CN102943092B - General type PiggyBac transposon transgenosis carrier and preparation method thereof - Google Patents

Abstract

The invention discloses a general type PiggyBac transposon transgenosis carrier and a preparation method thereof. The general type PiggyBac transposon transgenosis carrier comprises a donor carrier and an auxiliary carrier, the donor carrier comprises a 5' terminal repeat (5'TR) and a 3' terminal repeat (3'TR) of a PiggyBac transposon, two insulators are arranged between the 5'TR and the 3'TR, and a plurality of clone loci are arranged between insulator sequences; and the auxiliary carrier comprises a PiggyBac transposase encoding gene Pbase, a promoter is arranged on the upstream of the Pbase, and PloyA is arranged on the downstream of the Pbase. The method includes that exogenous genes are cloned in the clone loci of the donor carrier, and then the exogenous genes and the auxiliary carrier are mixed with transfection cells to stably screen cells for monoclone, and specificity of the exogenous genes is integrated with TTAA loci in genome through PiggyBac (PB) transposon elements.

Description

A kind of universal PiggyBac transposon transgene carrier and preparation method thereof

Technical field

The invention belongs to transgene carrier technical field, relate to a kind of universal PiggyBac transposon transgene carrier and preparation method thereof.

Background technology

Transgenosis is by the method for carrying in the DNA fragmentation quiding gene group of gene.By observing the phenotypic alternation of the organism being produced by transgenosis, can obtain the function information of genes involved.In addition, transgenic technology also can be used for improveing the proterties of organism, has huge economic worth.

In mammalian cell or animal body, the most frequently used transgenic method is the DNA of linearizing foreign gene-carrying to be passed through, in the means transfered cells such as liposome, electroporation or microinjection, DNA random integration is entered in genome.This method has a lot of shortcomings: (1) integration efficiency is low, therefore in most of Mammalss, can not cultivate efficiently transgenic animal by this method; (2) in most cases linearizing DNA can form multiple copied series connection repeat, i.e. concatermer (concatamer), its be difficult to simulation native gene normal physiological situation; (3) concatermer is easy to restructuring occurs between different transgenosis copies and causes disappearance (deletion) in the time going down to posterity, or modifies the genetically modified stably express of impact owing to methylating; (4) determine the position in the genome of transgenosis insertion place owing to utilizing this method to be difficult to, therefore also cannot make assessment near karyomit(e) environment insertion point.

Compared with simple linearizing DNA, virus vector energy render transgenic is integrated into genome more efficiently, but its main deficiency is: (1) loading capacity is little, the limited length that can carry exogenous dna fragment; (2) host also can be to the virus modification that methylates, and render transgenic is expressed and mourned in silence; (3) prepare viral complex operation; (4) although for genetically modified be replication-defective virus mostly, security is still a problem that needs are vigilant.

Transposon (transposon) is the Mobile Genetic Elements that a class can change on position in host genome, and its process that changes on position is called as swivel base (transposition).

PiggyBac (PB) transposon is that viral genetics man Malcolm J.Fraser finds at first and builds binary transposon system and proves that it not only has transposition activity in a host.PB transposon total length 2472bp, in the middle of it, be full of the region of transcribing of a long 2.1kb, comprise a potential promotor and only containing the ORF of the long 1.8kb of an exon, prediction size of its coding is the transposase of 64kDa, and distinguishes two ends in its outside according to the direction of this transcriptase.Its two ends outermost has the inverted terminal repeat piling (the inverted terminal repeat of each long 13bp, ITR), respectively there is an intersegmental septal area (spacer) its inner side, long 3bp and 31bp respectively, the sub-inverted terminal repeat sequence of symmetry (sub-terminal inverted repeat, STR) of each long 19bp more in the inner part.

PB transposon is to use it for insect sexual cell by Handler to transform at first, be proved to be and can in 5 object 20 various insects and platyhelminth, protozoon body, have carried out swivel base to PB transposon before 2005, application in these non-vertebratess is mainly concentrated both ways: sexual cell transforms (being transgenosis) and gene inserts mutagenesis, and these are laid a good foundation for the application of PB transposon in Mammals.

