CN111041047A - Construction method of mouse model for conditionally site-specific double overexpression HPV E6/E7 gene - Google Patents
Construction method of mouse model for conditionally site-specific double overexpression HPV E6/E7 gene Download PDFInfo
- Publication number
- CN111041047A CN111041047A CN201911320627.4A CN201911320627A CN111041047A CN 111041047 A CN111041047 A CN 111041047A CN 201911320627 A CN201911320627 A CN 201911320627A CN 111041047 A CN111041047 A CN 111041047A
- Authority
- CN
- China
- Prior art keywords
- mouse
- hpv
- site
- mice
- rosa26
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000010172 mouse model Methods 0.000 title claims abstract description 34
- 230000002018 overexpression Effects 0.000 title claims abstract description 28
- 101150071673 E6 gene Proteins 0.000 title claims abstract description 21
- 238000010276 construction Methods 0.000 title claims abstract description 21
- 101150013359 E7 gene Proteins 0.000 title claims abstract description 8
- 241000699666 Mus <mouse, genus> Species 0.000 claims abstract description 117
- 241000699670 Mus sp. Species 0.000 claims abstract description 58
- 238000000034 method Methods 0.000 claims abstract description 37
- 108091027544 Subgenomic mRNA Proteins 0.000 claims abstract description 29
- 239000013598 vector Substances 0.000 claims abstract description 27
- 230000008685 targeting Effects 0.000 claims abstract description 21
- 108091033409 CRISPR Proteins 0.000 claims abstract description 16
- 238000000520 microinjection Methods 0.000 claims abstract description 10
- 239000000203 mixture Substances 0.000 claims abstract description 9
- 108020004414 DNA Proteins 0.000 claims description 45
- 108090000623 proteins and genes Proteins 0.000 claims description 32
- 239000000523 sample Substances 0.000 claims description 21
- 230000008439 repair process Effects 0.000 claims description 19
- 238000012163 sequencing technique Methods 0.000 claims description 19
- 239000012634 fragment Substances 0.000 claims description 18
- 238000006243 chemical reaction Methods 0.000 claims description 17
- 238000012795 verification Methods 0.000 claims description 16
- 238000012216 screening Methods 0.000 claims description 14
- 230000014509 gene expression Effects 0.000 claims description 12
- 230000008569 process Effects 0.000 claims description 12
- 238000002105 Southern blotting Methods 0.000 claims description 10
- 235000013601 eggs Nutrition 0.000 claims description 9
- 238000001514 detection method Methods 0.000 claims description 8
- 238000005516 engineering process Methods 0.000 claims description 8
- 230000006801 homologous recombination Effects 0.000 claims description 8
- 238000002744 homologous recombination Methods 0.000 claims description 8
- 230000009437 off-target effect Effects 0.000 claims description 8
- 230000003321 amplification Effects 0.000 claims description 6
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 6
- 108010006785 Taq Polymerase Proteins 0.000 claims description 5
- 239000012154 double-distilled water Substances 0.000 claims description 5
- 238000001976 enzyme digestion Methods 0.000 claims description 5
- 108091008146 restriction endonucleases Proteins 0.000 claims description 5
- 239000003298 DNA probe Substances 0.000 claims description 4
- 241000700605 Viruses Species 0.000 claims description 4
- 238000009395 breeding Methods 0.000 claims description 4
- 230000001488 breeding effect Effects 0.000 claims description 4
- 238000010367 cloning Methods 0.000 claims description 4
- 210000003101 oviduct Anatomy 0.000 claims description 4
- 230000006798 recombination Effects 0.000 claims description 4
- 238000005215 recombination Methods 0.000 claims description 4
- 238000010079 rubber tapping Methods 0.000 claims description 4
- 108020003215 DNA Probes Proteins 0.000 claims description 3
- 230000009977 dual effect Effects 0.000 claims description 3
- 230000035484 reaction time Effects 0.000 claims description 3
- 241000581650 Ivesia Species 0.000 claims 1
- 238000010171 animal model Methods 0.000 abstract description 10
- 230000001105 regulatory effect Effects 0.000 abstract description 4
- 241000701806 Human papillomavirus Species 0.000 description 42
- 238000010586 diagram Methods 0.000 description 13
- 238000010362 genome editing Methods 0.000 description 11
- 230000010354 integration Effects 0.000 description 10
- 238000013461 design Methods 0.000 description 7
- 238000011160 research Methods 0.000 description 7
- 210000001519 tissue Anatomy 0.000 description 7
- 238000011830 transgenic mouse model Methods 0.000 description 7
- 206010008342 Cervix carcinoma Diseases 0.000 description 6
- 208000006105 Uterine Cervical Neoplasms Diseases 0.000 description 6
- 201000010881 cervical cancer Diseases 0.000 description 6
- 238000001962 electrophoresis Methods 0.000 description 6
- 241000699660 Mus musculus Species 0.000 description 5
- 201000011510 cancer Diseases 0.000 description 5
- 238000011580 nude mouse model Methods 0.000 description 5
- 238000010356 CRISPR-Cas9 genome editing Methods 0.000 description 4
- 206010028980 Neoplasm Diseases 0.000 description 4
- 238000011161 development Methods 0.000 description 4
- 230000034431 double-strand break repair via homologous recombination Effects 0.000 description 4
- 230000017188 evasion or tolerance of host immune response Effects 0.000 description 4
- 210000000987 immune system Anatomy 0.000 description 4
- 238000001727 in vivo Methods 0.000 description 4
- 210000004027 cell Anatomy 0.000 description 3
- 230000001276 controlling effect Effects 0.000 description 3
- 238000011156 evaluation Methods 0.000 description 3
- 230000003832 immune regulation Effects 0.000 description 3
- 238000003780 insertion Methods 0.000 description 3
- 230000037431 insertion Effects 0.000 description 3
- 230000007246 mechanism Effects 0.000 description 3
- 102000004169 proteins and genes Human genes 0.000 description 3
- 238000002864 sequence alignment Methods 0.000 description 3
- 230000009261 transgenic effect Effects 0.000 description 3
- 238000011740 C57BL/6 mouse Methods 0.000 description 2
- 206010064912 Malignant transformation Diseases 0.000 description 2
- 241001465754 Metazoa Species 0.000 description 2
- 208000009608 Papillomavirus Infections Diseases 0.000 description 2
- 230000000295 complement effect Effects 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 238000003205 genotyping method Methods 0.000 description 2
- 230000001939 inductive effect Effects 0.000 description 2
- 230000003993 interaction Effects 0.000 description 2
- 230000003902 lesion Effects 0.000 description 2
- 230000036212 malign transformation Effects 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 1
- 206010006187 Breast cancer Diseases 0.000 description 1
- 208000026310 Breast neoplasm Diseases 0.000 description 1
- 208000005623 Carcinogenesis Diseases 0.000 description 1
- 206010008263 Cervical dysplasia Diseases 0.000 description 1
- 108091026890 Coding region Proteins 0.000 description 1
- 230000033616 DNA repair Effects 0.000 description 1
- 102100035102 E3 ubiquitin-protein ligase MYCBP2 Human genes 0.000 description 1
- 101100540311 Human papillomavirus type 16 E6 gene Proteins 0.000 description 1
- 101100156155 Human papillomavirus type 16 E7 gene Proteins 0.000 description 1
- 102000011782 Keratins Human genes 0.000 description 1
- 108010076876 Keratins Proteins 0.000 description 1
- 101710163270 Nuclease Proteins 0.000 description 1
- 108700020796 Oncogene Proteins 0.000 description 1
- 108700026244 Open Reading Frames Proteins 0.000 description 1
- 108700019146 Transgenes Proteins 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000036952 cancer formation Effects 0.000 description 1
- 231100000357 carcinogen Toxicity 0.000 description 1
- 231100000504 carcinogenesis Toxicity 0.000 description 1
- 239000003183 carcinogenic agent Substances 0.000 description 1
- 230000010261 cell growth Effects 0.000 description 1
- 210000000349 chromosome Anatomy 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 230000005782 double-strand break Effects 0.000 description 1
