CN102660642A - Screening system for screening zinc finger protein - Google Patents
Screening system for screening zinc finger protein Download PDFInfo
- Publication number
- CN102660642A CN102660642A CN2012101228853A CN201210122885A CN102660642A CN 102660642 A CN102660642 A CN 102660642A CN 2012101228853 A CN2012101228853 A CN 2012101228853A CN 201210122885 A CN201210122885 A CN 201210122885A CN 102660642 A CN102660642 A CN 102660642A
- Authority
- CN
- China
- Prior art keywords
- screening
- zinc finger
- preport
- finger protein
- egfp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention discloses a screening system for screening zinc finger protein. The screening system comprises two reporting carriers, namely pReport-N1-LacZ and pReport-N2-EGFP and one activate carrier, namely pAD-RNAP-alpha-GAL4. By constructing matching of three elements, constructing two sets of screening systems and by using the matching of the three elements, the relevance of zinc finger protein and zinc finger nuclease recognition sequence specificity recognition and report gene expression indication is achieved, and the activity of zinc finger protein screening is improved through interactive screening of the two sets of systems. Interactive verification of the two sets of systems improves specificity in zinc finger protein screening.
Description
Technical field
The invention belongs to the triage techniques field of zinc finger protein, relate to a kind of screening system that screens zinc finger protein.
Background technology
Transgenic animal have a wide range of applications, and can realize the site-directed integration of foreign gene through gene targeting, and its expression can realize that accuracy controlling does not influence host bacteria autogene expression regulation.Gene targeting mainly depends on homologous recombination, and the homologous recombination odds is very low under the natural condition, is about one of 1,000,000, and this has just limited this broad application greatly.How improving gene targeting efficient has become the emphasis and the focus of present research.
Zinc finger protein is one type of transcription factor with finger-shaped structural domain, has important effect at aspects such as gene expression regulation, cytodifferentiation, fetal development, enhancement of plant resistance.Discoveries such as Kim in 1996; With the cutting structure territory of no specific recognition effect among the zinc fingers of known identification specific DNA sequence and the restriction enzyme FokI through " linker " amalgamation and expression; Can be combined into a new restriction enzyme-Zinc finger nuclease (zinc finger nuclease; ZFN), identification is determined by wherein zinc fingers with cleavage site.
ZFN is made up of two portions, comprises that a DNA combines territory and a non-specific endonuclease.Its principle of work is that DNA combines the territory to combine with specific dna structure, and the non-specific endonuclease that is attached thereto is brought into play shearing action thereupon, produces fracture at binding site, promotes homologous recombination, improves rite-directed mutagenesis and frequency of replacement.Research shows, can improve gene targeting efficient through the specificity Zinc finger nuclease.The key of Zinc finger nuclease is to screen the zinc finger protein of high specific, high-affinity.
The acquisition methods of zinc finger protein mainly contains sieve method and module construction from part.The advantage of module construction from part is simple and easy quick: simply each zinc finger print piece is connected and be used for the recognition objective sequence.Shortcoming is that the conjuncted zinc of designing refers to that avidity is low or do not have avidity.Along with zinc refers to combine the further investigation of DNA mechanism, this method will become a kind of high-efficiency method; The sieve method confidence level is higher, but more consuming time than module construction from part.
Summary of the invention
The problem that the present invention solves is to provide a kind of screening system that screens zinc finger protein, utilizes the alternative existing bacteria screening of report carrier system must sequence be integrated into and carries out method for screening in the bacterial genomes, and screening process is efficiently succinct.
The present invention realizes through following technical scheme:
A kind of screening system that screens zinc finger protein comprises two report carrier pReport-N1-LacZ, pReport-N2-EGFP and an activated carrier pAD-RNAP-alpha-GAL4;
Described report carrier pReport-N1-LacZ comprises that the Zinc finger nuclease recognition sequence inserts site, ribosome bind site and promotor, is provided with reporter gene LacZ and antibiotic-screening gene in the downstream of promotor;
Described report carrier pReport-N2-EGFP comprises that the Zinc finger nuclease recognition sequence inserts site, ribosome bind site and promotor, is provided with reporter gene EGFP and antibiotic-screening gene in the downstream of promotor;
Described activated carrier pAD-RNAP-alpha-GAL4 comprises RNA polymerase α and active element GAL4.
The Zinc finger nuclease recognition sequence of described report carrier pReport-N1-LacZ inserts the nucleotide sequence of site, ribosome bind site and promotor shown in SEQ.ID.NO.1;
The Zinc finger nuclease recognition sequence of described report carrier pReport-N2-EGFP inserts the nucleotide sequence of site, ribosome bind site and promotor shown in SEQ.ID.NO.2.
Be equipped with single copy controlling elements on described report carrier pReport-N1-LacZ and the pReport-N2-EGFP.
Antibiotic-screening gene among the described report carrier pReport-N1-LacZ is the aada gene, and reporter gene LacZ is connected through the tandem expression sequence with the aada gene;
Antibiotic-screening gene among the described report carrier pReport-N2-EGFP is the aada gene, and reporter gene EGFP is connected through the tandem expression sequence with the aada gene;
The nucleotide sequence of tandem expression sequence is shown in SEQ.ID.NO.3.
RNA polymerase α among the described activated carrier pAD-RNAP-alpha-GAL4 is connected through the linker sequence of expressing the five amino acid residue with active element GAL4.
Described five amino acid residue is Gly-Ser-Ala-Ala-Ala.
Also insert the site among described report carrier pReport-N1-LacZ, the report carrier pReport-N2-EGFP and insert the Zinc finger nuclease recognition sequence through the Zinc finger nuclease recognition sequence.
Described zinc finger protein recognition sequence is a kind of shown in SEQ.ID.NO.4～SEQ.ID.NO.9.
Described report carrier pReport-N1-LacZ and activated carrier pAD-RNAP-alpha-GAL4 cotransfection constitute the LacZ reporting system in host bacteria;
Described report carrier pReport-N2-EGFP and activated carrier pAD-RNAP-alpha-GAL4 cotransfection constitute the EGFP reporting system in host bacteria.
Respectively in LacZ reporting system and EGFP reporting system transfection to be screened be provided with at random that the zinc at random of zinc finger protein and GAL11P element refers to the storehouse plasmid; Add microbiotic then and carry out screening positive clone, and go out the zinc finger protein plasmid according to the expression screening of reporter gene; The zinc finger protein plasmid that again the LacZ reporting system is screened screens through the EGFP reporting system, and the zinc finger protein plasmid that the EGFP reporting system is screened screens through the LacZ reporting system.