Cell magazine publication cover story in 2005, grow the biological PB transposon system of transforming by Fudan University and can prove to carry out high-efficiency transposon in mammalian cell and mouse, and successfully cultivate the transgenic mice transposon-mediated by PB, this provides a kind of novel pattern for cell transgenosis, and this research shows that PB transposon has safety, efficient, loading capacity is large and with respect to general carrier because its insertion point is that TTAA has the features such as higher specificity.

In recent years, PB transposon system had been applied to more field, and for example utilizing PB transposon to carry some factor induction inoblast reprogrammed becomes multipotential stem cell, and RNA disturbs, the production of transgenic animal and gene trap and gene therapy etc.

Summary of the invention

The problem that the present invention solves is to provide a kind of universal PiggyBac transposon transgene carrier and preparation method thereof, and this carrier can make the stable expression constantly of goal gene.

The present invention is achieved through the following technical solutions:

A kind of universal PiggyBac transposon transgene carrier, comprises donor carrier and assistant carrier;

Described donor carrier comprises that PiggyBac transposon 5 ' repeats end sequence 5 ' TR and 3 ' and repeats end sequence 3 ' TR, is provided with two insulators between 5 ' TR and 3 ' TR, between insulator sequence, is provided with multiple clone site;

Described assistant carrier comprises PiggyBac transposase encoding gene Pbase, is provided with promotor in the upstream of Pbase, is provided with PloyA in its downstream.

The nucleotide sequence of 5 ' described TR is as shown in SEQ.ID.NO.1; The nucleotide sequence of 5 ' TR is as shown in SEQ.ID.NO.2.

The nucleotide sequence of described insulator is as shown in SEQ.ID.NO.3.

The nucleotide sequence of described multiple clone site is as shown in SEQ.ID.NO.4.

The nucleotide sequence of described Pbase is as shown in SEQ.ID.NO.5; Described promotor is PTK promotor.

Between the described insulator near 5 ' TR and multiple clone site, be also provided with interconnective antibiotic-screening gene and fluorescent mark gene.

Described antibiotic-screening gene and the two ends of fluorescent mark gene are respectively equipped with two Loxp sequences in the same way: Loxp1 and Loxp2;

Between Loxp1 and antibiotic-screening gene, be also provided with SV40 PloyA, antibiotic-screening gene is connected by 2A sequence with fluorescent mark gene, is also provided with CMV promotor between fluorescent mark gene and Loxp2.

Described antibiotic-screening gene is Neo gene, and described fluorescent mark gene is EGFP.

A preparation method for universal PiggyBac transposon transgene carrier, comprises the following steps:

1) synthesize respectively the PiggyBac transposon 5 ' TR as shown in SEQ.ID.NO.1 and 3 ' the TR sequence of the PiggyBac transposon as shown in SEQ.ID.NO.2, and chicken source insulator sequence as shown in SEQ.ID.NO.3, the sequence of multiple clone site as shown in SEQ.ID.NO.4, then be linked in sequence according to the element of 5 ' insulator-multiple clone site sequence-chicken source, TR-chicken source insulator-PiggyBac transposon 3 ' TR, and the mode that constructed fragment is cloned by TA is cloned in pMD18-T simple carrier, obtain plasmid TP;

2) the NEO gene that amplification upstream is connected with 2A sequence is cloned into the downstream of EGFP in pEGFP-C1 plasmid, obtains plasmid pNA;

3) taking pNA as template, the fragment between primer amplification CMV to PloyA taking CEANF and CEANR, and increased fragment is cloned between the insulator and multiple clone site near 5 ' end in TP plasmid, obtain pBNW-TP1 carrier;

Described CEANF is: gagcagatct ataacttcgt atagcataca ttatacgaag ttattgcgtt atcccctgat tctgt;

Described CEANR is: tatcgtcgac ataacttcgt ataatgtatg ctatacgaag ttatcgctta caatttacgc cttaag;

4) amplification PTK promotor, and be cloned in pEGFP-C1 plasmid, pPTK plasmid obtained;

5) the Pbase encoding gene of amplification as shown in SEQ.ID.NO.5, and be cloned into the downstream of PTK promotor in pPTK plasmid, obtain plasmid pPTK-Pbase;

6) taking pPTK-PBase as template, the fragment of amplification between PTK to PloyA, and the mode that increased fragment is cloned by TA connects and is cloned in pMD18-Tsimple carrier, obtains pBNW-TD2 carrier;

The universal PiggyBac transposon transgene carrier of the common composition of constructed carrier pBNW-TP1 and pBNW-TD2.