- 238000011827 double-transgenic mouse model Methods 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 210000002919 epithelial cell Anatomy 0.000 description 1
- 210000000981 epithelium Anatomy 0.000 description 1
- 229940011871 estrogen Drugs 0.000 description 1
- 239000000262 estrogen Substances 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 239000013604 expression vector Substances 0.000 description 1
- 230000002349 favourable effect Effects 0.000 description 1
- 238000003198 gene knock in Methods 0.000 description 1
- 230000007614 genetic variation Effects 0.000 description 1
- 210000004602 germ cell Anatomy 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 230000003834 intracellular effect Effects 0.000 description 1
- 239000007928 intraperitoneal injection Substances 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 230000013011 mating Effects 0.000 description 1
- 230000001404 mediated effect Effects 0.000 description 1
- 230000008506 pathogenesis Effects 0.000 description 1
- 230000001575 pathological effect Effects 0.000 description 1
- 239000013612 plasmid Substances 0.000 description 1
- 230000008707 rearrangement Effects 0.000 description 1
- 210000005000 reproductive tract Anatomy 0.000 description 1
- 238000012827 research and development Methods 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 230000005945 translocation Effects 0.000 description 1
- 230000010415 tropism Effects 0.000 description 1
- 241000701161 unidentified adenovirus Species 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- 210000004291 uterus Anatomy 0.000 description 1
- 229960005486 vaccine Drugs 0.000 description 1
- 210000003462 vein Anatomy 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/027—New breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0337—Animal models for infectious diseases
Abstract
The invention provides a construction method of a mouse model of conditional site-specific double overexpression HPV E6/E7 gene, which comprises the following steps: 1. respectively designing and obtaining sgRNAs, (2) respectively preparing a Cas9/sgRNA mixture; (3) constructing a targeting vector, (4) carrying out microinjection and obtaining with F0 generation mice, wherein the targeting vector comprises F0 generation mice of a ROSA26 site fixed point knock-in HPV E6 and F0 generation mice of an H11 site fixed point knock-in HPVE 7; (5) f1 mouse; (6) obtaining F2 generation positive homozygote mice; 2. obtaining a conditional site-directed HPV E6/E7 double knock-in model mouse: two F2 generation positive homozygous mice were crossed to obtain a conditional site-directed HPV E6/E7 double knock-in model mouse. The method provided by the invention can obtain an animal model which can be stably inherited and accurately regulated.
Description
Technical Field
The invention relates to a construction method of a mouse model of conditional site-specific double overexpression HPV E6/E7 gene, belonging to the technical field of biology.
Background
Cervical cancer is one of the most common malignant tumors of women, the incidence rate of the cervical cancer is second to breast cancer in gynecological malignant tumors, the incidence process is complex, the incidence rate is high, the incidence population tends to be younger, and the life health of women is seriously threatened. Its development is a complex, multi-step process, and is the result of long-term synergy of multiple carcinogens, including Human Papillomavirus (HPV) infection, genetic variation, immune escape, and the like. A large number of epidemiological and molecular biological research results prove that HPV and epithelial malignant tumor of genital tract are closely related to precancerous lesion and are the main etiological factors of cervical cancer. HPV has high tissue specificity and strong tropism to squamous epithelium. More than 200 subtypes of HPV have been identified and classified into high-risk type HPV (hrHPV) and low-risk type HPV (lrHPV) according to their oncogenicity. The gene structures of all subtypes are approximately similar and can be divided into 3 parts: early (E) coding region, late (L) coding region and long regulatory region (LCR). Among them, hrHPV E6 and E7 play a key role in the HPV carcinogenesis process, the encoded protein products are important factors for causing cervical epithelial canceration, and the two proteins influence the cell growth cycle and DNA repair by combining with intracellular oncostatin P53, pRb and the like, so that epithelial cells are promoted to exit the differentiation program and continuously proliferate. The method has important medical application value for carrying out deep research on the aspects of the mechanism of the generation and development process of the cervical cancer, the diagnosis and treatment of the cervical cancer, the research and the development of vaccines and the like of E6/E7.
At present, the bottleneck still exists in the research on how to comprehensively evaluate the cancer promotion mechanism of hrHPV E6/E7, especially the mechanism in the processes of inducing normal cell malignant transformation and tumor microenvironment immune regulation. In order to address the above scientific issues, the development of in vivo models is essential, and an organic whole of the in vivo environment is required for studying the interaction of molecules with lesions. The function of the in vivo hrHPV E6/E7 protein can be evaluated by the characteristics of relevant animal models, and the relationship between the hrHPV and female cervical dysplasia, cervical cancer and the like is discussed. At present, relevant researches are carried out by mostly utilizing nude mice and traditional random transgenic mice.
(1) Nude mice: domestic researchers induce the expression of E6/E7 in the uterus of a tested mouse by constructing an E6/E7 adenovirus vector with a keratin (K14) promoter, injecting recombinant virus Ad-K14-E6/E7 into a tail vein of a nude mouse in a mode of combining intraperitoneal injection of estrogen and the like.
(2) Transgenic mice: the transgenic animal refers to an animal in which an exogenous gene transferred by an experimental method is integrated in a genome, expressed and transmitted to a descendant, breaks the species limit, and provides possibility for researching genes from different sources. For example, researchers have constructed vectors carrying a skin tissue specific promoter PINVThe HPV16E 6/E7 eukaryotic expression vector of (Humaninvolucrinpromoter) is subjected to microinjection after linearization to obtain pINV-E6/E7 transgenic founder mice, and the proportion of positive offspring accords with Mendel's law of inheritance.
In the above model, the nude mouse lacks a robust immune system, and the model is not suitable for studying the role of HPV E6/E7 in mediating tumor microenvironment immune regulation, immune escape and the like. However, the conventional random transgenic mice have been limited in many fields. The efficiency of the transgene and the uncertainty of the integration site are the main reasons. The mice are generally prepared by injecting germ cells into pronuclei by plasmids, integration of the mice is random, some mice occur in a single site, and the integration of the mice is also integrated on a plurality of sites of different chromosomes under the condition of random, genome rearrangement and translocation deletion can be caused by the randomness of the integration of the; in addition, the copy number of integration is not fixed, and multi-copy tandem integration may cause low expression rate or even no expression of exogenous genes, which is not favorable for controlling the expression level and function research of genes. Therefore, the first established mouse (positive genotype identification) is obtained and needs further screening.
Disclosure of Invention
The invention aims to provide a method for constructing a mouse model of conditional site-specific dual over-expression HPV E6/E7 gene, so as to solve the problems.