Compared with prior art, the present invention has following beneficial technical effects:
The screening system of screening zinc finger protein provided by the invention; Be that a kind of being applicable to from zinc at random refers to the zinc finger protein that matches, discern with the Zinc finger nuclease recognition sequence the plasmid storehouse; Through making up the cooperation of three kinds of elements; Make up two cover screening systems, improve the activity of zinc finger protein screening again through the mutual screening of this two cover system.
The ingenious cooperation that utilizes three kinds of elements, thus it is relevant to realize that zinc finger protein and Zinc finger nuclease recognition sequence specific recognition and reporter gene expression are indicated:
Promotor in the reporting system comprises inserts site and the promotor that starts the follow-up report gene, under situation about being activated, starts follow-up Laz reporter gene and EGFP reporter gene, realizes different reports;
RNAP-alpha GAL4 in the activation system, wherein GAL4 is an active element, RNAP is for starting the promotor in the reporting system;
And zinc at random to be screened refers in the plasmid of storehouse, and zinc finger protein mainly is and the combining of Zinc finger nuclease recognition sequence that Gal11p also is an active element;
When the zinc at random that will be provided with refer to the storehouse plasmid transfection to contain report carrier and activated carrier all transfection in host bacteria; If what be arranged in report carrier waits that screening the zinc finger protein binding site can refer to that certain zinc finger protein of plasmid interacts with zinc at random; Then on the activated carrier GAL4 and zinc at random refer on the plasmid of storehouse with this zinc finger protein sequence bonded GAL11P element near and combines, thereby GAL4 with impel RNA polymerase α to be combined in the promoter region activation reporter gene LacZ of report carrier or the expression of EGFP after GAL11P combines; If having interaction, recognition site to be screened and zinc finger protein can not activate reporter gene expression.
And the mutual checking of two cover systems is the mono-clonals that obtain through the screening of LacZ reporting system, extracts plasmid and changes evaluation EGFP activity in the EGFP system over to; Finger extracts plasmid and changes evaluation LacZ activity in the LacZ system over to through the mono-clonal that the screening of EGFP reporting system obtains; Improved the specificity of screening zinc finger protein through the report of two kinds of systems.
The screening system of screening zinc finger protein provided by the invention; The screening capacity is big, and efficient is high, the characteristics that toxicity is little: at first screening system utilizes single copy property of report carrier; Alternative bacteria screening system in the past must be integrated into sequence and carry out method for screening in the bacterial genomes; Screening process is efficiently succinct, and bacterial growth is fast, can be simply and detect a large amount of interactions fast so transformation efficiency is high; Secondly, use bacterium and avoided yeast etc. as the host as the host, its host protein influences the interaction between the target protein; The while eukaryotic protein changes yeast over to and can host's toxigenicity be changed over to bacterium and just reduce Cytotoxic generation.
The screening system of screening zinc finger protein provided by the invention; With the Zinc finger nuclease recognition site on the ox β casein gene is target; The Zinc finger nuclease identification half site of design on the casein gene refers to screen zinc finger protein the plasmid storehouse from zinc at random, obtains the zinc finger protein of high specific simultaneously through Streptomycin sulphate screening and LacZ and Streptomycin sulphate and two reporting systems of EGFP; And the zinc finger protein that screening obtains verifies that it is respond well on the ox inoblast.
Description of drawings
Fig. 1 is the pRport-LacZ plasmid map;
Fig. 2 is HindIII and AvrII double digestion pMD19T-T-A and pRport-N1 electrophoretogram;
Fig. 3 is the pRport-EGFP plasmid map;
Fig. 4 is HindIII and AvrII double digestion pReport-N2 and PMD19T-T-E-A electrophoretogram;
Fig. 5 is the pAD-R-G plasmid map;
Fig. 6 cuts the evaluation electrophoretogram for the pAD-R-G enzyme;
Fig. 7 is NheI and ASCI double digestion report carrier pReport-N1-T-L-A electrophoretogram;
Fig. 8 inserts the report carrier pReport-N1-T-L-A-CN evaluation collection of illustrative plates that ox casein half hitch closes the site for PCR identifies;
Fig. 9 is the Bsu36I enzyme report carrier pReport-N2-T-E-A electrophoretogram of being sure to;
Figure 10 inserts the report carrier pReport-N2-T-E-A-CN evaluation collection of illustrative plates that ox casein half hitch closes the site for PCR identifies;
To be report carrier, activated carrier refer to that with zinc at random plasmid combines the schematic diagram of screening system to Figure 11-1～11-2;
The zinc finger protein that Figure 12 obtains for the PCR evaluation and screening.
Embodiment
Below in conjunction with concrete embodiment the present invention is done further detailed description, said is to explanation of the present invention rather than qualification.
1, the structure of report carrier pReport-N1-LacZ
1.1 design overlapping primer LWP1; LWP2; LWP3; LWP4 obtains to comprise the sequence that Asc I and two restriction enzyme sites of Nhe I (the Zinc finger nuclease recognition sequence being inserted through these two restriction enzyme sites) reach-35 ,-10 (weak promoter), lac operator (lactose promotor operon) and RBS (ribosome bind site) primary element through overlapping PCR; Described primer is specially:
LWP-1：gtacatgcat?gctgtggaag?ggcgcgcctg?gctcgtaggc?cgctagc；
LWP-2：cggaagcata?aagtgtaaag?cccggggtgc?ctaatgctag?cggcctacg；
LWP-3：ctttatgctt?ccggctcgta?tgttgtgtcg?aattgtgagc?ggataac；
LWP-4：cggcctaggc?ataagctttt?cctgtgtgaa?attgttatcc?gctcac。
Increase respectively LWP12 and LWP34 fragment of the first round; Its amplification condition is respectively:
LWP14ul；LWP24ul；pfu?Mix(2x)25ul；ddH
2O?17ul；
LWP34ul；LWP2/LWP44ul；pfu?Mix(2x)25ul；ddH
2O?17ul；
Amplification program is: 95 ℃ of 3min; 95 ℃ of 30s, 50 ℃ of 30s, 72 ℃ of 30s, 10cycle; 72 ℃ of 10min;
Second takes turns amplification LWP1234 fragment; Its amplification condition is:
LWP1212.5ul；LWP3412.5ul；pfu?Mix(2x)12.5ul；ddH
2O?12.5ul；
Amplification program is: 95 ℃ of 3min; 95 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 30s, 10cycle; 72 ℃ of 10min;
Third round amplification LWP fragment; Its amplification condition is:
LWP12341ul；LWP15ul；LWP45ul；pfu?Mix?12.5ul；ddH
2O?12.5ul；
Amplification program is: 95 ℃ of 3min; 95 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s, 30cycle; 72 ℃ of 10min;
The LWP fragment PCR products with 2.5% agarose electrophoresis after, reclaim test kit with glue and reclaim the 149bpDNA fragment.