The application of described universal PiggyBac transposon transgene carrier in external source gene transfecting cell: by exogenous gene cloning to the multiple clone site of donor carrier, and then with assistant carrier mixing transfectional cell, stable screening cell monoclonal.

Compared with prior art, the present invention has following useful technique effect:

Universal PiggyBac transposon transgene carrier provided by the invention, comprise donor carrier and assistant carrier, by exogenous gene cloning to the multiple clone site of donor carrier, and then with assistant carrier mixing transfectional cell, stable screening cell monoclonal, is incorporated into foreign gene specificity in genome by PB transposon element.Under the effect of the transposase of assistant carrier plasmid expression, there is swivel base and integrate in donor plasmid, specificity is inserted TTAA site in cell.

Universal PiggyBac transposon transgene carrier provided by the invention, due to the existence of two chicken insulator core sequences, be integrated in genomic situation at transposon, can effectively avoid genome epigenetic modification and the impact of position effect on goal gene, make the stable expression constantly of goal gene;

The rare restriction enzyme site that multiple clone site can be used is as follows: Bstz17I, AccIII, AscI, BclI, EspI, FseI, NheI, PacI, Sse232I, SbfI, SpeI, the frequency that in most of genomes, these restriction enzyme sites occur is very little, can meet exogenous gene cloning to this carrier, in introducing reporter gene, introduce T3 universal sequencing primer thing at multiple clone site 5 ' end simultaneously, be convenient to goal gene to check order.

Universal PiggyBac transposon transgene carrier provided by the invention, utilize 2A sequence by EGFP and the series connection of NEO gene, share CMV promotor and start expression, do not affecting under the prerequisite of its function, reduce carrier molecule amount, and because the two ends of reporting system exist two Loxp sequences in the same way, can need to add Cre enzyme to remove reporting system according to experiment.

Universal PiggyBac transposon transgene carrier provided by the invention, in view of the feature of PB transposon, this system is produced transgenic animal, the foundation of immortalized cell line, RNA are disturbed and the field such as the induction of IPS cell has possessed good application prospect.And increasing document has also obtained further illustrating to some mechanism of the concrete swivel base of PB transposon, and this lays a good foundation in Mammals transgenosis large-scale application for transposon.

Brief description of the drawings

Fig. 1 is the structure schema of universal PiggyBac transposon transgene carrier system;

Fig. 2 is the single endonuclease digestion qualification electrophoretogram of carrier TP, and wherein label M is DNA molecular amount Marker, and 1 is SpeI single endonuclease digestion TP.

Fig. 3 is carrier pNA double digestion qualification result, and label is that M is Marker, and 1 is BspEI and BamhI double digestion pNA result.

Fig. 4 is that the enzyme of carrier pBNW-TP1 is cut qualification electrophoretogram, and label M is Marker, and 1 is SalI single endonuclease digestion result, and 2 is BglII and SalI double digestion result.

Fig. 5 is that carrier pPTK enzyme is cut qualification result, and label M is Marker, and 1 and 2 are HindIII and SacII double digestion pPTK result.

Fig. 6 is that carrier pPTK-Pbase enzyme is cut qualification result, and label M is Marker, and 1 and 2 are HindIII and BamHI double digestion pPTK-Pbase result.

Fig. 7 is carrier pBNW-TD2 single endonuclease digestion qualification result, and label M is Marker, and 1 is SacII single endonuclease digestion pBNW-TD2 result.

Fig. 8 is universal PiggyBac transposon transgene carrier system carrier collection of illustrative plates, and wherein A is donor plasmid pBNW-TP1 carrier collection of illustrative plates, and B is helper plasmid pBNW-TD2 carrier collection of illustrative plates.

Fig. 9 is Loxp functional nucleotide sequence checking electrophoretogram, and label M is Marker, and 1 is SpeI single endonuclease digestion pBNW-TP1 result, and 2 is SpeI single endonuclease digestion pBNW-TPL result.

