CN112239767B - Construction method and application of mouse model for non-destructive monitoring of neuroinflammation by breaking through skull limitation - Google Patents

Abstract

The invention discloses a construction method and application of a mouse model for non-destructive monitoring of neuroinflammation by breaking through skull limitation. The invention establishes a Gfap-IRES-Venus-AkaLuc knock-in mouse model by connecting the genes of novel luciferase AkaLuc and yellow fluorescent protein Venus in series and connecting the genes behind the Gfap gene through an IRES sequence, and on the basis, the mouse model for inducing neuroinflammation through intracranial injection of virus and the increase of the fluorescence intensity in the mouse model for inducing neuroinflammation through nondestructive dynamic detection of virus prove that the mouse model established by the invention can be applied to the nondestructive dynamic detection of neuroinflammation.

Description

Construction method and application of mouse model for non-destructive monitoring of neuroinflammation by breaking through skull limitation

Technical Field

The invention belongs to the technical field of biology, and relates to a method for constructing a mouse model, in particular to a method for constructing a mouse model for non-destructive monitoring of neuroinflammation by breaking through skull limitation.

Background

The neuroinflammation is derived from microglial cell and astrocyte activation caused by various peripheral factors and/or central factors, and can promote the occurrence and development of various central nervous system diseases. Dynamic monitoring of neuroinflammation is of great importance, but in vitro monitoring is difficult due to the presence of the skull. The expression level of certain specific molecules such as calcium-binding protein Iba1 and mitochondrial outer membrane protein TSPO specifically expressed by microglia is obviously increased in the nerve inflammation state, and the radioactive isotope labeled TSPO ligand is used as an in vivo probe, so that the brain area location of inflammatory reaction can be accurately observed by the PET/SPECT technology, and the radioactive isotope labeled TSPO ligand not only can be used for animal models, but also has more clinical applications (Notter T, Couchlin JM, Sawa A, Meyer U.Reconception analysis of transporter protein as a biomarker of neuroinflammation in psychiatric Psychiatry 2018; 23: 36-47). however, the in vivo application of the radioactive isotope labeled ligand inevitably has damage to the organism, so that the method for establishing the nerve inflammation nondestructive in-vitro monitoring and the corresponding animal models have important significance.

At present, no method for nondestructive in-vitro monitoring of neuroinflammation and corresponding animal models are reported. GFAP is an intermediate filament protein that is expressed primarily in astrocytes and is expressed at significantly elevated levels upon activation of astrocytes. The luciferase transgenic mouse controlled by the GFAP promoter can visually observe in vivo neuroinflammation, but the sensitivity is not enough, and the skull needs to be opened for observation. In order to improve the sensitivity, the luciferase AkaLuc with the transformation efficiency improved by 100-fold, which is connected with the yellow fluorescent protein Venus gene in series is adopted, the gene is added behind the GFAP gene through IRES, a mouse model (Gfap-IRES-Venus-AkaLuc knock in) which breaks through skull limitation and monitors neuroinflammation without damage is established, the neuroinflammation is induced by intracranial injection of Vesicular Stomatis Virus (VSV), and the nondestructive living body imaging observation of the neuroinflammation is realized by utilizing the novel commercialized fluorescein in vivo injection.

Disclosure of Invention

Aiming at the defects in the prior art, the invention aims to provide a construction method and application of a mouse model for breaking through skull-limited nondestructive monitoring of neuroinflammation.

The above object of the present invention is achieved by the following technical solutions:

the invention provides a method for constructing a mouse model for non-destructive monitoring of neuroinflammation by breaking through skull limitation.

Further, the method comprises the steps of:

(1) vector construction: constructing a homologous recombinant vector carrying a yellow fluorescent protein gene Venus and a luciferase reporter gene AkaLuc;

(2) and (2) introducing the Cas9mRNA, the gRNA and the homologous recombination vector constructed in the step (1) into a mouse body, and constructing to obtain a skull-broken nondestructive nerve inflammation monitoring mouse model.

Further, the GFAP gene was added before the tandem Venus and AkaLuc genes by IRES.

Further, the homologous recombinant vector in the step (1) comprises a 5 'homology arm, IRES-Venus-AkaLuc and a 3' homology arm.