After carrier pReport and LWP fragment used AvrII and SphI double digestion respectively, obtain carrier pReport-N1 after connecting (16 ℃ of water-baths spend the night connection) with the T4 ligase enzyme.Wherein N1 representes constructed promotor, and its nucleotide sequence is realized the insertion (two restriction enzyme sites of Asc I and Nhe I) of Zinc finger nuclease recognition sequence and the startup of lacz reporter gene through it shown in SEQ.ID.NO.1.
The pReport-N1 carrier is transformed DH5 α competent cell.Converted product is uniformly coated in the flat board of the LB solid medium that contains 100ug/ml amp, after 12h is cultivated in 37 ℃ of inversions, chooses single bacterium colony, after identifying through bacterium colony PCR, choose correct single bacterium colony order-checking.Choose the correct single bacterium colony of order-checking, cultivate 100ml bacterium liquid, extract plasmid with extraction reagent kit among the OMGA.
1.2 with carrier pMD19T is basic framework series connection aada gene and the gene constructed pMD19T-T-L-A carrier of lacz
1.2.1 design primer TES-1, TES-2 are through overlapping pcr amplification TES sequence; TES-1, TES-2 are specially:
TES-15′GCCGTCGACTAACCGGGCAGGCCATGTCTGCCCGTATTTCG 3′
TES-25′CGCGGATCCTTTCCTTACGCGAAATACGGGCAGACATGG 3′
The amplification system of TES sequence is: pfu Mix 25ul; TES-15ul; TES-25ul; DdH
2O15ul;
Amplification program is: 95 ℃ of 3min; 95 ℃ of 30s, 57 ℃ of 30s, 72 ℃ of 15s, 10cycle; 72 ℃ of 4min; The TES sequence that finally obtains is shown in SEQ.ID.NO.3;
After reclaiming the TES sequence of amplification, use BamH I and Sal I double digestion carrier PMD-19T and TES sequence respectively, with obtaining carrier PMD19T-T after Solution I (the Takara code D6022A) connection (16 ℃ of water-baths spend the night connection);
The PMD19T-T carrier is transformed DH5 α competent cell; Converted product is uniformly coated in the flat board of the LB solid medium that contains 100ug/ml amp, after 12h is cultivated in 37 ℃ of inversions, chooses single bacterium colony; After bacterium colony PCR evaluation, choose correct single bacterium colony order-checking.Choose the correct single bacterium colony of order-checking, cultivate 100ml bacterium liquid, extract plasmid with extraction reagent kit among the OMGA.
1.2.2 design primer Sm-F, Sm-R are template amplification aada fragment with carrier pCDFDuet-1, Sm-F, Sm-R are specially:
Sm-F：ggggatccat?gagggaagcg?gtgat；
Sm-R：gctgaattcc?taggtcaggc?atttgagaag?c；
Amplification program is: 95 ℃ of 3min; 95 ℃ of 45s, 53 ℃ of 30s, 72 ℃ of 90s, 30cycle; 72 ℃ of 4min;
After reclaiming the aada fragment of amplification; Respectively with EcoR I and two carrier pMD19T-T and the aada fragments of cutting of BamH I; Inserting Streptomycin sulphate expressing gene (aada) in TES fragment downstream, with obtaining carrier PMD19T-T-A after the Solution I connection (Takara code D6022A) (16 ℃ of water-baths spend the night connection);
The PMD19T-T-A carrier is transformed DH5 α competent cell; Converted product is uniformly coated in the flat board of the LB solid medium that contains 100ug/ml amp, after 12h is cultivated in 37 ℃ of inversions, chooses single bacterium colony; After bacterium colony PCR evaluation, choose correct single bacterium colony order-checking.Choose the correct single bacterium colony of order-checking, shake bacterium, extraction reagent kit extracts plasmid.
1.2.3 the design primer is template amplification LacZ gene to LacZ-F, LacZ-R with carrier pLenti6/V5-GW/lacZ, LacZ-F, LacZ-R are specially:
LacZ-F：gggcagcga?agcttatgat?agatcccgtc?g；
LacZ-R：cgcggtcgac?ttattatttt?tgacaccaga?cca；
Amplification program is: 95 ℃ of 3min; 95 ℃ of 45s, 60 ℃ of 30s, 72 ℃ of 5min, 30cycle; 72 ℃ of 10min;
Reclaim the LacZ of amplification; Respectively with Sal I and two carrier pMD19T-T-A and the LacZ of cutting of Sph I; Inserting the reading frame of LacZ gene at the TES sequence upper reaches, with obtaining carrier PMD19T-T-L-A after Solution I (Takara codeD6022A) connection (16 ℃ of water-baths spend the night connection);
The PMD19T-T-L-A carrier is transformed DH5 α competent cell; Converted product is uniformly coated in the flat board of the LB solid medium that contains 100ug/ml amp, after 12h is cultivated in 37 ℃ of inversions, chooses single bacterium colony; After bacterium colony PCR evaluation, choose correct single bacterium colony order-checking.Choose the correct single bacterium colony of order-checking, shake bacterium, extraction reagent kit extracts plasmid.
1.2.3 through HindIII and AvrII double digestion pReport-N1 and pMD19T-T-L-A carrier; Reclaim respective segments, connect two fragments and obtain basic report carrier pReport-N1-LacZ (pReport-N1-T-L-A) with Solution I (Takara code D6022A) connection (16 ℃ of water-baths spend the night connection).Its plasmid map is as shown in Figure 1, can see that the arrangement of element of above-mentioned structure is following: N1 promotor (RBS, Asc I/Nhe I restriction enzyme site and-35 ,-10, lac operator) lacZ, TES, Aada.