Figure 10 is by universal PiggyBac transposon transgene carrier system plasmid rotaring redyeing 293 cell, utilize G418 sustained drug screening fortnight gained monoclonal cell, wherein A is details in a play not acted out on stage, but told through dialogues Growth of Cells picture under 40 times of object lens, and B is light field Growth of Cells picture under 40 times of object lens.

Figure 11 is picture after the 293 single cell clone enlarged culturing of screening, and wherein A is details in a play not acted out on stage, but told through dialogues Growth of Cells picture under 40 times of object lens, and B is light field Growth of Cells picture under 40 times of object lens.

Figure 12 utilizes chromosome walking to go out to stable screening the result that in monoclonal cell genome, flanking sequence detects and analyzes after being PiggyBac transposon transgene carrier system plasmid rotaring redyeing 293 cell.

Embodiment

Below in conjunction with specific embodiment, the present invention is described in further detail, and the explanation of the invention is not limited.

1, material and reagent

Carrier: pMCIneo (stratagen), pMD18-T simple (TAKARA), pEGFP-N1 and pEGFP-C1 be purchased from Clotech company,

PhspBac carrier (Handler and Harrell, 2001a) is so kind as to give by USDA agricultural insect disease South Atlantic center professor Handler.

Bacterial strain: DH5 α (day root)

Reagent: various restriction endonuclease (NEB, MBI), T4DNA ligase enzyme (TAKARA), CIAP (TAKARA), Klenow(TAKARA), the little extraction reagent kit of plasmid (the raw work in Shanghai), the large extraction reagent kit of plasmid (Promega), gel reclaims test kit (Axygen), HP DNA transfection reagent (Roche), G418(Sigma), PCR related reagent (TAKARA), chromosome walking test kit (TAKARA) T4 nucleoside monophosphate kinase (TAKARA), blood, cell, tissue gene group are extracted test kit (day root).

Primer used following (entrusting the raw work in Shanghai to synthesize):

NEOF:GGATCCGGAAATTTTGACCTTCTCAAGTTGGCAGGAGACGTTGAGTCCAACCCTGGGCCCTTCTTCTTCTCCGGCGTTAGGATGATTGAACAAGATGGATTG；

NEOR:CGCGGATCCTCAGAAGAACTCGTCAAGAAG；

CEANF:GAGCAGATCTATAACTTCGTATAGCATACATTATACGAAGTTATTGCGTTATCCCCTGATTCTGT；

CEANR:TATCGTCGACATAACTTCGTATAATGTATGCTATACGAAGTTATCGCTTACAATTTACGCCTTAAG；

PTKF:CTCAAGCTTTAAAACGACGGCCAGTGAATTCTCG；

PTKR:GGACCGCGGATTGGCTGCAGGGTCGCTCGGTGTT；

PbF:TCCCCGCGGATGGGTAGTTCTTTAGACGATGA；

PbR:CGCGGATCCTCAGAAACAACTTTGGCACATATC；

PPBF:TAAAACGACGGCCAGTGAAT；

PPBR:CGCTTACAATTTACGCGTTAAG；

SP1：TATGTCGACTACGTAGGGGAGCTCA；

SP2：ACGGGATCGCTTTCCTCTGAAC；

SP3：TGACTCACGCGGTCGTTATAGTTC。

2, construction process shown in Figure 1, builds respectively pBNW-TP1 and pBNW-TD2 carrier

The structure of pBNW-TP1 carrier:

1) by Nanjing Jin Sirui biotech firm synthetic PiggyBac transposon 5 ' TR as shown in SEQ.ID.NO.1 and 3 ' the TR sequence of the PiggyBac transposon as shown in SEQ.ID.NO.2 respectively, and chicken source insulator sequence as shown in SEQ.ID.NO.3, the sequence of multiple clone site as shown in SEQ.ID.NO.4, then be linked in sequence according to the element of PiggyBac transposon 5 ' insulator-multiple clone site sequence-chicken source, TR-chicken source insulator-PiggyBac transposon 3 ' TR, and the mode that constructed fragment is cloned by TA is cloned in pMD18-T simple carrier, this plasmid called after TP.

The single endonuclease digestion qualification electrophoretogram of carrier TP as shown in Figure 2, can see that carrier TP successfully constructs.