The invention adopts the following technical scheme:
a method for constructing a mouse model of conditional site-specific dual overexpression HPV E6/E7 gene is characterized by comprising the following steps:
1. obtaining mice with conditional site-directed tapping of the ROSA26 site HPV E6 and H11 site-conditional site-directed tapping HPVE 7:
(1) designing and obtaining sgRNA at mouse ROSA26 site and H11 site respectively according to the sequences of HPV E6 and E7 genes, and evaluating the off-target effect of candidate sequences;
(2) respectively incubating sgRNAs corresponding to the two sequences with Cas9 protein to respectively prepare Cas9/sgRNA mixtures;
(3) constructing a targeting vector, and constructing homologous recombination vectors carrying conditional overexpression E6 or E7 sequences respectively by utilizing In-Fusion cloning technology, wherein a recombination system used In the construction process is a Cre-LoxP induced expression system, and the vectors comprise 'start-loxP-Stop-loxP-Kozak-HPV E6 or E7-screening marker-polyA' gene segments;
(4) microinjection and F0 generation mice, respectively, and the targeting vector and the Cas9/sgRNA mixture are injected into fertilized eggs of the mice together; then sending the fertilized eggs after microinjection back to the oviduct of a surrogate mouse, and after the mouse is born, screening out a target mouse through gene identification, namely an F0 generation mouse, including an F0 generation mouse of which the site of ROSA26 is knocked into HPV E6 at a fixed point and an F0 generation mouse of which the site of H11 is knocked into HPV E7 at a fixed point;
(5) obtaining mice of F1 generation, breeding the sexually mature positive F0 generation mice with wild mice to generate F1 generation, and obtaining F1 generation positive heterozygote mice after PCR and Southern verification, wherein the F1 generation positive heterozygote mice comprise F1 generation mice of ROSA26 site fixed point knock-in HPV E6 and F1 generation mice of H11 site fixed point knock-in HPV E7;
(6) selfing the F1 generation positive heterozygote mouse with the site of ROSA26 knocked-in HPV E6 and the F1 generation positive heterozygote mouse with the site of H11 knocked-in HPV E7, and screening to obtain an F2 generation positive homozygote mouse;
2. obtaining a conditional site-directed HPV E6/E7 double knock-in model mouse:
the mouse with the ROSA26 site-specific knock-in HPV E6F 2 generation positive homozygote is hybridized with the mouse with the H11 site-specific knock-in HPV E7F2 generation positive homozygote to obtain a conditional site-specific HPV E6/E7 double knock-in model mouse.
Further, the method for constructing the mouse model for conditionally overexpressing HPV E6 gene at the ROSA26 site also has the following characteristics:
the sequences of sgrnas conditionally overexpressing HPV16E6 are:
CUCCAGUCUUUCUAGAAGAUGGG，
the sequences of sgrnas conditionally overexpressing HPV16E7 are:
GAACACUAGUGCACUUAUCCUGG。
further, the method for constructing the mouse model for conditionally overexpressing HPV E6 gene at the ROSA26 site of the invention also has the following characteristics:
mouse genotype identification: by adopting PCR detection or sequencing verification,
extracting genome DNA of an E6 mouse rat tail, and performing PCR identification after the target of the repair donor is in the target, wherein primers ROSA26-seqF1/ROSA26-seqR1 are respectively positioned outside a 5 'homology arm and in a repair donor fragment, and if a PCR product is generated by amplification of the pair of primers, the target donor is effectively inserted in the 5' genome of the mouse; ROSA26-seqF2/ROSA26-seqR2 are respectively positioned in the fragment of the repair donor and outside the 3 'homology arm, if the pair of primers are amplified to generate a PCR product, the target donor is effectively inserted into the 3' of the mouse genome;
e7 mouse rat tail genomic DNA was extracted and subjected to PCR identification after targeting with repair donor. As shown in FIG. 19, primers H11-seqF1/H11-seqR1 are respectively positioned outside the 5 'homology arm and in the repair donor fragment, and PCR products are generated by the amplification of the primers, so that the target donor is effectively inserted in the 5' of the mouse genome; H11-seqF2/H11-seqR2 are respectively positioned in the fragment of the repair donor and outside the 3 'homology arm, and if the pair of primers is amplified to generate a PCR product, the target donor is effectively inserted in the 3' of the mouse genome.
Further, the construction method of the mouse model for conditionally overexpressing HPV E6 gene at the ROSA26 site of the invention also has the characteristics that the primer sequences adopted by PCR detection or sequencing verification are as follows:
e6 mice:
e7 mice:
| primer name | Primer sequences |
| F1 | 5’-GTACATCCACAGCATCTTCCAAG-3’ |
| R1 | 5’-AGATGTACTGCCAAGTAGGAAAGTC-3’ |
| F2 | 5’-GCATCTGACTTCTGGCTAATAAAG-3’ |
| R2 | 5’-GCCTTGACCTAAGAGATGATGCGAC-3’ |
| F3 | 5’-CTCTACTGGAGGAGGACAAACTG-3 |
| R3 | 5’-GTCTTCCACCTTTCTTCAGTTAGC-3’ |
Further, the method for constructing a mouse model for conditionally overexpressing HPV E6 gene at the ROSA26 site of the invention is characterized in that if the purity of a DNA sample is low or the PCR reaction time is desired to be shortened, alternative PCR primers are adopted, and a PCR product with a shorter fragment can be obtained, wherein the sequences of the alternative PCR primers are respectively as follows:
e6 mice:
e7 mice:
further, the construction method of the mouse model for conditionally overexpressing HPV E6 gene at the ROSA26 site also has the characteristics that an alternative PCR reaction system:
| reaction assembly | Volume of |
| MousetailgenomicDNA | 1μL |
| Forwardprimer(10μM) | 1μL |
| Reverseprimer(10μM) | 1μL |
| PremixTaqPolymerase | 12.5μL |
| ddH2O | 9.5μL |
| Total | 25μL |
Further, the method for constructing the mouse model for conditionally overexpressing HPV E6 gene at the ROSA26 site also has the characteristics that the PCR reaction conditions are selected as follows:
further, the method for constructing the mouse model for conditionally overexpressing HPV E6 gene at the ROSA26 site of the invention also has the following characteristics:
mouse genotype identification: and (3) identifying by using southern blot:
taking the double-arm homologous recombination positive mouse (No. 2-4) verified by PCR and sequencing, extracting rat tail DNA, carrying out enzyme digestion by restriction enzyme BamHI or BstEII, simultaneously selecting a DNA probe for Southern blot analysis,
e6 mouse 5' probe primer sequence:
e6 mouse 3' probe primer sequence:
e7 mouse KI probe primer sequence:
further, the method for constructing the mouse model for conditionally overexpressing HPV E6 gene at the ROSA26 site of the invention also has the following characteristics:
crossing the fixed point HPV E6 single knock-in mouse, the fixed point HPV E7 single knock-in mouse or the fixed point HPV E6/E7 double knock-in model mouse with Cre mouse with tissue specific promoter or infecting with Cre virus.
