA and promotor thereof, and the sequence that double digestion is cloned is connected with T4DNA ligase enzyme after carrier pHA-SM, carrier construction pHA-SMN;

5) the marker gene EGFP in cloning vector pEGFP-C1 and promotor thereof, and the sequence that double digestion is cloned is connected with T4DNA ligase enzyme after carrier pHA-SMN, builds and obtains carrier pTCSN2.

Compared with prior art, the present invention has following useful technique effect:

Universal cattle beta-casein locus gene targeting vector provided by the invention and preparation method thereof, leave restriction enzyme site in targeting vector to may be used for interested goal gene to be inserted in the middle of the homology arm of targeting vector, wherein, breach is produced at the specific site of DNA by Zinc finger nuclease, engaged by homologous recombination end and realize gene knockout, thus substantially increase the efficiency of gene knockout; Then the method for homologous recombination is utilized to be incorporated into by goal gene on somatic target site, add that Loxp sequence is convenient to remove screening-gene and marker gene in follow-up work at the two ends of targeting vector screening-gene and marker gene, thus improve the efficiency of somatic cell clone.

Accompanying drawing explanation

Fig. 1 is the structure schematic diagram of universal cattle beta-casein locus gene targeting vector;

Fig. 2 is the pcr amplification electrophoretogram of 5 ' homology arm and 3 ' homology arm, swimming lane 1:5 ' homology arm PCR primer; Swimming lane 2:3 ' homology arm PCR primer; M:Marker.

Fig. 3 is the qualification electrophoretogram of carrier p5HA; Swimming lane 1:p5HA plasmid; Swimming lane 2:p5HA single endonuclease digestion (EcoR I) product; Swimming lane 3:p5HA double digestion (EcoR I, BamH I) product; M:Marker.

Fig. 4 is the qualification electrophoretogram of carrier pHA; Swimming lane 1:pHA plasmid; Swimming lane 2:pHA single endonuclease digestion (EcoR I) product; Swimming lane 3:pHA double digestion (EcoR I, Hind III) product; M:Marker.

Fig. 5 is qualification carrier pHA-SM electrophoretogram, swimming lane 1:pHA-SM plasmid; Swimming lane 2:pHA-SM single endonuclease digestion (Acc III) product; Swimming lane 3:pHA-SM single endonuclease digestion (Avr II) product; Swimming lane 4:pHA-SM single endonuclease digestion (Bgl II) product; Swimming lane 5:pHA-SM single endonuclease digestion (Cla I) product; Swimming lane 6:pHA-SM single endonuclease digestion (Nhe I) product; Swimming lane 7:pHA-SM single endonuclease digestion (Xho I) product; Swimming lane 8:pHA-SM single endonuclease digestion (Mlu I) product; Swimming lane 9:pHA-SM single endonuclease digestion (Sal I) product; M:Marker.

Fig. 6 is qualification carrier pHA-SMN electrophoretogram, swimming lane 1:pHA-SMN single endonuclease digestion (Bgl II) product; Swimming lane 2:pHA-SMN double digestion (Bgl II, Mlu I) product; M:Marker.

Fig. 7 is qualification carrier pTCSN2 electrophoretogram, swimming lane 1:pTCSN2 single endonuclease digestion (Acc III) product; Swimming lane 2:pHA-SMN double digestion (Vsp I, Mlu I) product; M:Marker.

Fig. 8 is targeting vector pTCSN2 and Zinc finger nuclease cotransfection bovine fetal fibroblast, A: light field; B: details in a play not acted out on stage, but told through dialogues

Fig. 9 is that the positive colony PCR of G418 screening identifies, M:Marker; 1-24 swimming lane: positive colony.Upstream primer is located at 5 ' homology arm upstream (5 '-TTATGTGGGACAAAGGGGAGA-3 '), and downstream primer is located at 3 ' homology arm downstream (5 '-CAGGCTCCTCCTCTATGGGATTTT-3 ').

Figure 10 is the electrophoretogram of checking Loxp functional nucleotide sequence, M:Marker; Swimming lane 1: cell of not practicing shooting; Swimming lane 2: target practice cell untransfected Cre enzyme; Swimming lane 3: target practice cell transfecting Cre enzyme.

Figure 11 be checking shear splicing site (SA) function, A: carrier pEGFP-EI and carrier pEGFP-EIS build explanatory view; B: bovine fetal fibroblast transfection pEGFP-EI; C: bovine fetal fibroblast transfection pEGFP-EIS.