Further, the method comprises genotyping the mouse.

Further, the identification comprises a homologous recombination positive mouse PCR identification scheme: the 5' arm homologous recombination positive genome should amplify a 4.2kb fragment, and the negative genome should have no product; 3' arm homologous recombination positive genome should amplify 3.7kb fragment, and negative genome should amplify 7.6kb fragment.

Further, the method comprises the step of carrying out functional identification on the mouse model obtained by the construction method.

Further, the specific method for functional identification comprises the following steps:

(1) intracranial injection of virus into the mouse model, establishing an intracranial virus infection mouse model;

(2) detecting the expression level of interferon in the mouse model in the step (1);

(3) if the expression level of the interferon is increased, the mouse model is successfully established.

Further, the mouse model of intracranial virus infection described in step (1) is a mouse model of neuroinflammation induced by intracranial injection of a virus.

Further, the viruses described in step (1) include, but are not limited to: vesicular Stomatitis Virus (VSV), Herpes Simplex Virus (HSV), B herpes virus (BV), EB virus, cytomegalovirus and varicella zoster virus.

Further, the method for detecting the expression level of interferon includes but is not limited to: real-time fluorescent quantitative PCR, in-situ hybridization, gene chip, protein immunoblotting (Western blot), enzyme-linked immunosorbent assay (ELISA), and colloidal gold detection.

(1) Real-time fluorescent quantitative PCR (Real-time PCR, RT-PCR)

The real-time fluorescent quantitative PCR technology is characterized in that a fluorescent group is added into a PCR reaction system, the whole PCR process is detected in real time by utilizing fluorescent signal accumulation, and finally, an unknown template is qualitatively and quantitatively analyzed through a standard curve, and the technology has the following characteristics: and displaying the amount of the amplified product by using an indicator generating a fluorescent signal, and carrying out real-time dynamic continuous fluorescence monitoring. The fluorescent signal is obtained by embedding fluorescent dye into double-stranded DNA or specifically combining fluorescent probe with target detection object, so that the sensitivity, specificity and accuracy of detection are greatly improved.

(2) In situ hybridization (In situ hybridization)

In situ hybridization chemistry is a form of nucleic acid hybridization, which refers to a process of hybridizing specifically labeled nucleic acids with known sequences as probes to nucleic acids in cells or tissue sections, thereby precisely and quantitatively locating specific nucleic acid sequences. Has the advantages of safety, rapidness, high sensitivity, good specificity, long-term preservation of the probe and simultaneous display of various colors.

(3) Gene chip (Genechip)

A gene chip or DNA microarray (DNA Array) is prepared through in-situ photoetching or micro-spotting to fix a great number of DNA molecules on the surface of supporter (such as glass slide, silicon chip, polyacrylamide gel, nylon membrane, etc) to form dense two-dimensional molecular Array, hybridizing with the target molecules in biological sample, and quickly, parallelly and efficiently detecting and analyzing the intensity of hybridized signal by a special instrument such as laser confocal scan or charge Coupled Camera (CCD) to judge the number of target molecules in sample. Has the advantages of high speed, high efficiency and automation.

(4) Protein immunoblotting (Western blot)

The western blotting method is a protein analysis method in which proteins are separated on polyacrylamide gel by protein gel electrophoresis (SDS-PAGE), then transferred from the gel to an NC membrane or a PVDF membrane, and then subjected to blotting detection by using an antibody, is a commonly used method for detecting protein characteristics, expression and distribution, and has the advantages of large analysis capacity, high sensitivity and strong specificity.

(5) Enzyme-linked immunosorbent assay (ELISA)

The principle of enzyme-linked immunosorbent assay is to bind antigen or antibody to substrate (enzyme) to keep the immunoreaction and enzyme activity. The marked antigen or antibody is combined with the ligand coated on the solid phase carrier, and then the ligand is reacted with the corresponding colorless substrate to display color, and the OD value is determined by visual inspection according to the color development depth or an enzyme-labeling instrument. The method mainly comprises a sandwich method, an indirect method, a competition method and a capture method, and has the advantages of simple and rapid operation, high sensitivity, strong specificity and wide application range.