Constructed pReport-N1 and pMD19T-T-L-A double digestion collection of illustrative plates are as shown in Figure 2, and wherein M is Trans15K.Swimming lane 1 is the pMD19T-T-L-A vector plasmid; Swimming lane 2,3 is HindIII and AvrII double digestion pMD19T-T-L-A carrier result, and size is 4071bp; Swimming lane 4,5 is HindIII and AvrII double digestion pReport-N1 result, and size is 12309bp; Swimming lane 6 is a pReport-N1 plasmid band.
The pReport-LacZ carrier is transformed DH5 α competent cell; Converted product is uniformly coated in the flat board of the LB solid medium that contains 100ug/ml amp, after 12h is cultivated in 37 ℃ of inversions, chooses single bacterium colony; After bacterium colony PCR evaluation, choose correct single bacterium colony order-checking.Choose the correct single bacterium colony of order-checking, shake bacterium, extraction reagent kit extracts plasmid.
2, the structure of carrier pReport-N2-EGFP
2.1 design overlapping primer EWP-1, EWP-2, EWP-3, EWP-4, obtain the sequence of continuous two Bsu36I restriction enzyme sites and-35 ,-10, lac operator and RBS primary element through overlapping PCR, described primer is specially:
EWP-1：gccatcgatt?gtggaagggc?gcgcctggct?cgtaggccgc?atgc；
EWP-2：cggaagcata?aagtgtaaag?cccggggtgc?ctaatcctaa?ggggcctac；
EWP-3：ctttatgctt?ccggctcgta?tgttgtgtcg?aattgtgagc?ggataac；
EWP-4：cggcctaggc?ataagctttt?cctgtgtgaa?attgttatcc?gctcac；
Increase respectively EWP12 and EWP34 fragment of the first round; Its amplification condition is respectively:
EWP14ul；EWP24ul；pfu?Mix(2x)25ul；ddH
2O?17ul；
EWP34ul；EWP2/LWP44ul；pfu?Mix(2x)25ul；ddH
2O?17ul；
Amplification program is: 95 ℃ of 3min; 95 ℃ of 30s, 50 ℃ of 30s, 72 ℃ of 30s, 10cycle; 72 ℃ of 10min;
Second takes turns amplification EWP1234 fragment; Its amplification condition is:
EWP1212.5ul；EWP3412.5ul；pfu?Mix(2x)12.5ul；ddH
2O?12.5ul；
Amplification program is: 95 ℃ of 3min; 95 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 30s, 10cycle; 72 ℃ of 10min;
Third round amplification EWP fragment; Its amplification condition is:
EWP12341ul；LWP15ul；LWP45ul；pfu?Mix?12.5ul；ddH
2O?12.5ul；
Amplification program is: 95 ℃ of 3min; 95 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s, 30cycle; 72 ℃ of 10min;
The EWP fragment PCR products with 2.5% agarose electrophoresis after, reclaim test kit with glue and reclaim the 146bpDNA fragment.
After carrier pReport and EWP fragment used AvrII and Sph I double digestion respectively, obtain carrier pReport-N2 after connecting (16 ℃ of water-baths spend the night connection) with the T4 ligase enzyme.Wherein N2 representes constructed promotor, and its nucleotide sequence is realized the insertion (two Bsu36I enzymes are cut a site) of Zinc finger nuclease recognition sequence and the startup of EGFP reporter gene through it shown in SEQ.ID.NO.2.
The pReport-N2 carrier is transformed DH5 α competent cell.Converted product is uniformly coated in the flat board of the LB solid medium that contains 100ug/ml amp, after 12h is cultivated in 37 ℃ of inversions, chooses single bacterium colony, after identifying through bacterium colony PCR, choose correct single bacterium colony order-checking.Choose the correct single bacterium colony of order-checking, cultivate 100ml bacterium liquid, extract plasmid with extraction reagent kit among the OMGA.
2.2 with carrier pMD19T is basic framework series connection aada gene and the gene constructed pMD 19T-T-E-A of EGFP carrier
2.2.1 the design primer is template amplification EGFP gene to EGFP-F, EGFP-R with carrier pEGFP-C1, EGFP-F, EGFP-R are specially:
EGFP-F：gctgcatgcg?aagcttagg?tgagcaaggg；
EGFP-R：ggagtcgact?tattacttgt?acagctcgtc?catgcc；
Amplification program is: 95 ℃ of 3min; 95 ℃ of 45s, 60 ℃ of 30s, 72 ℃ of 90s, 30cycle; 72 ℃ of 10min;
Reclaim the EGFP of amplification, respectively with two carrier pMD19T-T-A and the EGFP of cutting of Sal I and Sph I, with Solution I connection (16 ℃ of water-baths spend the night connection), thereby insertion EGFP in the TES sequence upper reaches obtains carrier PMD19T-T-E-A;
The PMD19T-T-E-A carrier is transformed DH5 α competent cell; Converted product is uniformly coated in the flat board of the LB solid medium that contains 100ug/ml amp, after 12h is cultivated in 37 ℃ of inversions, chooses single bacterium colony; After bacterium colony PCR evaluation, choose correct single bacterium colony order-checking.Choose the correct single bacterium colony of order-checking, shake bacterium, extraction reagent kit extracts plasmid.
2.2.2 through HindIII and Avr II double digestion pReport-N2 and PMD19T-T-E-A carrier; Reclaim respective segments, connect two fragments and obtain basic report carrier pReport-N2-EGFP (pReport-N2-T-E-A) with Solution I connection (16 ℃ of water-baths spend the night connection).Its plasmid map is as shown in Figure 2, can see that the arrangement of element of above-mentioned structure is following: N2 promotor (RBS, two Bsu36I restriction enzyme sites and-35 ,-10, lac operator) EGFP, TES (tandem expression sequence), Aada.
Double digestion pReport-N2 and PMD19T-T-E-A carrier collection of illustrative plates are as shown in Figure 4: wherein M is frans15k; Swimming lane 1 is cut with AvrII pair by HindIII for pReport-N2, and the size after its pair cuts is 12461bp; Swimming lane 2 is cut big or small 1731bp its pair cut after by HindIII with AvrII pair for PMD19T-T-E-A.
The pReport-EGFP carrier is transformed DH5 α competent cell; Converted product is uniformly coated in the flat board of the LB solid medium that contains 100ug/ml amp, after 12h is cultivated in 37 ℃ of inversions, chooses single bacterium colony; After bacterium colony PCR evaluation, choose correct single bacterium colony order-checking.Choose the correct single bacterium colony of order-checking, shake bacterium, extraction reagent kit extracts plasmid.