2), using NEOF and NEOR as primer, upstream and downstream primer 5 ' end design BspEI and two restriction enzyme sites of BamHI taking pEGFP-N1 plasmid as template amplification NEO gene, and are introduced 2A sequence in upstream primer;

Described 2A sequence is: cctaacgccg gagaagaaga agggcccagg gttggactca acgtctcctg ccaacttgag aaggtcaaaa tt;

Pcr amplification condition: 95 degree sex change 5min, then carry out following 30 circulations, 95 degree 30s, 59 degree 30s, 72 degree 1min, after last loop ends, carry out 72 degree and extend 10min.

Reclaim this fragment by glue, and itself and pEGFP-C1 plasmid are used respectively to BspE I and BamH I double digestion, be then cloned in pEGFP-C1 plasmid gained plasmid called after pNA.

As shown in Figure 3, result detects and shows that carrier pNA successfully constructs carrier pNA double digestion qualification result.

3) taking pNA as template, taking CEANF and CEANR as the following fragment of primer amplification: CMV-EGFP-2A-NEO-PloyA;

Wherein, primer upstream and downstream 5 ' end is introduced two Loxp palindromic sequences that the identical length of order is 34bp, and upstream primer Loxp introduces T3 primer (T3primer) in outside, and respectively at upstream and downstream primer 5 ' tip designs BglII and SalI restriction enzyme site,

Pcr amplification condition: 95 degree sex change 5min, then carry out following 32 circulations, 95 degree 30s, 61 degree 35s, 72 degree 3min, after last loop ends, carry out 72 degree and extend 10min.

After fragment glue after amplification reclaims, and itself and TP plasmid are used respectively to BglII and SalI double digestion, be then cloned in TP plasmid gained plasmid called after pBNW-TP1.

The enzyme of carrier pBNW-TP1 is cut qualification electrophoretogram as shown in Figure 4, and result shows that carrier pBNW-TP1 successfully constructs.

The structure of pBNW-TD2 carrier:

4) be respectively upstream and downstream primer (introducing HindIII and SacII restriction enzyme site) with PTKF and PTKR, taking pMC1neo carrier as template, amplification PTK promotor;

Pcr amplification condition: 95 degree sex change 5min, then carry out following 35 circulations, 95 degree 30s, 58 degree 30s, 72 degree 30s, after last loop ends, carry out 72 degree and extend 10min.

After object fragment glue reclaims, and itself and pEGFP-C1 plasmid are used respectively to HindIII and SacII double digestion, be then cloned in pEGFP-C1 plasmid gained plasmid called after pPTK.

5) be respectively upstream and downstream primer (introducing SacII and BamHI restriction enzyme site) with PbF and PbR, taking phspBac carrier as template, amplification PiggyBac transposase (Pbase) coding gene sequence;

Pcr amplification condition: 95 degree sex change 5min, then carry out following 33 circulations, 95 degree 35s, 60 degree 35s, 72 degree 2min, after last loop ends, carry out 72 degree and extend 10min.

The sequence of the Pbase encoding gene increasing is as shown in SEQ.ID.NO.5;

After fragment glue after amplification reclaims, and itself and pPTK plasmid are used respectively to SacII and BamHI double digestion, be then cloned in pPTK plasmid gained plasmid called after pPTK-Pbase.

Carrier pPTK-Pbase enzyme is cut qualification result as shown in Figure 6, and result shows vector construction success.

6) be respectively upstream and downstream primer with PPBF and PPBR, taking pPTK-PBase as template, amplification PTK-Pbase-PloyA fragment, pcr amplification condition: 95 degree sex change 5min, then carry out following 32 circulations, 95 degree 35s, 61 degree 35s, 72 degree 2.5min, after last loop ends, carry out 72 degree and extend 10min.

Fragment glue reclaims, and the mode of cloning by TA connects and is cloned in pMD18-T simple carrier, the plasmid vector called after pBNW-TD2 of structure.

As shown in Figure 7, result detects and shows vector construction success carrier pBNW-TD2 single endonuclease digestion qualification result.