(6) Colloidal gold detection method

The principle of the colloidal gold detection method is that a specific antibody is fixed on a membrane in a strip shape (T line), a colloidal gold labeled reagent is adsorbed on a binding body (gold pad), when an antigen to be detected is added on a sample pad at one end of a test strip, a sample moves forwards through capillary action, the colloidal gold labeled reagent on the binding pad is dissolved and then reacts with each other, and when the sample moves to a region of the fixed antigen or antibody, the binding body of the object to be detected and the gold labeled reagent is specifically bound with the binding body and is intercepted, and is gathered on the detection strip. Has the advantages of rapidness, simple and convenient operation, low cost and good stability.

In the embodiment of the present invention, the virus in step (1) is preferably Vesicular Stomatitis Virus (VSV), the interferons in step (2) are preferably Ifn α 4 and Ifn β 1, and the detection method is preferably real-time fluorescent quantitative PCR.

The second aspect of the present invention provides the application of the method for constructing the mouse model according to the first aspect of the present invention in the field of animal model construction.

The third aspect of the invention provides an application of the mouse model obtained by the construction method of the mouse model described in the first aspect of the invention in screening drugs for preventing or treating neuroinflammation.

Further, the use includes a method of screening a candidate drug for preventing or treating neuroinflammation.

In a fourth aspect of the present invention, there is provided a method of screening a candidate drug for preventing or treating neuroinflammation.

Further, the method comprises the steps of:

(1) administering a test drug candidate to a mouse model infected with a virus constructed by the method of construction of the first aspect of the invention;

(2) in vitro non-destructive dynamic monitoring of neuroinflammation induced by intracranial viral infection in a mouse model;

(3) test drug candidates are selected that result in a decrease in fluorescence intensity in mice.

Further, the mouse model infected with a virus described in step (1) is a mouse model of neuroinflammation induced by intracranial injection of a virus.

Further, the viruses described in step (1) include, but are not limited to: vesicular Stomatitis Virus (VSV), Herpes Simplex Virus (HSV), B herpes virus (BV), EB virus, cytomegalovirus and varicella zoster virus.

Further, the dynamic monitoring described in step (2) was performed by bioluminescence imaging by an In Vivo Imaging System (IVIS) Spectrum (PerkinElmer, Santa Clara, CA, USA) and analyzed using the Living Image 4.5.2 software (PerkinElmer) specific to IVIS system.

The invention has the advantages and beneficial effects that:

(1) the invention firstly constructs a mouse model for non-destructive monitoring of neuroinflammation, namely a Gfap-IRES-Venus-AkaLuc knock-in mouse model, which breaks through skull limitation.

(2) The mouse model constructed by the invention has the advantages of high sensitivity, and breakthrough of skull limitation (nondestructive) and dynamic monitoring.

(3) The invention provides a construction method of a mouse model for non-destructive monitoring of neuroinflammation, which breaks through skull limitation, and has the advantages of relatively simple construction process, convenient operation and low construction cost.

(4) The mouse model constructed by the invention can be used for screening candidate drugs for neuroinflammation, and provides an important research model for researching etiology, occurrence and development mechanism and treatment of neuroinflammation.

Drawings

Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:

FIG. 1 is a diagram of a homologous recombination plasmid vector constructed according to the present invention;

FIG. 2 is a schematic diagram of the Gfap-IRES-Venus-AkaLuc knock in mouse model construction;

FIG. 3 is a diagram showing the result of PCR identification electrophoresis of F0 mouse, in which, A is: 5' arm, Panel B: a 3' arm;

FIG. 4 is a diagram showing the result of PCR identification electrophoresis of F1 mouse, in which, A is: 5' arm, Panel B: a 3' arm;

FIG. 5 is a diagram showing the results of PCR identification electrophoresis after breeding of model mice, in which A is a diagram: wild type mouse, panel B: HE mice (post-reproductive model mice);

FIG. 6 is a graph of the results of bioluminescence imaging of mice by In Vivo Imaging System (IVIS);

FIG. 7 is a graph showing the results of expression levels of Ifn α 4 in the control group and VSV-injected group by qRT-PCR, in which, Panel A: amplification profile, panel B: a result statistical chart;

FIG. 8 is a graph showing the results of expression levels of Ifn β 1 in the control group and VSV-injected group by qRT-PCR, in which, Panel A: amplification profile, panel B: a result statistical chart;

FIG. 9 is a graph showing the results of activation of glial cells after 5 days of immunofluorescence analysis with intracranial VSV virus injection, in which panel A: control, panel B: VSV injection group;

FIG. 10 is a graph of in vivo fluorescence imaging analysis of neuroinflammation levels after 5 days of intracranial injection of VSV virus, where plot A: imaging result chart, B chart: statistical plots of results, mice 401 and 407 injected with VSV, and mice 408 and 409 injected with an equivalent amount of saline.