3, the structure of activated carrier pAD-RNAP-alpha GAL4 (pAD-R-G)
3.1 with carrier pBD-LGF2 is template amplification Gal4 fragment, amplimer is:
Gal4-F：ggcgcggccg?cagaatcaa；
Gal4-R：ctcgaactag?ttcaaaataa?tcctgttaac?aat；
Amplification program is: 95 ℃ of 3min; 95 ℃ of 30s, 57 ℃ of 45s, 72 ℃ of 45s, 35cycle; 72 ℃ of 10min;
Reclaim the Gal4 of amplification, with Not I and two carrier pTRG and the Gal4 of cutting of Spe I, the T4DNA ligase enzyme obtains carrier pTRG-R-G after spending the night for 16 ℃ and connecting respectively;
The pTRG-R-G carrier is transformed DH5 α competent cell, converted product is uniformly coated in the flat board of the LB solid medium that contains 100ug/ml amp, after 12h is cultivated in 37 ℃ of inversions, choose single bacterium colony, identify, choose correct single bacterium colony order-checking through bacterium colony PCR.Choose the correct single bacterium colony of order-checking, shake bacterium, extraction reagent kit extracts plasmid.
3.2 with the pTRG-R-G carrier is template amplification RNAP-alpha GAL4, amplimer is:
28R-F：ctcgaattca?aataagtgcc?ttcccatca；
28R-R：gcgagatctc?gctcagtgga?acgaaaa；
Amplification program is: 95 ℃ of 3min; 95 ℃ of 45s, 60 ℃ of 45s, 72 ℃ of 90s, 30cycle; 72 ℃ of 10min;
Reclaim the RNAP-alpha GAL4 of amplification, with BglII and two carrier pAD and the RNAP-alpha GAL4 of cutting of NcoI, the T4DNA ligase enzyme obtains carrier pAD-R-G after spending the night for 16 ℃ and connecting respectively; Its plasmid map is as shown in Figure 5, can see that object component RNAP-alpha GAL4 is cloned into corresponding position.It is as shown in Figure 6 that its enzyme is cut qualification result: M1 is Trans 2k plus DNA Marker; M2Trans 15k DNA Marker; 1,2 cut the result for two different mono-clonal enzymes of pAD-R-G activated carrier, two clip size are respectively 5582bp and 885bp.
4, in order to verify above-mentioned two report carriers, the concrete Zinc finger nuclease recognition site with on the ox β casein gene is a target, designs the Zinc finger nuclease identification half site on the following casein gene:
Following three the Zinc finger nuclease recognition site CNS1 of concrete design, CNS2, CNS3 (respectively shown in SEQ.ID.NO.4～9).Two and half recognition sites about each recognition site has comprised, underscore partly be about two half hitches close site sequence.
CNS1：1882TAGAAGCAACTATAAA
GATTTGTAAC?1907
1882A
TCTTCGTTGATATTTCTAAACATTG?1907
CNS2：3706CATCCTTGCCTGCCT
GGTGGCTCTG?3730
3706G
TAGGAACGGACGGACCACCGAGAC?3730
CNS3：3723TGGCTCTGGCCCTTGC
AAGAGAGGTA3748
3723A
CCGAGACCGGGAACGTTCTCTCCAT3748
6 half site primers on synthetic CNS1, CNS2, three sites of CNS3 obtain 6 half site insertion sequence: CNS1Y, CNS1Z, CNS2Y, CNS2Z, CNS3Y, CNS3Z through annealing.
Wherein, Y represents half recognition site on Zinc finger nuclease the right, and Z represents half recognition site on the Zinc finger nuclease left side.
Zinc finger nuclease identification half site on the casein gene that design is obtained obtains report carrier pReport-N1-T-L-A-CN through in Asc I and the Nhe I insertion pReport-N1-T-L-A report carrier respectively, and wherein CN represents CNS1Y, CNS1CNS2Y, CNS2Z, CNS3Y or CNS3Z;
Asc I and Nhe I be two, and to cut the pReport-N1-T-L-A report carrier as shown in Figure 7: wherein M is trans15k, and 1 is plasmid, and 2 is the double digestion band, and size is 16360bp.
PReport-N1-T-L-A-CN is as shown in Figure 8 for PCR probation report carrier: wherein M is trans5k, and 1-22 is that picking mono-clonal PCR identifies band, and stripe size is 750bp, its 1,2,4,5,6,7,8,9,12,13,14,15,16,19,20 positive clone.
Zinc finger nuclease identification half site on the casein gene that simultaneously design is obtained inserts in the pReport-N2-T-E-A report carriers through two Bsu36I restriction enzyme sites and obtains pReport-N2-T-E-A-CN, and wherein CN represents CNS1Y, CNS1CNS2Y, CNS2Z, CNS3Y or CNS3Z;
It is as shown in Figure 9 that the Bsu36I enzyme is cut the pReport-N2-T-E-A report carrier: wherein M is trans15k; 1 is pReport-N2-EGFP Bsu361 cleavage map, and its size is 14142bp; 2 is plasmid pReport-N2-EGFP.
PCR identifies that pReport-N2-T-E-A-CN is shown in figure 10: wherein M is trans2Kplus; 1,2 for PCR identifies band, and the size of purpose band is 750bp.Half site is centered close to transcriptional start point-62, is the binding site of the best.
5, in order better to realize the screening of zinc finger protein, can interactional Gal11p, Gal4 is separately positioned at random that zinc refers in the middle of storehouse plasmid and the activated carrier.Gal11p can interact with Gal4, can whether regulate and control promoter transcription, in being widely used in protein-protein or making a search, like bacterium two-hybrid system and yeast two-hybrid system.
Shown in Figure 11-1,11-2; When the zinc at random that will be provided with refer to the storehouse plasmid transfection to contain report carrier and activated carrier all transfection in host bacteria; If what be arranged in report carrier waits that screening the zinc finger protein binding site can refer to that certain zinc finger protein of plasmid interacts with zinc at random; Then on the activated carrier GAL4 and zinc at random refer on the plasmid of storehouse with this zinc finger protein sequence bonded GAL11P element near and combines, thereby GAL4 with impel RNA polymerase α to be combined in the promoter region activation reporter gene LacZ of report carrier or the expression (shown in Figure 11-1) of EGFP after GAL11P combines; , recognition site to be screened and zinc finger protein can not activate reporter gene expression (shown in Figure 11-2) if not having interaction.