Figure 12 is the plasmid map of targeting vector pTCSN2.

Embodiment

First the present invention builds the tracheal epithelial cell specific expression vector Muc1-EGFP-HBD3 containing HBD3 and green fluorescent protein (EGFP) gene, then exogenous expression's carrier Muc1-EGFP-HBD3 is imported bovine fetal fibroblast by electricity consumption infection protocol, the expression of fluorescence microscope marker gene EGFP, and obtain positive cell through G418 screening, through PCR qualification, confirm that goal gene HBD3 is incorporated into the genome of bovine fetal fibroblast; Finally, the bovine fetal fibroblast of transfection HBD3 gene is moved into ox enucleation oocyte as nuclear donor, obtain transgene clone embryo.

Concrete involved reagent and material as follows: G418, DMEM substratum purchased from American GIBICO (Invitrogen) company, EDTA and Trypsin purchased from American Sigma company, foetal calf serum is purchased from GIBICO (Invitrogen) company, Tissue Culture Plate and culture dish are Denmark Nunclon Products, plasmid extraction kit is purchased from Shanghai bio-engineering corporation, cellular genome extracts test kit purchased from Tian Gen company, Hot start archaeal dna polymerase and T4DNA ligase enzyme are purchased from Takara company, electrotransfection instrument (ECM2001) purchased from American BTX company, restriction enzyme is purchased from MBI company. i Reduced Serum Media is purchased from Invitrogen company.

Below in conjunction with the drawings and specific embodiments, the present invention is described in further detail, and the explanation of the invention is not limited.

1, the determination of homology arm sequence and homologous recombination protocol thereof

1) with cattle beta-casein site for integration site, Zinc finger nuclease is utilized to produce double-strand break (DSB) in Zinc finger nuclease identification place (only having place's recognition site) of cattle beta-casein site intron 2, respectively increase the homologous sequence of 700 ~ 800bp as 5 ' homology arm and 3 ' homology arm in broken site upstream and downstream, concrete upstream amplification 5 ' homology arm 745bp, downstream amplification 3 ' homology arm 789bp.The method of homologous recombination is utilized to be incorporated into by goal gene on somatic target site CSN2.

Zinc refers to that rnase (ZFN) is made up of a DNA differential threshold and a non-specific nucleic acid restriction endonuclease.DNA differential threshold is composed in series (general 3 ~ 4) by a series of Cys2-His2 zinc finger protein (zinc-fingers), each zinc finger protein identification in conjunction with a special triplet base.The DNA that 96 amino-acid residues that the non-specific nucleic acid restriction endonuclease be connected with zinc finger protein group is held from the C of FokI form shears territory.FokI is a kind of restriction enzyme from Flavobacterium okeanokoites, only just there is digestion activity when dimer state, each FokI monomer is connected with a zinc finger protein group formation ZFN, identify specific site, as two recognition sites (6 ~ 8bp) when appropriate distance, two monomer ZFN interactions produce enzyme and cut function.Thus reach the object of DNA fixed point shearing.

Zinc finger nuclease can be cut at the specific site of gene order and open a gap, the DNA repair mechanism in activating cells.By homologous recombination, or nonhomologous end joint realizes efficient gene knockout or insertion.Traditional gene Knockout depends on abiogenous homologous recombination in cell, and its efficiency is very low, is generally 10 ^-6level.And the present invention produces breach by Zinc finger nuclease at the specific site of DNA, engaged by homologous recombination end and realize gene knockout, thus substantially increase the efficiency of gene knockout.

2) splicing site (SA), multiple clone site (MCS) is sheared

Further the downstream of 5 ' homology arm design shear splicing site (SA), shear splicing site (SA) insertion be convenient to the mRNA after transcribing rear mRNA(homologous recombination) correct splicing.Multiple clone site (MCS) is rare restriction enzyme site, thus is convenient to different goal gene to be inserted in targeting vector.

3) design of screening-gene and Lxop sequence

Screening-gene (neo) and marker gene (EGFP) are inserted between 5 ' homology arm and 3 ' homology arm respectively, wherein, add Loxp sequence in the same way at screening-gene (neo) and marker gene (EGFP) two ends, the Loxp sequence inserted in the same way is convenient to remove screening-gene and marker gene.