Detailed Description

The present invention will be described in further detail with reference to the following detailed description and accompanying drawings. In the following embodiments, numerous details are set forth in order to provide a better understanding of the present invention, and are set forth in order to illustrate, but not to limit the scope of the present invention. However, those skilled in the art will readily recognize that some of the features may be omitted or replaced with other elements, materials, methods in different instances. The experimental methods not specified in the examples are generally commercially available according to the conditions described in the conventional conditions or according to the conditions recommended by the manufacturers, and the materials, reagents and the like used in the examples, unless otherwise specified.

Example 1 construction of Gfap-IRES-Venus-AkaLuc knock-in mouse model

1. Construction of Gfap-IRES-Venus-AkaLuc knockin mouse model

By adopting CRISPR/Cas9 technology, an IRES-Venus-AkaLuciferase expression frame is knocked in at the stop codon site of the Gfap gene in a homologous recombination mode.

The process is as follows: by means of in vitro transcription, Cas9mRNA and gRNA were obtained, the sequences of the gRNA were: CAATCTGGTGAGCCTGTATT (SEQ ID NO.15), and constructing a homologous recombinant vector (donor vector) by the In-Fusion cloning method, wherein the vector comprises a 3.7kb 5 'homology arm, an IRES-Venus-AkaLuciferase and a 3.3kb 3' homology arm, and the map of the constructed homologous recombinant plasmid vector is shown In FIG. 1, wherein element Rep is a replication initiation site, element Amp is an ampicillin resistance screening gene, element 5 'arm is a 5' homology arm, and element 3 'arm is a 3' homology arm. Cas9mRNA, gRNA and homologous recombinant plasmid vector are injected into fertilized eggs of a C57BL/6J mouse in a micro-injection mode, the fertilized eggs after injection are transplanted into a pseudopregnant mother mouse, the mouse born about 20 days is an F0 generation mouse, the early stage oozing speed of the fertilized eggs is fast, so the obtained F0 generation mouse is a chimera and does not necessarily have the capability of stable inheritance, passage is needed to obtain the F1 generation mouse capable of stable inheritance, namely the F0 generation mouse positive in PCR identification is mated with a wild type C57BL/6J mouse for breeding to obtain the F1 generation mouse, and the genotype identification is carried out through the PCR identification.

2. Genotyping

Performing PCR identification on F0 mice, and performing a PCR identification scheme on homologous recombination positive mice: the 5' arm homologous recombination positive genome should amplify a 4.2kb fragment, and the negative genome should have no product; 3' arm homologous recombination positive genome should amplify 3.7kb fragment, and negative genome should amplify 7.6kb fragment.

Performing PCR identification on F1 mice, and performing a PCR identification scheme on homologous recombination positive mice: the 5' arm homologous recombination positive genome should amplify a 4.2kb fragment, and the negative genome should have no product; 3' arm homologous recombination positive genome should amplify 3.7kb fragment, and negative genome should amplify 7.6kb fragment.

(1) Rat tail DNA extraction

1) Marking the mouse to be identified with the ear number, clipping the tail end of the mouse with the length of 0.1-0.2cm, putting the tail end into a 1.5mL E P tube, adding 200mL of Tissue Lysate (TL) and 20mL of proteinase K, and shaking and mixing uniformly. Thermostatic water bath at 55 ℃ for 4h or overnight.

2) 100mL of isopropanol and 200mL of conjugate CB were added to the lysate and mixed well.

3) Centrifuging at 13000rpm for 5min, adding the supernatant into the adsorption column, centrifuging at 10000rpm for 30s, and discarding the waste liquid.

4) 500mL of inhibitor removing solution (IR) was added to the adsorption column, and the mixture was centrifuged at 12000rpm for 30 seconds to discard the waste liquid.