6, the screening of zinc finger protein and condition optimizing
1) the pAD-R-G carrier is changed over to prepares competent cell (with reference to the super competent preparation method of molecular cloning second edition) among the DH5a; Wherein a part changes the bacterial strain DH5a-L that the pReport-N1-T-L-A-CN report carrier obtains comprising two kinds of plasmids over to then, and another part changes the bacterial strain DH5a-E that the pReport-N2-T-E-A-CN report carrier obtains comprising two kinds of plasmids over to.
2) prepare electric transformant with the bacterial strain DH5a-L and the bacterial strain DH5a-E that comprise two kinds of plasmids respectively: the fresh bacterial classification that connects bacterium 1% is in the SOB liquid medium, and 37 ℃ are cultivated 8-10h to OD is between the 0.8-1.0, connect 1ml bacterium liquid in 100ml sterilizes the SOC nutrient solution in 25 ℃ of-37 ℃ of cultivations; Treat that OD is at 0.6 o'clock, collect the 100ml thalline, 4 ℃; The centrifugal 5min of 3000g removes supernatant, and 10% glycerine is washed thalline; 4 ℃, the centrifugal 5min of 5000g repeats twice; With 400ul10% glycerine suspension thalline, above step is all in operation on ice.
3) electric conversion condition: is that a gradient adds in the electric transformed competence colibacillus cell for preparing with zinc finger protein storehouse plasmid concentration 10ug to the every 1ul of 20ug; The 1500-2500v 5ms that shocks by electricity; Place 6min-8min on ice, add the SOC nutrient solution, 37 ℃; 120rpm shakes bacterium 1h, the thalline that shakes the bacterium gained is applied on the multiple antibiotic solid medium screens.Adjust various antibiotic concentration, adjust the consumption of glucose in nutrient solution, the substratum.Electric shock cup specification: Gap (mm) 2.0, Minimum Volume 40 μ l, Maximum Volume 400 μ l.Electricity transforms at random that zinc refers to the storehouse, zinc is referred to that the storehouse plasmid adds in the electric transformant of preparation, operation on ice.Electric shock 1800v-2500v, 5ms.
Place 6min after the electric shock on ice, add the SOC liquid medium then, 37 ℃, 120rpm cultivates to be coated with behind the 1h and contains on the multiple antibiotic solid medium, is inverted for 37 ℃ and cultivates.The picking mono-clonal is identified.
And to add the activity that X-gal is used for showing LacZ in the LacZ reporting system.
4) screening of zinc finger protein and condition optimizing result:
Preparing the best bacterium temperature of shaking of electric transformed competence colibacillus cell is 26.7 ℃, confirms that the electric shock condition of the best was 2000v when electricity transformed, 5ms, and cells injury is minimum.
Confirm that final antibiotic concentration kan is 30ug/m; Cm is 34ug/ml; Amp is 50ug/ml; Concentration＜80ug/ml of Sm, 0.2%gluclose, IPTG are 50uM.
5) after the report carrier report is expressed, the zinc finger protein that the PCR evaluation and screening obtains, the result is shown in figure 12: wherein M is that 50bpmarker is (from being 50bp down; 100bp, 150bp, 200bp; 250bp, 300bp, 400bp; 500bp) 1-7 obtains bacterial strain plasmid PCR result for screening, and clip size is 273bp.
6) the active mensuration of zinc finger protein EGFP/LacZ
The zinc finger protein anti-streptomycin concentration that screening obtains is up to 80ug/ml, and it is active that the zinc finger protein that obtains is measured EGFP/LacZ.Extract the monoclonal plasmid of gained, obtain the higher plasmid of zinc finger protein at random of purity through twice reclosing with heavily changeing for twice, the zinc finger protein plasmid commentaries on classics EGFP system with the LacZ screening system arrives measures its EGFP intensity; The zinc finger protein plasmid that the EGFP screening system is arrived changes its LacZ activity of LacZ systems measurement.The mutual use of two kinds of systems has strengthened screening the confidence level of the zinc finger protein that obtains.The zinc finger protein that is screened is identified in PCR and order-checking.
The method of Lac determination of activity wherein: the mono-clonal that the picking screening obtains from glass dish is connected to and contains multiple microbiotic (kan is 30ug/m; Cm is 34ug/ml; Amp is 50ug/ml; The concentration of Sm is 40ug/ml) the soc nutrient solution in, 37 ℃, 200rpm spends the night and shakes bacterium.To spend the night shake bacterium liquid 100ul be connected in the fresh soc nutrient solution 37 ℃, 200rpm shakes to the OD to 0.8.Collect thalline (the centrifugal 1min of 12000rpm); With Z Buffer lotion thalline 2 times to remove residual nutrient solution; The dilution thalline makes its od600 between about 0.8; The bacterium liquid 200ul of gained being added in 96 orifice plates accurately measure each bacterium liquid OD600 value with the od appearance, is control group with pReprorT-N1-LacZ plasmid bacterial strain, is the error control group with Z Buffer solution.Get the lysate A that 100ul bacterium liquid adds 11ul, cracking 15min under the room temperature.Z Buffer is contained mercaptoethanol 135ul, and the ONPG mixing of 30ml 4mg/ml adds in 9 orifice plates gets 15ul adding, mixing with the lysate of gained then.The application of dynamic method is measured OD420 value, measures the variation of OD420 value in 50 minutes, every at a distance from 50 seconds mensuration once, contain mercaptoethanol and the ONPG mixture is done control group with Z Buffer.With the OD420 value mapping of time shaft to obtaining, the Trendline slope of gained is the heating rate (V) of ONPG, and it is active to utilize formula LacZ activity=V*1000/OD600 to obtain final LacZ.It is as shown in table 1 to record the lacz activity, and with respect to control group, experimental group is promptly screened the activity that the zinc finger protein that obtains has obviously improved lacz.