2, the carrier used by vector construction and reagent

1) carrier:

pMD19-T(TAKARA)，pMCIneopolyA(stratagen)，pEGFP-C1(Clontech)

2) bacterial strain: DH5 α (TAKARA)

3) reagent: restriction endonuclease (NEB company), T4DNA ligase enzyme (TAKARA), the little extraction reagent kit of plasmid (the raw work in Shanghai), glue reclaims test kit (the raw work in Shanghai), LAtaq enzyme (TAKARA), dNTP(TAKARA), G418 (SIGMA company).

4) following primer is synthesized:

P5HA1：5’-GGAATTCCCCAGAATCTAAGACATATC-3’

P5HA2：5’-GGGATCCTGAGATAGTGGATGAACGT-3’

P3HA1：5’-GGTCGACTATGGGACCACAAGTCTGAG-3’

P3HA2：5’-GAAGCTTTGCCTCTGAATGAACACTAT-3’

3, building process and method (as shown in Figure 1)

1) EcoR I restriction enzyme site is introduced with primer P5HA1() and P5HA2(introducing BamH I restriction enzyme site) for amplimer; with cow genome group for template amplification 5 ' homology arm sequence; gel reclaims PCR primer (its electrophoresis result as shown in Figure 2), and the nucleotide sequence of 5 ' the homology arm sequence increased is as shown in SEQ.ID.NO.1.

EcoR I, BamH I double digestion PCR primer and pMD19-T carrier, 0.8% gel reclaims PCR digestion products and enzyme cuts carrier pMD19-T, T4DNA ligase enzyme connects PCR digestion products and enzyme cuts carrier pMD19-T, 4 DEG C are spent the night, transformation of E. coli DH5 α, qualification exact connect ion mono-clonal, name carrier is p5HA; Qualification result as shown in Figure 3, shows that p5HA successfully constructs.

2) Sal I restriction enzyme site is introduced using primer P3HA1() and P3HA2(introducing Hind III restriction enzyme site) as primer; with cow genome group for template amplification 3 ' homology arm sequence; gel reclaims PCR primer (electrophoresis result as shown in Figure 2), and the nucleotide sequence of 3 ' homology arm sequence is as shown in SEQ.ID.NO.2.

Sal I, Hind III double digestion 3 ' homology arm sequence PCR primer and carrier p5HA, 0.8% gel reclaims PCR digestion products and enzyme cuts carrier p5HA, T4DNA ligase enzyme connects PCR digestion products and enzyme cuts carrier p5HA, 4 DEG C are spent the night, transformation of E. coli DH5 α, qualification exact connect ion mono-clonal, name carrier is pHA; Qualification result as shown in Figure 4, shows that pHA successfully constructs.

3) synthesis is containing the sequence shearing splicing site (SA) and multiple clone site (MCS), the nucleotide sequence that this sequence is (namely shown in SEQ.ID.NO.3, Nanjing Jin Sirui company specifically can be entrusted to synthesize) as follows:

GGATCC TAGGAAAATATTTAATAATGAGTTGACTGTGGGAACTAAA GTGTTTTTTTTTCTCTTTAGTCCGGAGGGCCCCCTAGGTGATCAAGATCTATCGATGGCCGGCCGCTAGCCGTACGATAACTTCGTATAATGTATGCTATACGAAGTTATCTCGAGATTAATACGCGTATAACTTCGTATAATGTATGCTATACGAAGTTATGTCGAC；

The sequence of line, for shearing splicing site (SA), is thereafter the sequence of multiple clone site (MCS), and the restriction enzyme site order of this section of sequence is: Acc III, Apa I, Avr II, Bcl I, Bgl II, Cla I, Fse I, Nhe I, Spl I, Loxp1, Xho I, Vsp I, Mlu I, Loxp2, Sal I, sequence also has except the restriction enzyme site of rareness the palindromic sequence Loxp of two sections of 34bp, utilizes BamH I and Sal I site to be cloned on carrier pHA after this sequent synthesis, qualification exact connect ion mono-clonal, name carrier is pHA-SM; Qualification result as shown in Figure 5, shows that pHA-SM successfully constructs.

Wherein shear correct shearing and splicing that splicing site SA ensures post-transcriptional homologous recombination mRNA.And interested goal gene fixed point is inserted in targeting vector by multiple clone site (MCS).Palindromic sequence Loxp comprises Loxp palindromic sequence Loxp1 and Loxp2 in the same way, under the effect of Cre enzyme, between Loxp1 and Loxp2, Site-specific recombinase occurs, and effectively can excise the sequence between Loxp1 and Loxp2

Further, SV40PLOYA sequence (its sequence is as shown in SEQ.ID.NO.4) is also set after MCS, after its sequence of synthesis (can synthesize by Nanjing Jin Sirui company) be directly inserted into Spl I site of MCS, its effect is that termination is inserted in transcribing of goal gene in MCS.