5) 700mL of the rinse solution (WB) was added to the adsorption column, and after centrifugation at 12000rpm for 30 seconds, the waste liquid was discarded. The centrifugation was repeated 1 more time to remove the rinsing solution as much as possible.

6) The adsorption column was placed in a new EP tube labeled with the corresponding ear number, 100mL of the eluent was added, and after standing for 2min, centrifugation was carried out at 12000rpm for 1 min.

7) The obtained DNA was immediately subjected to PCR or stored in a refrigerator at-20 ℃.

(2) Identification of mouse tail genotype

The reaction conditions, reaction system and primer sequences are shown in tables 1-3.

TABLE 1 reaction conditions

TABLE 2 reaction System

TABLE 3 primer sequences

P1 and P2 are used for amplifying 5' arm homologous recombination positive genome fragments; p3, P4 were used to amplify 3' arm homologous recombination positive genomic fragments.

Homologous recombination positive mouse PCR identification scheme:

the 5' arm homologous recombination positive genome should amplify a 4.2kb fragment, and the negative genome has no product; 3' arm homologous recombination positive genome should amplify 3.7kb fragment, and negative genome should amplify 7.6kb fragment.

3. Results of the experiment

The map of the constructed homologous recombination vector plasmid is shown in figure 1, and the schematic construction diagram of the Gfap-IRES-Venus-AkaLuc knock-in mouse model is shown in figure 2. The electrophoresis result chart of the F0 mouse PCR identification is shown in the figure 3A and B, and the result shows that only the 5 'arm homologous recombination genome of No.1 amplifies a 4.2kb fragment, the negative genome has no product, the 3' arm homologous recombination genome amplifies a 3.7kb fragment, the negative genome amplifies a 7.6kb fragment, which indicates that the F0 mouse with double-arm homologous recombination positive is No. 1; the electrophoresis result of the F1 mouse PCR identification is shown in the picture of 4A and B, the result shows that the 5 'arm homologous recombination genome of No.1 and No. 7 amplifies 4.2kb fragment, the negative genome has no product, the 3' arm homologous recombination genome amplifies 3.7kb fragment, the negative genome amplifies 7.6kb fragment, namely the PCR identification of the positive mouse is No.1 and No. 7, which shows that the Gfap-IRES-Venus-AkaLuc knock-in mouse model which can be stably inherited is successfully constructed.

Example 2 propagation and genotyping of Gfap-IRES-Venus-AkaLuc knock-in mouse model generation F1

In the mouse mating and breeding process, different genotypes are distinguished according to the existence of PCR products and the difference of fragment sizes when wild type and mutant type are identified by PCR before and after knocking in the target sequence, and the mouse genotypes are identified by a short-fragment PCR mode in the embodiment.

1. Rat tail DNA extraction

(1) Marking the mouse to be identified with an ear number, clipping the tail end of the mouse with the length of 0.1-0.2cm, putting the tail end into a 1.5mL EP tube, adding 200mL of Tissue Lysate (TL) and 20mL of proteinase K, and shaking and mixing uniformly. Thermostatic water bath at 55 ℃ for 4h or overnight.

(2) 100mL of isopropanol and 200mL of conjugate CB were added to the lysate and mixed well.

(3) Centrifuging at 13000rpm for 5min, adding the supernatant into the adsorption column, centrifuging at 10000rpm for 30s, and discarding the waste liquid.

(4) 500mL of inhibitor removing solution (IR) was added to the adsorption column, and the mixture was centrifuged at 12000rpm for 30 seconds to discard the waste liquid.

(5) 700mL of the rinse solution (WB) was added to the adsorption column, and after centrifugation at 12000rpm for 30 seconds, the waste liquid was discarded. The centrifugation was repeated 1 more time to remove the rinsing solution as much as possible.

(6) The adsorption column was placed in a new EP tube labeled with the corresponding ear number, 100mL of the eluent was added, and after standing for 2min, centrifugation was carried out at 12000rpm for 1 min.

(7) The obtained DNA was immediately subjected to PCR or stored in a refrigerator at-20 ℃.

2. Identification of mouse tail genotype

The reaction conditions, reaction systems and primer sequences required for mouse genotype identification are shown in tables 4-6.