Advantageous effects of the invention
Aiming at the problems in the prior art, the invention provides a method for establishing an HPV E6/E7 conditional site-specific double-knock-in mouse model by applying a CRISPR-Cas9 genome site-specific editing technology so as to obtain an animal model which can be stably inherited and accurately regulated. Compared with the prior art, the invention mainly solves the following technical problems:
the problem that a nude mouse lacks a healthy immune system and is not suitable for researching the effect of HPV E6/E7 in the process of mediating tumor microenvironment immune regulation, immune escape and the like in the prior art is solved, and the animal model provided by the invention has a healthy immune system and is suitable for all researches on the interaction of HPV E6/E7 and the immune system;
the problem that the gene efficiency and the integration site uncertainty of the traditional random transgenic mouse in the prior art are solved, and the animal model construction method provided by the invention has the characteristics of high gene editing efficiency and definite integration site;
the problem that the gene integration copy number of the traditional random transgenic mouse is not fixed in the prior art is solved, and the animal model construction method provided by the invention has the characteristic of fixed gene integration copy number;
the problem that the traditional random transgenic mouse in the prior art is high in time and money cost is solved, and the animal model construction method provided by the invention can reduce mouse customization cost and shorten construction period.
The invention adopts a CRISPR-Cas9 system, which mainly utilizes the double strand break of 3 bases at the upstream of an adjacent sequence (PAM sequence, NGG) of an original region of a target gene mediated by Cas9 nuclease under the guide of sgRNA, the HNH domain on Cas9 cuts single strand DNA complementary with the sgRNA, the Ruv C domain cuts non-complementary single strand, and the fixed point knock-in of a gene fragment is realized by homologous recombination Repair (Homology-Directed Repair, HDR) under the existence of a template strand. The system has the characteristics of high editing efficiency and targeting property, easy targeting, and more accurate and efficient experimental operation;
the invention uses repair donor containing mouse homologous sequence as homologous recombination repair template, and injects the repair donor and Cas9/sgRNA into mouse fertilized egg together, thus increasing the probability of homologous recombination repair and the probability of obtaining positive mouse, the mouse prepared by the method does not contain other exogenous sequences except the target sequence;
the ROSA26 site and the H11 site are respectively selected as specific insertion sites of a target gene E6/E7, the two sites both belong to safe regions, the fixed-point insertion of an exogenous gene cannot influence the expression of other genes, and the E6/E7 cannot influence the mutual expression;
the promoter-loxP-Stop-loxP-Kozak-HPV E6 or E7-screening marker-polyA sequence is embedded into a specific site at a fixed point, and the promoter and the target gene are separated by a loxP-Stop-loxP structure, so that the promoter cannot start the expression of the target gene under normal conditions. Only after mating with the tissue-specific Cre tool mouse, the target gene can be expressed in specific cells or tissues, and the method has better specificity and controllability compared with the conventional transgenic mouse model;
the invention realizes the insertion of single copy target gene, and the expression quantity is easier to predict; different screening markers are added in the targeting vector, and then the model can be flexibly detected through the markers;
the invention can reduce the customization cost of the gene knock-in mouse model and greatly shorten the research and development period;
the mouse model can be hybridized with any Cre mouse with a tissue-specific promoter or infected by Cre virus, so that the function of E6/E7 genes can be selectively regulated and controlled by individual specific tissues or specific time, and the finally obtained conditional overexpression E6/E7 mouse can be used for researching the influence of E6/E7 on the processes of inducing cell malignant transformation, tumor microenvironment regulation, immune escape and the like in the HPV infection process.
Drawings
FIG. 1 is a schematic diagram showing the overall strategy of gene editing in example 1 of the present invention.
Fig. 2 is an evaluation of sgRNA off-target effect in example 1 of the present invention.
FIG. 3 is a schematic view of a targeting vector in example 1 of the present invention.
FIG. 4 is a diagram showing the results of enzyme digestion verification of the targeting vector in example 1 of the present invention.
FIG. 5 is a schematic diagram of the design of primers for identifying PCR of a targeted mouse in example 1 of the present invention.
FIG. 6 is a diagram showing the results of PCR electrophoresis of the 5' homology arm of F1 mouse in example 1 of the present invention.
FIG. 7 is a diagram showing the results of PCR electrophoresis of the 3' homology arm of the F1 generation mouse in example 1 of the present invention.
FIG. 8 is a graph showing the sequencing alignment of the PCR products of the 5' homology arm of the F1 mouse in example 1.
FIG. 9 shows the sequencing alignment of the 3' homology arm PCR products of the F1 mouse in example 1.
FIG. 10 is a schematic diagram of alternative PCR identification primers for a target mouse in example 1 of the present invention.
FIG. 11 is a schematic diagram of the restriction enzyme and primer design for identifying the southern blot of the targeted mouse in example 1.
FIGS. 12A and 12B are graphs showing the results of southern blot analysis of the targeted mouse in example 1 of the present invention.
FIG. 13 is a schematic diagram showing the overall strategy for gene editing in example 2 of the present invention.
Fig. 14 is an evaluation of sgRNA off-target effect in example 2 of the present invention.
FIG. 15 is a schematic view of a targeting vector in example 2 of the present invention.
FIG. 16 is a diagram showing the results of enzyme digestion verification of the targeting vector in example 2 of the present invention.
FIG. 17 is a schematic diagram of the design of primers for identifying PCR of a target mouse in example 2 of the present invention.
FIG. 18 is a diagram showing the results of PCR electrophoresis of the 5' homology arm of F1 mouse in example 2 of the present invention.
FIG. 19 is a diagram showing the results of PCR electrophoresis of the 3' homology arm of F1 mouse in example 2 of the present invention.
FIG. 20 is a graph showing the sequencing alignment of the PCR products of the 5' homology arm of the F1 mouse in example 2 of the present invention.
FIG. 21 shows the sequencing alignment of the 3' homology arm PCR products of the F1 mouse in example 2 of the present invention.
FIG. 22 is a schematic diagram of alternative PCR identification primers for a target mouse in example 2 of the present invention.
Detailed Description
The technical solution of the present invention is further described below with reference to specific examples.
Specific example 1: construction of animal model for conditional overexpression of HPV16E6 at ROSA26 site
The HPV16E6 gene sequence is knocked in at the ROSA26 site of a mouse model by using a CRISPR-Cas9 gene editing technology, so that the conditional overexpression of HPV16E6 can be realized, and a mouse model of the conditional overexpression of HPV16E6 is established. The method comprises the following steps:
(1) sgRNA design and off-target effect assessment
sgRNA design for conditional overexpression of HPV16E6 at the ROSA26 site in C57BL/6 mice was performed, and candidate sgrnas were evaluated for off-target effects, as shown in fig. 2. The sgrna (formatting forward strandofgene) is obtained by screening:
CUCCAGUCUUUCUAGAAGAUGGG。
(2) incubating the obtained sgRNA and the Cas9 protein together to prepare a Cas9/sgRNA mixture;
(3) gene editing strategy and targeting vector construction
The overall strategy of gene editing is shown In figure 1, and for achieving the purpose of gene editing, as shown In figure 3, an In-Fusion cloning technology is utilized to construct a homologous recombination vector carrying a conditional overexpression E6 sequence, a recombination system used In the construction process is a Cre-LoxP induced expression system, and the vector comprises a gene segment of 'CAG-loxP-Stop-loxP-Kozak-HPV 16E6-3 FLAG-polyA'. The results of the vector restriction verification are shown in FIG. 4.
(4) Microinjection was performed with F0-generation mice
Co-injecting the targeting vector and the Cas9/sgRNA mixture into mouse fertilized eggs; and sending the fertilized eggs after microinjection back to the oviduct of the surrogate mouse, and screening out a target mouse, namely the F0 surrogate mouse, through gene identification after the mouse is born.