Universal PiggyBac transposon transgene carrier system carrier collection of illustrative plates shown in Figure 8, the universal PiggyBac transposon transgene carrier system of the common composition of constructed carrier pBNW-TP1 and pBNW-TD2, when use, by exogenous gene cloning to the multiple clone site (MCS) of pBNW-TP1, mix transfectional cell with pBNW-TD2 in the ratio of conventional 1:1, after stable screening cell monoclonal, detect integration site flanking sequence, determine its function.

3, the detection of carrier related elements

1) carrier pBNW-TP1 is transformed into the function of checking Loxp sequence in the intestinal bacteria BM2.5 (Clontech) of constitutive expression Cre enzyme

Cre enzyme is a kind of site-specific recombinase, can mediate two restructuring of the sequence generation specificity between the Loxp site of 34bp in the same way, makes the sequence between Loxp site deleted.These experimental technique concrete operations are as follows: by standby the Inoue legal system in BM2.5 intestinal bacteria reference " molecular cloning experiment guide " third edition competent cell that becomes, utilize traditional plasmid method for transformation that carrier pBNW-TP1 is transformed and entered in this competent cell, and screen recon enlarged culturing, extract plasmid called after pBNW-TPL in the recon after enlarged culturing, utilize speI single endonuclease digestion pBNW-TP 1 and pBNW-TPL respectively, 0.8% gel electrophoresis result shows that pBNW-TPL is than the short 2500bp of pBNW-TP left and right, and result as shown in Figure 9; This explanation reporting system is deleted, send the rear result of order-checking to conform to electrophoresis result, proves that Loxp functional nucleotide sequence is normal, after swivel base success, can utilize Cre enzyme to remove reporting system.

2) EGFP and NEO gene function

After plasmid pBNW-TP1 and pBNW-TD2 are transformed respectively to DH 5 α intestinal bacteria amoxicillins (Amp) screening enlarged culturing, in enormous quantities extraction after plasmid, utilize HPDNA transfection reagent by above-mentioned plasmid according to the ratio rotaring redyeing 293 cell of 1:1, after 24h, green fluorescence is expressed normal;

Cell adds the G418 of 500ug/ml concentration and continues one week of screening after changing liquid, and control group is all dead, and the equal normal growth of positive control and experimental group, proves that the EGFP and the NEO gene function that connect by 2A sequence are normal.

Figure 10 shows that and utilize G418 sustained drug screening fortnight gained monoclonal cell, wherein A is details in a play not acted out on stage, but told through dialogues Growth of Cells picture under 40 times of object lens, and B is light field Growth of Cells picture under 40 times of object lens.Result shows to screen the cell of positive colony.

3) swivel base function

By after the screened positive 293 cell monoclonal enlarged culturing (as shown in figure 11, wherein A is details in a play not acted out on stage, but told through dialogues Growth of Cells picture under 40 times of object lens, B is light field Growth of Cells picture under 40 times of object lens), extract genome, utilize the method (hot asymmetric PCR) of chromosome walking to detect PB transposon integration site taking genome as template, in known transposon sequence, design three Auele Specific Primer SP1, SP2, SP3, specific experiment principle and step are with reference to TAKARA chromosome walking test kit specification sheets (article No.: D316), the band of amplification is cloned into pMD19-T carrier, order-checking shows that PB transposon element specificity is incorporated into human genome TTAA site, prove that native system swivel base function is normal, concrete detected result is as shown in figure 12:

Wherein A figure is No. 1 clone's detected result, figure A 1 is the flanking sequence comparison result of transposon 5 ' TR and detection, figure A 2 inputs ncbi database by flanking sequence and carries out BLAST comparison result, confirms that No. 1 clone inserts TTAA site, and is incorporated into No. 8 karyomit(e)s of human genome.

Figure B is No. 2 clone's detected results, wherein scheme the flanking sequence comparison result of B 1 for transposon 5 ' TR and detection, figure B 2 inputs ncbi database by flanking sequence and carries out BLAST comparison result, confirms that No. 2 clones insert TTAA site, and is incorporated into No. 9 karyomit(e)s of human genome.