TABLE 4 reaction conditions

TABLE 5 reaction System

TABLE 6 primer sequences

P1 and P2 are used for amplifying a 332bp band; p3, P4 were used to amplify a 702bp band.

The product was subjected to agarose gel electrophoresis at a gel concentration of 1.5%.

The mouse genome was amplified using primer pairs (P1, P2), (P3, P4), respectively, and the identification scheme was as follows:

wild type: only (P1, P2) amplified a 332bp band, and (P3, P4) no band;

heterozygote: (P1, P2) amplified a 332bp band, and (P3, P4) also amplified a small band of 702 bp;

a homozygote: (P1, P2) has no band, and (P3, P4) can amplify a small band of 702 bp.

3. Results of the experiment

The result shows that the He mutant mouse after breeding amplifies a 702bp band, and the wild mouse amplifies a 332bp band (see the figure 5A and B), and further proves the successful construction of the mutant Gfap-IRES-Venus-AkaLuc knock-in mouse model.

Example 3 Gfap-IRES-Venus-AkaLuc knock-in mouse model intracranial Virus injection induces expression of type I interferon

1. VSV (vesicular stomatitis virus) intracranial injection

Mice were anesthetized with pentobarbital (150 mg/kg); placing a mouse on a stereo positioning instrument and fixing; shaving the hair on the top of the mouse skull by using a small electric shaver and sterilizing; lifting the skin at the top of the skull with forceps and cutting a circle of skin (about 5mm in diameter) with scissors, fully exposing the area where the coronal and sagittal lines of the skull meet; cleaning periosteum of the exposed part by using forceps and a blade and repairing the skull; drilling a hole on the skull by using a high-speed miniature cranial drill (the diameter is about 0.5mm, the distance between the drilling position and the midline is 1.5mm, and the bregma is 0.7 mm); using a microinjection Pump to control the microinjector to carry out intracranial injection of VSV (depth of 2mm, volume of 2. mu.L, concentration of 1X 10) at the puncture site⁶pfu/g, the injection time is 10min, the syringe is taken out after the injection is finished and the standing time is 10 min), or the equivalent amount of normal saline; mice were gently returned after surgery and maintained at body temperature until normal.

2. Bioluminescent imaging

Shaving off the hair on the mouse head using a small electric razor; mice were given intraperitoneal injections of luciferase substrate AkaLumine (trade name TokeOni, Sigma-Aldrich, cat No. 808350, 50. mu.L/mouse, concentration 300. mu. mol/mL) 12min before imaging; mice were anesthetized 5min after substrate injection; injecting the substrate for 10min, placing in a machine, and placing in a prone position; bioluminescence imaging was performed 12min after substrate injection using an In Vivo Imaging System (IVIS) Spectrum (Perki nlmer, Santa Clara, CA, USA) (parameters as follows: open for total bio luminescence, exposure time auto, binding medium:8, field of view: 25.2 × 25.2cm and f/stop 1) and analyzed using the life Image 4.5.2 software (PerkinElmer) specific to IVIS system; the interval between the continuous in vivo imaging of the mice was 24 h.

3. Type I interferon expression detection

(1) Extraction of RNA

1) Taking about 200 mu g of mouse brain tissue, adding 1mL of TRIzol reagent, repeatedly blowing and beating to crack cells, and standing for 5min at room temperature;

2) adding 200 μ L chloroform, shaking for 15s, standing at room temperature for 7 min;

3) centrifuging at 4 deg.C and 12,000rpm for 15min, and transferring the upper water phase into a new RNA-free enzyme centrifuge tube;

4) adding 500 μ L isopropanol, reversing, mixing, and standing at room temperature for 15 min;

5) centrifuging at 4 deg.C and 12,000rpm for 20min, and discarding the supernatant;

6) adding 75% ethanol prepared from DEPC water and absolute ethanol, 1 mL/tube, and washing RNA;

7) centrifuging at 7500rpm at 4 deg.C for 20min, and removing supernatant;

8) placing in a fume hood at room temperature for 15min, and air drying; adding 15-60 μ L DEPC water, dissolving RNA sufficiently, standing on ice for 10min, or storing at-70 deg.C.