The activity of the lacz of the zinc finger protein of table 1 screening
| control | CSNY1 | CSNY5 | CSNY9 | CNSZ3 | CNSZ4 | CNSZ16 | |
| OD600 | 0.773 | 0.796 | 0.673 | 0.788 | 0.77 | 0.888 | 0.865 |
| velocity | 0 | 0.0101 | 0.0108 | 0.0111 | 0.01 | 0.0114 | 0.0096 |
| activity | 0 | 12.74 | 16.05 | 14.10 | 13.0 | 12.84 | 11.10 |
And the method for EGFP strength detection: the mono-clonal that picking screening obtains from glass dish is connected to and contains multiple microbiotic (kan is 30ug/m; Cm is 34ug/ml; Amp is 50ug/ml; The concentration of Sm is 40ug/ml) the soc nutrient solution in, 37 ℃, 200rpm spends the night and shakes bacterium.To spend the night shake bacterium liquid 100ul be connected in the fresh soc nutrient solution 37 ℃, 200rpm shakes to the OD to 0.8.Collect thalline (the centrifugal 1min of 12000rpm); With sodium phosphate lotion thalline 2 times to remove residual nutrient solution; The dilution thalline makes its od600 between about 0.5; The bacterium liquid 200ul of gained added in the 96 hole enzyme plates accurately measure each bacterium liquid OD600 value with ELIASA, pReprorT-EGFP is a control group with the report carrier bacterial strain, uses sodium radio-phosphate,P-32 solution to be the error control group.Measure its fluorescence intensity then, the condition determination of fluorescence intensity, using ELIASA, to set the fluorescence excitation optical wavelength be 491nm, and the emission wavelength of fluorescence is 511nm, and being determined to be lower than under 22 ℃ of EGFP intensity carried out.Fluorescence intensity/the OD600 that measures is the fluorescence intensity of final bacterial strain.The EGFP activity of measuring is as shown in table 2, and with respect to control group, experimental group is promptly screened the expression that the zinc finger protein that obtains has obviously improved EGFP.
The activity of the EGFP of the zinc finger protein of table 2 screening
Use the screening system of above-mentioned structure, screen, obtained zinc finger protein efficiently for the Zinc finger nuclease binding site on the ox β casein gene.Verified the activity of the zinc finger protein that screening obtains through the high expression level of antibiotic-screening, lacz determination of activity and EGFP, and screened the zinc finger protein that obtains and on the ox inoblast, verify that it is respond well.
Claims (10)
1. a screening system that screens zinc finger protein is characterized in that, comprises two report carrier pReport-N1-LacZ, pReport-N2-EGFP and an activated carrier pAD-RNAP-alpha-GAL4;
Described report carrier pReport-N1-LacZ comprises that the Zinc finger nuclease recognition sequence inserts site, ribosome bind site and promotor, is provided with reporter gene LacZ and antibiotic-screening gene in the downstream of promotor;
Described report carrier pReport-N2-EGFP comprises that the Zinc finger nuclease recognition sequence inserts site, ribosome bind site and promotor, is provided with reporter gene EGFP and antibiotic-screening gene in the downstream of promotor;
Described activated carrier pAD-RNAP-alpha-GAL4 comprises RNA polymerase α and active element GAL4.
2. the screening system of screening zinc finger protein as claimed in claim 1; It is characterized in that the Zinc finger nuclease recognition sequence of described report carrier pReport-N1-LacZ inserts the nucleotide sequence of site, ribosome bind site and promotor shown in SEQ.ID.NO.1;
The Zinc finger nuclease recognition sequence of described report carrier pReport-N2-EGFP inserts the nucleotide sequence of site, ribosome bind site and promotor shown in SEQ.ID.NO.2.
3. the screening system of screening zinc finger protein as claimed in claim 1 is characterized in that, is equipped with single copy controlling elements on described report carrier pReport-N1-LacZ and the pReport-N2-EGFP.
4. the screening system of screening zinc finger protein as claimed in claim 1 is characterized in that, the antibiotic-screening gene among the described report carrier pReport-N1-LacZ is the aada gene, and reporter gene LacZ is connected through the tandem expression sequence with the aada gene;
Antibiotic-screening gene among the described report carrier pReport-N2-EGFP is the aada gene, and reporter gene EGFP is connected through the tandem expression sequence with the aada gene;
The nucleotide sequence of tandem expression sequence is shown in SEQ.ID.NO.3.
5. the screening system of screening zinc finger protein as claimed in claim 1 is characterized in that, the RNA polymerase α among the described activated carrier pAD-RNAP-alpha-GAL4 is connected through the linker sequence of expressing the five amino acid residue with active element GAL4.
6. the screening system of screening zinc finger protein as claimed in claim 5 is characterized in that, described five amino acid residue is Gly-Ser-Ala-Ala-Ala.
7. the screening system of screening zinc finger protein as claimed in claim 1; It is characterized in that, also insert the site among described report carrier pReport-N1-LacZ, the report carrier pReport-N2-EGFP and insert the Zinc finger nuclease recognition sequence through the Zinc finger nuclease recognition sequence.
8. the screening system of screening zinc finger protein as claimed in claim 7 is characterized in that, described zinc finger protein recognition sequence is a kind of shown in SEQ.ID.NO.4～SEQ.ID.NO.9.
9. the screening system of screening zinc finger protein as claimed in claim 7 is characterized in that, described report carrier pReport-N1-LacZ and activated carrier pAD-RNAP-alpha-GAL4 cotransfection constitute the LacZ reporting system in host bacteria;
Described report carrier pReport-N2-EGFP and activated carrier pAD-RNAP-alpha-GAL4 cotransfection constitute the EGFP reporting system in host bacteria.