Claims (1)

1. One kind universal piggyBactransposon transgene carrier, is characterized in that, comprises donor carrier and assistant carrier;

   Described donor carrier comprises piggyBactransposon 5 ' repeats end sequence 5 ' TR and 3 ' and repeats end sequence 3 ' TR, is provided with two insulators between 5 ' TR and 3 ' TR, between insulator sequence, is provided with multiple clone site; The nucleotide sequence of 5 ' described TR is as shown in SEQ.ID.NO.1; The nucleotide sequence of 3 ' TR is as shown in SEQ.ID.NO.2;

   Between the insulator of close 5 ' TR and multiple clone site, be also provided with interconnective antibiotic-screening gene and fluorescent mark gene; Described antibiotic-screening gene and the two ends of fluorescent mark gene are respectively equipped with two Loxp sequences in the same way: Loxp1 and Loxp2;

   Between Loxp1 and antibiotic-screening gene, be also provided with SV40 PloyA, antibiotic-screening gene is connected by 2A sequence with fluorescent mark gene, is also provided with CMV promotor between fluorescent mark gene and Loxp2; Described 2A sequence is: cctaacgccg gagaagaaga agggcccagg gttggactca acgtctcctg ccaacttgag aaggtcaaaa tt;

   The nucleotide sequence of described insulator is as shown in SEQ.ID.NO.4, and the nucleotide sequence of described multiple clone site is as shown in SEQ.ID.NO.3;

   Described assistant carrier comprises piggyBactransposase encoding gene Pbase, is provided with promotor in the upstream of Pbase, is provided with PloyA in its downstream.

   2 .as claimed in claim 1 universal piggyBactransposon transgene carrier, is characterized in that, the nucleotide sequence of described Pbase is as shown in SEQ.ID.NO.5; Described promotor is PTK promotor.

   3 .as claimed in claim 1 universal piggyBactransposon transgene carrier, is characterized in that, described antibiotic-screening gene is Neo gene, and described fluorescent mark gene is EGFP.

   4 .a kind of universal piggyBacthe preparation method of transposon transgene carrier, is characterized in that, comprises the following steps:

   1) synthesize respectively as shown in SEQ.ID.NO.1 piggyBactransposon 5 ' TR and as shown in SEQ.ID.NO.2 piggyBactransposon 3 ' TR sequence, and chicken source insulator sequence as shown in SEQ.ID.NO.4, as shown in SEQ.ID.NO.3 the sequence of multiple clone site, then according to 5 ' insulator-multiple clone site sequence-chicken source, TR-chicken source insulator- piggyBacthe element of transposon 3 ' TR is linked in sequence, and the mode that constructed fragment is cloned by TA is cloned in pMD18-T simple carrier, obtains plasmid TP;

   2) the NEO gene that amplification upstream is connected with 2A sequence is cloned into the downstream of EGFP in pEGFP-C1 plasmid, obtains plasmid pNA; Described 2A sequence is: cctaacgccg gagaagaaga agggcccagg gttggactca acgtctcctg ccaacttgag aaggtcaaaa tt;

   3) taking pNA as template, the fragment between primer amplification CMV to PloyA taking CEANF and CEANR, and increased fragment is cloned between the insulator and multiple clone site near 5 ' end in TP plasmid, obtain pBNW-TP1 carrier;

   Described CEANF is: gagcagatct ataacttcgt atagcataca ttatacgaag ttattgcgtt atcccctgat tctgt;

   Described CEANR is: tatcgtcgac ataacttcgt ataatgtatg ctatacgaag ttatcgctta caatttacgc cttaag;

   4) amplification PTK promotor, and be cloned in pEGFP-C1 plasmid, pPTK plasmid obtained;

   5) the Pbase encoding gene of amplification as shown in SEQ.ID.NO.5, and be cloned into the downstream of PTK promotor in pPTK plasmid, obtain plasmid pPTK-Pbase;

   6) taking pPTK-PBase as template, the fragment of amplification between PTK to PloyA, and the mode that increased fragment is cloned by TA connects and is cloned in pMD18-T simple carrier, obtains pBNW-TD2 carrier;

   The common composition of constructed carrier pBNW-TP1 and pBNW-TD2 is universal piggyBactransposon transgene carrier.

   5 .claimed in claim 1 universal piggyBacthe application of transposon transgene carrier in external source gene transfecting cell: by exogenous gene cloning to the multiple clone site of donor carrier, and then with assistant carrier mixing transfectional cell, stable screening cell monoclonal.