(5) F1 generation positive heterozygote mice
And (3) breeding the sexually mature positive F0 mice and wild mice to generate F1 generations, and finally obtaining positive heterozygote F1 generation mice after PCR and Southern verification to complete the mouse model construction capable of subculturing.
(6) F2 generation positive homozygous mice
Selfing the positive heterozygote F1 mouse, and screening to obtain the F2 positive homozygote mouse.
(7) The mouse genotype identification scheme comprises the following steps:
APCR detection and sequencing verification
Genomic DNA from mouse rat tail was extracted from E6 and identified by PCR after targeting in repair donor. As shown in FIG. 5, the primers ROSA26-seqF1/ROSA26-seqR1 are respectively positioned outside the 5 'homologous arm and in the repair donor fragment, and PCR products are generated by the amplification of the primers, so that the target donor is effectively inserted in the 5' of the mouse genome; ROSA26-seqF2/ROSA26-seqR2 are respectively positioned in the fragment of the repirandor and outside the 3 'homologous arm, and if the pair of primers is amplified to generate a PCR product, the target doror is effectively inserted in the 3' of the mouse genome. And the PCR products were sequenced and aligned using primers ROSA26-seqF3/ROSA26-seqR3, respectively.
PCR primer sequences:
| primer name | Primer sequences |
| F1 | 5’-AAAGATCGCTCTCCACGCCCTAG-3’ |
| R1 | 5’-AGATGTACTGCCAAGTAGGAAAGTC-3’ |
| F2 | 5’-CTGCTGTCCATTCCTTATTCCATAG-3’ |
| R2 | 5’-CTGGAAATCAGGCTGCAAATCTC-3’ |
| F3 | 5’-CACTTGCTCTCCCAAAGTCGCTC-3’ |
| R3 | 5’-ATACTCCGAGGCGGATCACAA-3’ |
And (3) PCR reaction system:
and (3) PCR reaction conditions:
in this example, 3 positive F1 mice were obtained by PCR and sequencing verification, No. 2, No. 3, No. 4: the results of 5 'and 3' homology arm PCR identification electrophoresis are shown in FIGS. 6 and 7, respectively (number: F1 mouse number; WT: wild-type control); the 5 'and 3' homology arm PCR products were taken for sequencing and sequence alignment, respectively, and the results are shown in FIG. 8 and FIG. 9 for mouse No. 2.
Remarking:
1) the Taq DNA polymerase used was LongAmp Taq DNA polymerase (NEB M0323V).
2) Two controls used in PCR genotyping were:
controlling water: no DNA template was added.
Wild type control: 400ng of mouse genomic DNA.
If the DNA sample is of lower purity or it is desirable to shorten the PCR reaction time. Alternative primers as in figure 10 may be used.
Alternative PCR primer sequences:
| primer name | Primer sequences |
| F4 | 5’-AGATCTGCAAGCTAATTCCTGC-3’ |
| R4 | 5’-TGCATAACTGTGGTAACTTTCTG-3’ |
Alternative PCR reaction system:
| reaction assembly | Volume of |
| MousetailgenomicDNA | 1μL |
| Forwardprimer(10μM) | 1μL |
| Reverseprimer(10μM) | 1μL |
| PremixTaqPolymerase | 12.5μL |
| ddH2O | 9.5μL |
| Total | 25μL |
Alternative PCR reaction conditions:
b southern blot identification
The double-arm homologous recombination positive mice (No. 2-4) verified by PCR and sequencing are taken to extract rat tail DNA. As shown in FIG. 11, the DNA probe used for Southern blot analysis was selected while being cleaved with restriction enzymes BamHI or BstEII. As shown in FIGS. 12A and 12B, the detection results show that the three mouse DNA fragments can be hybridized with the designed probe, and the sizes of the products are in accordance with the expectation.
5' Probe primer sequence:
| primer name | Primer sequences |
| Forward | 5’-AAACGTGGAGTAGGCAATACCCAGG-3’ |
| Reverse | 5’-AAAGAAGGGTCACCTCAGTCTCCCT-3’ |
3' Probe primer sequence:
| primer name | Primer sequences |
| Forward | 5’-TTCTGGGCAGGCTTAAAGGCTAAC-3’ |
| Reverse | 5’-AGGAGCGGGAGAAATGGATATGAAG-3’ |
Specific example 2: construction of animal model for conditional overexpression of HPV16E7 at H11 site
The HPV16E7 gene sequence is knocked in at the site of H11 of a mouse model by using a CRISPR-Cas9 gene editing technology, so that the conditional overexpression of HPV16E7 can be realized, and a mouse model of the conditional overexpression of HPV16E7 is established. The method comprises the following steps:
(1) sgRNA design and off-target effect assessment
sgRNA design for conditional overexpression of HPV16E7 at the C57BL/6 mouse H11 site and off-target effect assessment of candidate sgrnas were performed as shown in fig. 14. Sgrna (formatting forward strand gene) was screened:
GAACACUAGUGCACUUAUCCUGG。
(2) incubating the obtained sgRNA and the Cas9 protein together to prepare a Cas9/sgRNA mixture;
(3) gene editing strategy and targeting vector construction
The overall strategy of gene editing is shown In FIG. 13, and for achieving the purpose of gene editing, as shown In FIG. 15, an In-Fusion cloning technology is used for constructing a homologous recombination vector carrying a conditional overexpression E7 sequence, a recombination system used In the construction process is a Cre-LoxP induced expression system, and the vector comprises
"CAG-loxP-Stop-loxP-Kozak-HPV 16E 7-HA-polyA" gene fragment. The results of the vector restriction verification are shown in FIG. 16.
(4) Microinjection was performed with F0-generation mice
Co-injecting the targeting vector and the Cas9/sgRNA mixture into mouse fertilized eggs; and sending the fertilized eggs after microinjection back to the oviduct of the surrogate mouse, and screening out a target mouse, namely the F0 surrogate mouse, through gene identification after the mouse is born.
(5) F1 generation positive heterozygote mice
And (3) breeding the sexually mature positive F0 mice and wild mice to generate F1 generations, and finally obtaining positive heterozygote F1 generation mice after PCR and Southern verification to complete the mouse model construction capable of subculturing. (6) F2 generation positive homozygous mice
Selfing the positive heterozygote F1 mouse, and screening to obtain the F2 positive homozygote mouse.
(7) The mouse genotype identification has two schemes of AB:
scheme A: PCR detection and sequencing verification
Genomic DNA from mouse rat tail was extracted from E7 and identified by PCR after targeting in repair donor. As shown in FIG. 17, primers H11-seqF1/H11-seqR1 are respectively located outside the 5 'homology arm and inside the repair donor fragment, and PCR products are generated by the amplification of the primers, which indicates that the target donor is effectively inserted in the 5' of the mouse genome; H11-seqF2/H11-seqR2 are respectively positioned in the fragment of the repair donor and outside the 3 'homology arm, and if the pair of primers is amplified to generate a PCR product, the target donor is effectively inserted in the 3' of the mouse genome. And sequencing and sequence alignment are carried out on the PCR products by using primers H11-seqF3/H11-seqR3 respectively.