4) utilize Xho I, Sal I double digestion carrier pMCIneoployA obtains antibiotic-screening gene (neo), gel reclaims (neo) gene, cut carrier pHA-SM with Xho I enzyme and 0.8% gel recovery skeleton carrier simultaneously, T4DNA ligase enzyme connects neo gene and glue recovery enzyme cuts skeleton carrier pHA-SM, 4 DEG C are spent the night, transformation of E. coli DH5 α, qualification exact connect ion mono-clonal is (see Fig. 6, wherein neo gene is inserted into Xho I restriction enzyme site place in Loxp1 downstream in carrier pHA-SM), name carrier is pHA-SMN.

It should be noted that PTK is the promotor of neo, shear from carrier pMCIneoployA together with neo gene, for starting the expression of neo gene.

5) EGFP is inserted in the upstream of the Loxp2 of pHA-SMN carrier

Vsp I, Mlu I double digestion carrier pEGFP-C1 obtain fluorescent marker gene EGFP, glue reclaims EGFP gene, cut carrier pHA-SMN with identical enzyme enzyme and 0.8% gel recovery skeleton carrier fragment simultaneously, T4DNA ligase enzyme linkage flag gene (EGFP) and glue reclaim enzyme and cut skeleton carrier pHA-SMN, 4 DEG C are spent the night, transformation of E. coli DH5 α, qualification exact connect ion mono-clonal (qualification result is shown in Fig. 7), name carrier is pTCSN2.

4, the transfection of carrier and checking

1) by carrier pTCSN2 and Zinc finger nuclease expression vector (purchased from Sigma) cotransfection bovine fetal fibroblast, the method cotransfection bovine fetal fibroblast of concrete employing electroporation.The Zinc finger nuclease that Zinc finger nuclease expression vector is expressed produces double-strand break in bovine fetal fibroblast genome C SN2 site, promotes targeting vector pTCSN2 and genome generation homologous recombination.

2) the cell expressing green fluorescent protein (expression of results is as shown in Figure 8) of Successful transfection, the cell of transfection is at medicine G418(600 μ g/ml) effect under can filter out the positive colony cell of stable transfection.Transfection after 48 hours under fluorescent microscope microscopy, the cell of transfection targeting vector can observe the expression of green fluorescent protein.The cell of stable transfection targeting vector, owing to have expressed neomycin resistance gene neo, has resistance to G418.And do not have the meeting under the effect of 600 μ g/ml of the cell of stable transfection targeting vector dead, G418 therefore can be utilized to filter out the positive colony cell of stable transfection.

3) utilize the method for homology arm outside P CR can identify the positive colony cell that homologous recombination occurs, positive clone identification result as shown in Figure 9.

In homology arm outside P CR detects:

Upstream primer (5 '-TTATGTGGGACAAAGGGGAGA-3 ') is located at 5 ' homology arm upstream, and downstream primer is located at 3 ' homology arm downstream (5 '-CAGGCTCCTCCTCTATGGGATTTT-3 ').

The cell clone that homologous recombination occurs can amplify 1900bp and 5700bp two band, and 1900bp is the allelotrope of wild-type, and 5700bp is the allelotrope (result as shown in Figure 9) knocking in foreign gene.

4) function of Loxp sequence will be verified in the positive colony cell of the Cre zymoprotein transfection generation homologous recombination of purifying

The Cre zymoprotein of purifying is added in cell culture fluid, concentration 150ng/ml, cultivates 72 hours; The genome of the positive colony cell of transfection Cre enzyme and the positive colony cell of untransfected Cre enzyme is extracted, the sequence between design primer amplification Loxp after 72 hours:

Upstream primer P1:5 '-GCCCAGTCATAGCCGAATAGC-3 ',

Downstream primer P2:5 '-TTTAGTTCCCACAGTCAACTCA-3 '

The gel electrophoresis spectrum of more as shown in Figure 10 two groups, weak obviously than untransfected Cre enzyme of the positive colony cell amplification finding transfection Cre enzyme 2600bp fragment out, illustrate Loxp sequence with Cre role of apoenzyme after, can practice shooting in the genome successfully remove screening and marker gene.