(2) Synthesis of cDNA

The experiment was carried out according to the instructions of the cDNA synthesis kit of the company biomoke, the reaction system is shown in Table 7, and the reaction conditions are shown in Table 8.

TABLE 7 reaction System for reverse transcription PCR

TABLE 8 reaction conditions for reverse transcription PCR

(3) Real-time fluorescent quantitative PCR

The experiments were carried out according to the instructions of Toyobo company Realtime PCR Master Mix, and the reaction systems are shown in Table 9.

TABLE 9 reaction conditions for reverse transcription PCR

Reaction conditions are as follows:

1) pre-denaturation at 95 ℃ for 3 min;

2) denaturation at 95 ℃ for 15 seconds, annealing at 60 ℃ for 15s, extension at 72 ℃ for 30s, and 40 cycles;

3) finally, 30 seconds at 60 ℃.

Wherein, the primer sequence is shown in Table 10:

TABLE 10 primer sequences

Analyzing data: with 18S as internal reference and according to 2^-ΔΔCtThe method performs statistical analysis.

4. Results of the experiment

Experimental results show that 12min after a Gfap-IRES-Venus-AkaLuc knock in mouse (KI) and a wild type mouse (WT) are injected with a novel luciferase substrate AkaLumine in vivo, a result graph obtained by performing bioluminescence imaging by using an IVIS living body imaging system of PerkinElmer company is shown in figure 6, and the results show that the KI mouse can detect a background fluorescence signal under the condition that the skull is not damaged, and the WT mouse does not have a fluorescence signal, so that the skull limitation can be broken through when a mouse model constructed by the method is monitored.

Experimental results show that type I interferons Ifn alpha 4 and Ifn beta 1 are abundantly expressed after 5 days of VSV virus injection in Gfap-IRES-Venus-AkaLuc knock in mice, especially Ifn beta 1 (see FIGS. 7A and B, 8A and B), and the successful construction of a Gfap-IRES-Venus-AkaLuc knock in mouse model of VSV intracranial infection is prompted.

Example 4 immunofluorescence detection of activation of glial cells in a mouse model of Gfap-IRES-Venus-AkaLuc knock-in with VSV intracranial infection

1. Experimental methods

Immersing brain tissue into 4% paraformaldehyde, embedding, and freezing and slicing; taking out the frozen slices from the refrigerator, standing at room temperature, and rewarming for 5-10 min; PBS washing 3 times, 5 min/time, to remove the embedded reagent; freezing methanol and fixing at-20 deg.C for 1 h; 0.3 percent TritonX-100/3 percent BSA/(PBS preparation), and blocking for 1-2h at room temperature; the Iba1 antibody (Wako, cat 019-19 19741) was raised against 3% BSA1: diluting with 100 deg.C, incubating at 4 deg.C overnight or incubating at room temperature for 2-5 h; washing with PBS for 3 times and 5 min/time; fluorescent secondary antibody (3% BSA1: 100-; washing with PBS for 3 times and 5 min/time; incubating DAPI at room temperature for 10 min; sealing a sheet; and (5) observing the result under a fluorescence microscope.

2. Results of the experiment

Experimental results showed that under confocal microscopy, uninfected KI mice exhibited a weak background green fluorescence due to the presence of the yellow fluorescent protein Venus, whereas after VSV infection, green fluorescence was significantly enhanced throughout the brain regions of the mice (see fig. 9A and B), suggesting astrocyte activation due to Venus expression consistent with GFAP, on the other hand, uninfected KI mice exhibited no red fluorescence, and more red fluorescence spots after VSV infection, indicating significantly elevated Iba1 expression levels, microglial activation (see fig. 9A and B). These results further demonstrate that intracranial VSV viral infection in KI mice induces neuroinflammation.

Example 5 Gfap-IRES-Venus-AkaLuc knock in mouse model for non-destructive in vivo imaging dynamic monitoring of intracranial viral infection-induced neuroinflammation

1. Experimental methods

Prior to infection, KI mice were injected with the novel luciferase substrate AkaLumine and the raw fluorescence intensity was recorded. After 5 days of intracranial injection of VSV or physiological saline, a novel luciferase substrate AkaLumine is injected into a KI mouse again, and the fluorescence intensity after treatment is recorded. The ratio of the fluorescence intensity before and after the treatment was then calculated.