PCR primer sequences:
| primer name | Primer sequences |
| F1 | 5’-GTACATCCACAGCATCTTCCAAG-3’ |
| R1 | 5’-AGATGTACTGCCAAGTAGGAAAGTC-3’ |
| F2 | 5’-GCATCTGACTTCTGGCTAATAAAG-3’ |
| R2 | 5’-GCCTTGACCTAAGAGATGATGCGAC-3’ |
| F3 | 5’-CTCTACTGGAGGAGGACAAACTG-3 |
| R3 | 5’-GTCTTCCACCTTTCTTCAGTTAGC-3’ |
And (3) PCR reaction system:
| reaction assembly | Volume of |
| MousetailgenomicDNA | 2μL |
| Forwardprimer(10μM) | 2μL |
| Reverseprimer(10μM) | 2μL |
| dNTPs(2.5mM) | 6μL |
| 5XLongAmpTaqReaction | 10μL |
| LongAmpTaqDNAPolymerase | 2μL |
| ddH2O | 26μL |
| Total | 50μL |
And (3) PCR reaction conditions:
in this example, 3 positive F1 mice were obtained by PCR and sequencing verification, No. 9, 10, 11: the 5 'and 3' homology arm PCR identification electrophoresis results are shown in FIGS. 18 and 19, respectively, wherein the numbers: the mouse numbers of F1 generation; WT: wild type control); the 5 'and 3' homology arm PCR products were taken for sequencing and sequence alignment, respectively, and the results are shown in FIG. 20 and FIG. 21, using mouse No. 10 as an example.
Remarking:
1) the Taq DNA polymerase used was LongAmp Taq DNA polymerase (NEB M0323V).
2) Two controls used in PCR genotyping were:
controlling water: no DNA template was added.
Wild type control: 400ng of mouse genomic DNA.
If the DNA sample is not very pure or does not have sufficient PCR extension time, it may not be possible to amplify long fragment PCR products. Alternative primers as shown in FIG. 22 may be used.
Alternative PCR primer sequences:
| primer name | Primer sequences |
| F4 | 5’-GTGTGACTCTACGCTTCGGTTGTGC-3’ |
| R4 | 5’-CTTTATTAGCCAGAAGTCAGATGC-3’ |
Alternative PCR reaction system:
| reaction assembly | Volume of |
| MousetailgenomicDNA | 1μL |
| Forwardprimer(10μM) | 1μL |
| Reverseprimer(10μM) | 1μL |
| PremixTaqPolymerase | 12.5μL |
| ddH2O | 9.5μL |
| Total | 25μL |
Alternative PCR reaction conditions:
scheme B southern blot identification
Double-arm homologous recombination positive mice (No. 9-11) verified by PCR and sequencing are taken to extract rat tail DNA. The DNA probes used for Southern blot analysis were selected simultaneously by restriction with the restriction enzymes EcoRI or Ssspl. The detection result shows that the corresponding genome segments of the three mice subjected to DNA enzyme digestion can be hybridized with the designed probe, and the size of the product is in accordance with the expectation.
KI probe primer sequence:
| primer name | Primer sequences |
| Forward | 5’-TGCCCTGGCTCACAAATACCACT-3’ |
| Reverse | 5’-TAGCCAACCTTTGTTCATGGCAGC-3’ |
Specific example 3: generation of conditional site-directed HPV16E 6/E7 double knock-in mice
Hybridization to obtain a conditional site-directed HPV16E 6/E7 double knock-in mouse method: mice homozygous for ROSA26 site conditional overexpression HPV16E6 constructed in example 1 were crossed with the mouse model homozygous for H11 site conditional overexpression HPV16E7 constructed in example 2 to obtain positive progeny of mice homozygous for conditional fixed-point HPV16E 6/E7 double knock-in. The heterozygous progeny is 100% homozygous and may not be genotyped.
The invention provides an animal model which can stably inherit and accord with the real pathological state of HPV infection by establishing a conditional fixed-point HPV E6/E7 double-transgenic mouse model through a transgenic technology. The model can be used for researching the HPV key oncogene E6/E7 in vivo function analysis, disease pathogenesis discussion, drug new target discovery, preclinical efficacy evaluation and the like, and has very important scientific significance and clinical value.
SEQUENCE LISTING
<110> Shanghai Coincident Biotechnology Co., Ltd
<120> construction method of mouse model of conditional site-directed double overexpression HPV E6/E7 gene
<130>JSP11912145
<160>24
<170>PatentIn version 3.3
<210>1
<211>23
<212>DNA
<213>Artificial
<220>
<223>sgRNA
<400>1
cuccagucuu ucuagaagau ggg 23
<210>2
<211>23
<212>DNA
<213>Artificial
<220>
<223>Primer
<400>2
aaagatcgct ctccacgccc tag 23
<210>3
<211>25
<212>DNA
<213>Artificial
<220>
<223>Primer
<400>3
agatgtactg ccaagtagga aagtc 25
<210>4
<211>25
<212>DNA
<213>Artificial
<220>
<223>Primer
<400>4
ctgctgtcca ttccttattc catag 25
<210>5
<211>23
<212>DNA
<213>Artificial
<220>
<223>Primer
<400>5
ctggaaatca ggctgcaaat ctc 23
<210>6
<211>23
<212>DNA
<213>Artificial
<220>
<223>Primer
<400>6
cacttgctct cccaaagtcg ctc 23
<210>7
<211>21
<212>DNA
<213>Artificial
<220>
<223>R3
<400>7
atactccgag gcggatcaca a 21
<210>8
<211>22
<212>DNA
<213>Artificial
<220>
<223>Primer
<400>8
agatctgcaa gctaattcct gc 22
<210>9
<211>23
<212>DNA
<213>Artificial
<220>
<223>R4
<400>9
tgcataactg tggtaacttt ctg 23
<210>10
<211>25
<212>DNA
<213>Artificial
<220>
<223>Probe
<400>10
aaacgtggag taggcaatac ccagg 25
<210>11
<211>25
<212>DNA
<213>Artificial
<220>
<223>Probe
<400>11
aaagaagggt cacctcagtc tccct 25
<210>12
<211>24
<212>DNA
<213>Artificial
<220>
<223>Probe
<400>12
ttctgggcag gcttaaaggc taac 24
<210>13
<211>25
<212>DNA
<213>Artificial
<220>
<223>Probe
<400>13
aggagcggga gaaatggata tgaag 25
<210>14
<211>23
<212>RNA
<213>Artificial
<220>
<223>sgRNA
<400>14
gaacacuagu gcacuuaucc ugg 23
<210>15
<211>23
<212>DNA
<213>Artificial
<220>
<223>Primer
<400>15
gtacatccac agcatcttcc aag 23
<210>16
<211>25
<212>DNA
<213>Artificial
<220>
<223>Primer
<400>16
agatgtactg ccaagtagga aagtc 25
<210>17
<211>24
<212>DNA
<213>Artificial
<220>
<223>Primer
<400>17
gcatctgact tctggctaat aaag 24
<210>18
<211>25
<212>DNA
<213>Artificial
<220>
<223>Primer
<400>18
gccttgacct aagagatgat gcgac 25
<210>19
<211>23
<212>DNA
<213>Artificial
<220>
<223>Primer
<400>19
ctctactgga ggaggacaaa ctg 23
<210>20
<211>24
<212>DNA
<213>Artificial
<220>
<223>Primer
<400>20
gtcttccacc tttcttcagt tagc 24
<210>21
<211>25
<212>DNA
<213>Artificial
<220>
<223>Primer
<400>21
gtgtgactct acgcttcggt tgtgc 25
<210>22
<211>24
<212>DNA
<213>Artificial
<220>
<223>Primer
<400>22
ctttattagc cagaagtcag atgc 24
<210>23
<211>23
<212>DNA
<213>Artificial
<220>
<223>Probe
<400>23
tgccctggct cacaaatacc act 23
<210>24
<211>24
<212>DNA
<213>Artificial
<220>
<223>Probe
<400>24
tagccaacct ttgttcatgg cagc 24
Claims (9)
1. A method for constructing a mouse model of conditional site-specific dual overexpression HPV E6/E7 gene is characterized by comprising the following steps:
1. obtaining mice with conditional site-directed tapping of the ROSA26 site HPV E6 and H11 site-conditional site-directed tapping HPV E7:
(1) designing and obtaining sgRNA at mouse ROSA26 site and H11 site respectively according to the sequences of HPV E6 and E7 genes, and evaluating the off-target effect of candidate sequences;
(2) respectively incubating sgRNAs corresponding to the two sequences with Cas9 protein to respectively prepare Cas9/sgRNA mixtures;