5) by the sequence clone of Zinc finger nuclease identification cleavage site in the CSN2 Second Exon translation initiation site ATG to intron 2 in 5 ' homology arm sequence in targeting vector pTCSN2 and be inserted into carrier pEGFP-N1(purchased from CLONTECH company) multiple clone site, carrier construction pEGFP-EI(is shown in Figure 11), CSN2 Second Exon translation initiation site ATG in 5 ' homology arm sequence in targeting vector is inserted into carrier pEGFP-N1 multiple clone site to the sequence clone shearing splicing site (SA), carrier construction pEGFP-EIS(is shown in Figure 12), wherein CSN2 Second Exon translation initiation site ATG is positioned at 5 ' homology arm the 514th base place.

Respectively by carrier pEGFP-EI and carrier pEGFP-EIS transfection bovine fetal fibroblast (see Figure 11) respectively, the cell redgreen fluorescent protein expression of transfection pEGFP-EI, and the cell of transfection pEGFP-EIS has egfp expression, illustrate that shearing splicing site (SA) has function, correct shearing splicing after the goal gene of insertion targeting vector pTCSN2 multiple clone site can being made to complete transcribe, thus give expression to the target protein of needs.

Claims (6)

1. a universal cattle beta-casein locus gene targeting vector, it is characterized in that, comprise 5 ' homology arm and 3 ' homology arm, respectively extend the homologous sequence of 700 ~ 850bp as 5 ' homology arm and 3 ' homology arm using the upstream and downstream of cattle beta-casein site intron 2 Zinc finger nuclease recognition site;

The nucleotide sequence of 5 ' described homology arm is as shown in SEQ.ID.NO.1, and the nucleotide sequence of 3 ' homology arm is as shown in SEQ.ID.NO.2;

The downstream of 5 ' described homology arm is also connected with the sequence comprising and shear splicing site SA, multiple clone site and two Loxp in the same way.

2. universal cattle beta-casein locus gene targeting vector as claimed in claim 1, is characterized in that, be also inserted with SV40 PolyA sequence between described multiple clone site.

3. universal cattle beta-casein locus gene targeting vector as claimed in claim 1, it is characterized in that, be also provided with following element successively between the sequence of described two Loxp in the same way: PTK promotor, antibiotic-screening gene, PolyA, CMV promoter, fluorescent marker gene and SV40 PolyA.

4. universal cattle beta-casein locus gene targeting vector as claimed in claim 1, it is characterized in that, 5 ' described homology arm and 3 ' homology arm are implemented on pMD19-T carrier, between 5 ' homology arm and 3 ' homology arm, be also provided with following element successively: shear splicing site SA, multiple clone site, SV40PolyA, Loxp1, PTK promotor, antibiotic-screening gene, PolyA, CMV promoter, fluorescent marker gene, SV40 PolyA and Loxp2.

5. the universal cattle beta-casein locus gene targeting vector as described in claim 3 or 4, it is characterized in that, described antibiotic-screening gene is neo, and fluorescent marker gene is EGFP.

6. a construction process for universal cattle beta-casein locus gene targeting vector, is characterized in that, comprise the following steps:

1) using primer P5HA1, P5HA2 as primer pair, with cow genome group for template amplification 5 ' homology arm sequence, gel reclaims PCR primer; Double digestion PCR primer is connected with T4DNA ligase enzyme after pMD19-T carrier, carrier construction p5HA;

2) using primer P3HA1, P3HA2 as primer pair, with cow genome group for template amplification 3 ' homology arm sequence, gel reclaims PCR primer; Double digestion PCR primer is connected with T4DNA ligase enzyme after carrier p5HA, carrier construction pHA;

3) sequence of synthesis as shown in SEQ.ID.NO.3, and by the downstream of 5 ' homology arm in this sequence clone to carrier pHA, carrier construction pHA-SM;

4) the screening-gene neo in cloning vector pMCIneoployA and promotor thereof, and the sequence that double digestion is cloned is connected with T4DNA ligase enzyme after carrier pHA-SM, carrier construction pHA-SMN;

5) the marker gene EGFP in cloning vector pEGFP-C1 and promotor thereof, and the sequence that double digestion is cloned is connected with T4DNA ligase enzyme after carrier pHA-SMN, builds and obtains carrier pTCSN2;

P5HA1：5’-GGAATTCCCCAGAATCTAAGACATATC-3’

P5HA2：5’-GGGATCCTGAGATAGTGGATGAACGT-3’

P3HA1：5’-GGTCGACTATGGGACCACAAGTCTGAG-3’

P3HA2：5’-GAAGCTTTGCCTCTGAATGAACACTAT-3’

。