2. Results of the experiment

The experimental result shows that the fluorescence intensity of the control group does not change obviously before and after treatment, but the fluorescence intensity is increased due to neuroinflammation induced by virus infection (see fig. 10A and B), and the Gfap-IRES-Venus-AkaLuc knockin mouse model can be used for monitoring the neuroinflammation in a nondestructive and dynamic manner.

The above-described embodiments are only for illustrating the present invention and are not to be construed as limiting the present invention. As will be understood by those of ordinary skill in the art: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents.

Sequence listing

<110> military medical research institute of military science institute of people's liberation force of China

<120> construction method of mouse model for breakthrough of skull restriction and nondestructive monitoring of neuroinflammation and application thereof

<141> 2020-10-24

<150> 202011017638.8

<151> 2020-09-24

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tgctggctgt gaggacatac 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aggaagagag ggctctccag 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccctatggag atgacggaga 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cccagtgctg gagaaattgt 20

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ttgacggaag ggcaccacca g 21

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gcaccaccac cacggaatcg 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tcacacagcc aaaaacccct 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ccttgttgaa tacgcttgag 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ccctgaaaat gttcgcagcc 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tggggatgga gaaccttgga 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

agcaccaaag aaggggaagg 20

<210> 12

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aggaagaaga caagctggaa agg 23

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

catctggtcc ccatcttgct c 21

<210> 14

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ggttgtgccg cctttgc 17

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

caatctggtg agcctgtatt 20

Claims (9)

1. A method for constructing a mouse model for non-destructive monitoring of neuroinflammation by breaking through skull restriction is characterized by comprising the following steps:

(1) vector construction: constructing a homologous recombinant vector carrying a yellow fluorescent protein gene Venus and a luciferase reporter gene AkaLuc;

(2) introducing Cas9mRNA, gRNA and the homologous recombination vector constructed in the step (1) into a mouse body, and constructing to obtain a mouse model which breaks through skull restriction and monitors neuroinflammation without damage;

the GFAP gene was added before the tandem Venus and AkaLuc genes by IRES;

the homologous recombination vector comprises a 5 'homologous arm, an IRES-Venus-AkaLuc and a 3' homologous arm;

the gRNA is a gRNA aiming at the 8 th exon of the GFAP gene.

2. The method of construction of claim 1, wherein the method comprises genotyping a mouse.

3. The method of construction of claim 2, wherein the identification comprises a homologous recombination positive mouse PCR identification protocol: the 5' arm homologous recombination positive genome should amplify a 4.2kb fragment, and the negative genome should have no product; 3' arm homologous recombination positive genome should amplify 3.7kb fragment, and negative genome should amplify 7.6kb fragment.

4. The method of claim 1, wherein the gRNA has the sequence set forth in SEQ ID No. 15.

5. The method for constructing the recombinant vector according to claim 1, wherein the step (2) of introducing the Cas9mRNA, the gRNA and the homologous recombination vector constructed in the step (1) into a mouse comprises the following steps:

(a) microinjecting Cas9mRNA, gRNA and the homologous recombination vector constructed in the step (1) into fertilized eggs of mice;

(b) transplanting the fertilized eggs after injection into a pseudopregnant female mouse to obtain an F0 generation mouse;

(c) and hybridizing the F0 mouse and the wild mouse to obtain the stably inherited F1 mouse, namely the mouse model for breaking through skull limitation and monitoring neuroinflammation without damage.

6. The method of constructing according to claim 5, wherein the mouse is a C57BL/6J mouse.

7. Use of the method of constructing a mouse model according to any one of claims 1 to 6 in the field of animal model construction.

8. The use of the mouse model constructed according to the method of any one of claims 1 to 6 for screening a drug for preventing or treating neuroinflammation.

9. A method of screening a candidate drug for preventing or treating neuroinflammation, the method comprising the steps of:

(1) administering a test drug candidate to a mouse model infected with a virus constructed by the construction method of any one of claims 1 to 6;

(2) in vitro non-destructive dynamic monitoring of neuroinflammation induced by intracranial viral infection in a mouse model;

(3) test drug candidates are selected that result in a decrease in fluorescence intensity in mice.

Images