(3) constructing a targeting vector, and constructing homologous recombination vectors carrying conditional overexpression E6 or E7 sequences respectively by utilizing In-Fusion cloning technology, wherein a recombination system used In the construction process is a Cre-LoxP induced expression system, and the vectors comprise 'start-loxP-Stop-loxP-Kozak-HPV E6 or E7-screening marker-polyA' gene segments;
(4) microinjection and F0 generation mice, respectively, and the targeting vector and the Cas9/sgRNA mixture are injected into fertilized eggs of the mice together; sending the fertilized eggs subjected to microinjection back to the oviduct of a surrogate mouse, and after the mouse is born, screening out a target mouse through gene identification, namely an F0 generation mouse, including an F0 generation mouse of which the site of ROSA26 is knocked into HPV E6 at a fixed point and an F0 generation mouse of which the site of H11 is knocked into HPV E7 at a fixed point;
(5) obtaining mice of F1 generation, breeding the sexually mature positive F0 generation mice with wild mice to generate F1 generation, and obtaining F1 generation positive heterozygote mice after PCR and Southern verification, wherein the F1 generation positive heterozygote mice comprise F1 generation mice of ROSA26 site fixed point knock-in HPV E6 and F1 generation mice of H11 site fixed point knock-in HPV E7;
(6) selfing the F1 generation positive heterozygote mouse with the site of ROSA26 knocked-in HPV E6 and the F1 generation positive heterozygote mouse with the site of H11 knocked-in HPV E7 respectively, and screening to obtain an F2 generation positive homozygote mouse;
2. obtaining a conditional site-directed HPV E6/E7 double knock-in model mouse:
the mouse with the ROSA26 site fixed point knocked-in HPV E6F 2 generation positive homozygote is hybridized with the mouse with the H11 site fixed point knocked-in HPV E7F2 generation positive homozygote to obtain a conditional fixed point HPV E6/E7 double-knock-in model mouse.
2. The method of constructing a mouse model of conditional overexpression of the HPV E6 gene at the ROSA26 site of claim 1, wherein:
the sequences of sgrnas conditionally overexpressing HPV16E6 are:
CUCCAGUCUUUCUAGAAGAUGGG，
the sequences of sgrnas conditionally overexpressing HPV16E7 are:
GAACACUAGUGCACUUAUCCUGG。
3. the method of constructing a mouse model of conditionally overexpressing HPV E6 at the ROSA26 site of claim 1, further comprising:
mouse genotype identification: by adopting PCR detection or sequencing verification,
extracting genome DNA of an E6 mouse rat tail, and performing PCR identification after the target of the repair donor is in the target, wherein primers ROSA26-seqF1/ROSA26-seqR1 are respectively positioned outside a 5 'homology arm and in a repair donor fragment, and if a PCR product is generated by amplification of the pair of primers, the target donor is effectively inserted in the 5' genome of the mouse; ROSA26-seqF2/ROSA26-seqR2 are respectively positioned in the fragment of the repair donor and outside the 3 'homology arm, if the pair of primers are amplified to generate a PCR product, the target donor is effectively inserted into the 3' of the mouse genome;
e7 mouse rat tail genomic DNA was extracted and subjected to PCR identification after targeting with repair donor. As shown in FIG. 19, primers H11-seqF1/H11-seqR1 are respectively located outside the 5 'homology arm and in the repair donor fragment, and PCR products are generated by the amplification of the primers, which indicates that the target donor is effectively inserted in the 5' of the mouse genome; H11-seqF2/H11-seqR2 are respectively positioned in the fragment of the repair donor and outside the 3 'homology arm, and if the pair of primers is amplified to generate a PCR product, the target donor is effectively inserted in the 3' of the mouse genome.
4. The method of claim 3, wherein the mouse model for conditional overexpression of the HPV E6 gene at the ROSA26 site,
the primer sequences adopted by PCR detection or sequencing verification are as follows:
e6 mice:
e7 mice:
5. the method of constructing a mouse model of conditional overexpression of the HPV E6 gene at the ROSA26 site of claim 4, wherein:
if the purity of the DNA sample is low or the PCR reaction time is desired to be shortened, alternative PCR primers are adopted, and PCR products with shorter fragments can be obtained, wherein the sequences of the alternative PCR primers are respectively as follows:
e6 mice:
e7 mice:
。
6. The method of constructing a mouse model of conditional overexpression of the HPV E6 gene at the ROSA26 site of claim 5, wherein:
alternative PCR reaction system:
。
7. The method of constructing a mouse model of conditional overexpression of the HPV E6 gene at the ROSA26 site of claim 6, wherein:
alternative PCR reaction conditions:
8. the method of constructing a mouse model of conditionally overexpressing HPV E6 at the ROSA26 site of claim 1, further comprising:
mouse genotype identification: and (3) identifying by using Southern blot:
taking the double-arm homologous recombination positive mouse verified by PCR and sequencing, extracting rat tail DNA, carrying out enzyme digestion by restriction enzyme BamHI or BstEII, simultaneously selecting a DNA probe for Southern blot analysis,
e6 mouse 5' probe primer sequence:
e6 mouse 3' probe primer sequence:
e7 mouse KI probe primer sequence:
。
9. The method of constructing a mouse model of conditionally overexpressing HPV E6 at the ROSA26 site of claim 1, further comprising:
crossing the fixed point HPV E6 single knock-in mouse, the fixed point HPV E7 single knock-in mouse or the fixed point HPV E6/E7 double knock-in model mouse with Cre mouse with tissue specific promoter or infecting with Cre virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911320627.4A CN111041047A (en) | 2019-12-19 | 2019-12-19 | Construction method of mouse model for conditionally site-specific double overexpression HPV E6/E7 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911320627.4A CN111041047A (en) | 2019-12-19 | 2019-12-19 | Construction method of mouse model for conditionally site-specific double overexpression HPV E6/E7 gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111041047A true CN111041047A (en) | 2020-04-21 |
Family
ID=70238131
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911320627.4A Pending CN111041047A (en) | 2019-12-19 | 2019-12-19 | Construction method of mouse model for conditionally site-specific double overexpression HPV E6/E7 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111041047A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111500544A (en) * | 2020-04-22 | 2020-08-07 | 江苏同科医药科技有限公司 | Mouse fibroblast strain capable of conditionally over-expressing HPV E7 and application thereof |
| CN111662904A (en) * | 2020-04-22 | 2020-09-15 | 华中科技大学同济医学院附属同济医院 | Preparation of sgRNA and HaCaT cell models of human genome sequences at high-frequency integration sites of targeted high-risk HPV |