10. the screening system of screening zinc finger protein as claimed in claim 7 is characterized in that, respectively in LacZ reporting system and EGFP reporting system transfection to be screened be provided with at random that the zinc at random of zinc finger protein and GAL11P element refers to the storehouse plasmid; Add microbiotic then and carry out screening positive clone, and go out the zinc finger protein plasmid according to the expression screening of reporter gene; The zinc finger protein plasmid that again the LacZ reporting system is screened screens through the EGFP reporting system, and the zinc finger protein plasmid that the EGFP reporting system is screened screens through the LacZ reporting system.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101228853A CN102660642A (en) | 2012-04-24 | 2012-04-24 | Screening system for screening zinc finger protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101228853A CN102660642A (en) | 2012-04-24 | 2012-04-24 | Screening system for screening zinc finger protein |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102660642A true CN102660642A (en) | 2012-09-12 |
Family
ID=46770217
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012101228853A Pending CN102660642A (en) | 2012-04-24 | 2012-04-24 | Screening system for screening zinc finger protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102660642A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160534A (en) * | 2013-03-26 | 2013-06-19 | 西北农林科技大学 | Universal type bovine beta-casein site gene targeting vector and preparation method thereof |
| CN103215295A (en) * | 2013-04-11 | 2013-07-24 | 西北农林科技大学 | Targeting vector for integrating Lys gene at fixed point of bate-casein locus and cells constructed thereby |
| CN103695375A (en) * | 2013-12-30 | 2014-04-02 | 佛山安普泽生物医药有限公司 | Method for quickly constructing high-expression and stable cell strains |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1285846A (en) * | 1997-11-10 | 2001-02-28 | 综合医院公司 | Detection systems for registering protein interactions and functional relationships |
| WO2001088197A2 (en) * | 2000-05-16 | 2001-11-22 | Massachusetts Institute Of Technology | Methods and compositions for interaction trap assays |
| CN1350062A (en) * | 2000-10-17 | 2002-05-22 | 罗姆和哈斯公司 | Method of identifying production using gene expression |
| CN1438323A (en) * | 2003-01-08 | 2003-08-27 | 中国人民解放军军事医学科学院生物工程研究所 | Genetic-sorting model of zinc finger-protein-DNA interaction and use thereof |
| WO2011011767A1 (en) * | 2009-07-24 | 2011-01-27 | Sigma-Aldrich Co. | Method for genome editing |
| WO2011091324A2 (en) * | 2010-01-22 | 2011-07-28 | The Scripps Research Institute | Methods of generating zinc finger nucleases having altered activity |
-
2012
- 2012-04-24 CN CN2012101228853A patent/CN102660642A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1285846A (en) * | 1997-11-10 | 2001-02-28 | 综合医院公司 | Detection systems for registering protein interactions and functional relationships |
| WO2001088197A2 (en) * | 2000-05-16 | 2001-11-22 | Massachusetts Institute Of Technology | Methods and compositions for interaction trap assays |
| CN1350062A (en) * | 2000-10-17 | 2002-05-22 | 罗姆和哈斯公司 | Method of identifying production using gene expression |
| CN1438323A (en) * | 2003-01-08 | 2003-08-27 | 中国人民解放军军事医学科学院生物工程研究所 | Genetic-sorting model of zinc finger-protein-DNA interaction and use thereof |
| WO2011011767A1 (en) * | 2009-07-24 | 2011-01-27 | Sigma-Aldrich Co. | Method for genome editing |
| WO2011091324A2 (en) * | 2010-01-22 | 2011-07-28 | The Scripps Research Institute | Methods of generating zinc finger nucleases having altered activity |
Non-Patent Citations (2)
| Title |
|---|
| JESSICA A. HURT等: "Highly specific zinc finger proteins obtained by directed domain shuffling and cell-based selection", 《PNAS》 * |
| 李战伟 等: "人工锌指蛋白随机库的构建及其在锌指核酸酶筛选中的应用", 《西北农业学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160534A (en) * | 2013-03-26 | 2013-06-19 | 西北农林科技大学 | Universal type bovine beta-casein site gene targeting vector and preparation method thereof |
| CN103215295A (en) * | 2013-04-11 | 2013-07-24 | 西北农林科技大学 | Targeting vector for integrating Lys gene at fixed point of bate-casein locus and cells constructed thereby |
| CN103215295B (en) * | 2013-04-11 | 2015-04-22 | 西北农林科技大学 | Targeting vector for integrating Lys gene at fixed point of bate-casein locus and cells constructed thereby |
| CN103695375A (en) * | 2013-12-30 | 2014-04-02 | 佛山安普泽生物医药有限公司 | Method for quickly constructing high-expression and stable cell strains |
| CN103695375B (en) * | 2013-12-30 | 2015-08-26 | 佛山安普泽生物医药有限公司 | A kind of method of rapid build high expression level stability cell strain |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103224947B (en) | Gene targeting system | |
| Vanegas et al. | Cpf1 enables fast and efficient genome editing in Aspergilli | |
| Zou et al. | Efficient genome editing in filamentous fungi via an improved CRISPR‐Cas9 ribonucleoprotein method facilitated by chemical reagents | |
| US10858662B2 (en) | Genome editing with split Cas9 expressed from two vectors | |
| Ingham et al. | Quantitative real-time PCR assay for determining transgene copy number in transformed plants | |
| Hao et al. | Fast gene disruption in Trichoderma reesei using in vitro assembled Cas9/gRNA complex | |
| Liu et al. | ErCas12a CRISPR-MAD7 for model generation in human cells, mice, and rats | |
| Vainstein et al. | Permanent genome modifications in plant cells by transient viral vectors | |
| CN108130342A (en) | Plant Genome fixed point edit methods based on Cpf1 | |
| CN106282228A (en) | A kind of method that point mutation is repaired | |
| Akram et al. | An insight into modern targeted genome-editing technologies with a special focus on CRISPR/Cas9 and its applications | |
| CN109136248A (en) | Multiple target point editor carrier and its construction method and application | |
| Wang et al. | Rapid and high efficiency transformation of Chlamydomonas reinhardtii by square-wave electroporation | |
| CN102660642A (en) | Screening system for screening zinc finger protein | |
| CN102994501A (en) | DNA (Deoxyribose Nucleic Acid) with constitutive promoter activity, application of DNA and pichia pastoris expression vector | |
| CN111902541A (en) | Method for increasing expression level of nucleic acid molecule of interest in cell | |
| CN112553079B (en) | Construction method for expressing exogenous fluorescent protein coccidia | |
| CA3193961A1 (en) | Reprogrammable iscb nucleases and uses thereof | |
| CN104531686B (en) | A kind of method that insertion is pinpointed to pig H11 sites using fixed point diced system | |
| CN110073001A (en) | Carrier and method for the gene expression in monocotyledon | |
| CN103667296B (en) | A composition type expression promoter and application thereof | |
| Tiwari et al. | Genome engineering in rice: applications, advancements and future perspectives | |
| Huang et al. | Novel transgenic Chlamydomonas reinhardtii strain with retargetable genomic transgene integration using Cre-loxP system | |
| US20230167435A1 (en) | Autoinducer-2 (ai-2) molecular response-based starting element and escherichia coli (e. coli) dynamic regulation system and method constructed thereby | |
| JP2019508047A (en) | Plant regulatory element and its use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20120912 |