| CN111979265A (en) * | 2020-07-17 | 2020-11-24 | 中国人民解放军陆军军医大学第二附属医院 | Construction method of spontaneous squamous cell lung carcinoma mouse model |
| CN112239767A (en) * | 2020-09-24 | 2021-01-19 | 中国人民解放军军事科学院军事医学研究院 | Construction method and application of mouse model for non-destructive monitoring of neuroinflammation by breaking through skull limitation |
| CN112997966A (en) * | 2021-03-08 | 2021-06-22 | 国家卫生健康委科学技术研究所 | Mouse model knocking-in miRNA-125a based on CRISPR/Cas9 technology and construction method |
| CN115074368A (en) * | 2022-06-09 | 2022-09-20 | 澳门科技大学 | Construction and application of drug-resistant rheumatoid arthritis animal model |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050138677A1 (en) * | 2003-09-16 | 2005-06-23 | Pfister Herbert J. | Transgenic animal model for the treatment of skin tumors |
| CN108315350A (en) * | 2018-03-01 | 2018-07-24 | 昆明医科大学 | It is overexpressed COX5A/ low expression BDNF transgenic mouse models and its construction method and application |
| CN110093369A (en) * | 2019-04-25 | 2019-08-06 | 成都药康生物科技有限公司 | A kind of construction method being overexpressed Yap1 genetic mouse model in the site H11 conditionity |
-
2019
- 2019-12-19 CN CN201911320627.4A patent/CN111041047A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050138677A1 (en) * | 2003-09-16 | 2005-06-23 | Pfister Herbert J. | Transgenic animal model for the treatment of skin tumors |
| CN108315350A (en) * | 2018-03-01 | 2018-07-24 | 昆明医科大学 | It is overexpressed COX5A/ low expression BDNF transgenic mouse models and its construction method and application |
| CN110093369A (en) * | 2019-04-25 | 2019-08-06 | 成都药康生物科技有限公司 | A kind of construction method being overexpressed Yap1 genetic mouse model in the site H11 conditionity |
Non-Patent Citations (3)
| Title |
|---|
| CARPER等: "An Immunocompetent Mouse Model of HPV16(+) Head and Neck Squamous Cell Carcinoma" * |
| LI等: "Generation of H11-albumin-rtTA Transgenic Mice: A Tool for Inducible Gene Expression in the Liver" * |
| 殷俊;高慧;李厚达;: "HPV16(E6-E7)转基因小鼠肿瘤细胞系的建立与生物学特性观察" * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111500544A (en) * | 2020-04-22 | 2020-08-07 | 江苏同科医药科技有限公司 | Mouse fibroblast strain capable of conditionally over-expressing HPV E7 and application thereof |
| CN111662904A (en) * | 2020-04-22 | 2020-09-15 | 华中科技大学同济医学院附属同济医院 | Preparation of sgRNA and HaCaT cell models of human genome sequences at high-frequency integration sites of targeted high-risk HPV |
| CN111979265A (en) * | 2020-07-17 | 2020-11-24 | 中国人民解放军陆军军医大学第二附属医院 | Construction method of spontaneous squamous cell lung carcinoma mouse model |
| CN111979265B (en) * | 2020-07-17 | 2022-03-22 | 中国人民解放军陆军军医大学第二附属医院 | Construction method of spontaneous squamous cell lung carcinoma mouse model |
| CN112239767A (en) * | 2020-09-24 | 2021-01-19 | 中国人民解放军军事科学院军事医学研究院 | Construction method and application of mouse model for non-destructive monitoring of neuroinflammation by breaking through skull limitation |
| CN112239767B (en) * | 2020-09-24 | 2022-04-15 | 中国人民解放军军事科学院军事医学研究院 | Construction method and application of mouse model for non-destructive monitoring of neuroinflammation by breaking through skull limitation |
| CN112997966A (en) * | 2021-03-08 | 2021-06-22 | 国家卫生健康委科学技术研究所 | Mouse model knocking-in miRNA-125a based on CRISPR/Cas9 technology and construction method |
| CN115074368A (en) * | 2022-06-09 | 2022-09-20 | 澳门科技大学 | Construction and application of drug-resistant rheumatoid arthritis animal model |
| CN115074368B (en) * | 2022-06-09 | 2023-08-08 | 澳门科技大学 | Construction and application of drug-resistant rheumatoid arthritis animal model |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111041047A (en) | Construction method of mouse model for conditionally site-specific double overexpression HPV E6/E7 gene | |
| CN111019971A (en) | Construction method of mouse model for conditionally overexpressing HPV E6 gene at ROSA26 site | |
| US20220015342A1 (en) | Gene editing of reproductive hormones to reduce fertility in ictalurus punctatus | |
| Albadri et al. | Genome editing using CRISPR/Cas9-based knock-in approaches in zebrafish | |
| Bäck et al. | Neuron-specific genome modification in the adult rat brain using CRISPR-Cas9 transgenic rats | |
| CN108660161B (en) | Method for preparing chimeric gene-free knockout animal based on CRISPR/Cas9 technology | |
| JP6700306B2 (en) | Pre-fertilization egg cell, fertilized egg, and method for modifying target gene | |
| CN110923265A (en) | Construction method of mouse model for conditionally overexpressing HPV E7 gene at H11 site | |
| Honda et al. | Single-step generation of rabbits carrying a targeted allele of the tyrosinase gene using CRISPR/Cas9 | |
| CN109197781B (en) | Construction method of AURKA-CKO1-N conditional gene knockout mouse model | |
| JP7199577B2 (en) | Targeting vector, nucleic acid composition and construction method for constructing liver injury mouse model | |
| CN103409448B (en) | Model mouse preparation method and recombinant vector for conditional cell removal | |
| CN106282231B (en) | Construction method and application of mucopolysaccharide storage disease type II animal model | |
| Mizuno-Iijima et al. | Efficient production of large deletion and gene fragment knock-in mice mediated by genome editing with Cas9-mouse Cdt1 in mouse zygotes | |
| CN106554972B (en) | A kind of construction method of the enterovirns type 71 infection model based on hSCARB2 gene knock-in and the purposes of the infection model | |
| CN110541002A (en) | method for constructing zebra fish asap1b gene knockout mutant by using CRISPR/Cas9 technology | |
| Takasu et al. | Precise genome editing in the silkworm Bombyx mori using TALENs and ds-and ssDNA donors–A practical approach | |
| CN110951745A (en) | CD163 mutant gene and method and application thereof in inhibiting or blocking antibody production of pig | |
| JP2023525263A (en) | Methods for improving the health of swine species by targeting CD163 inactivation | |
| Du et al. | Generation of Rm21LG transgenic mice: a powerful tool to generate conditional overexpression of miR-21 that is involved in oncogenesis | |
| KR20180021135A (en) | Humanized heart muscle | |
| EP3311660B1 (en) | Method for producing blood chimeric animal | |
| CN115992176A (en) | Method for constructing model pig capable of inducing Cas9 protein expression through drugs | |
| CN106554954B (en) | In vivo efficacy evaluation method of EV71 vaccine and antiviral drug screening method | |
| Ohtsuka | Development of Pronuclear Injection-Based Targeted Transgenesis in Mice Through Cre–loxP Site-Specific Recombination |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20200421 |
|
| WD01 | Invention patent application deemed withdrawn after publication |