CN109943564A - The gene site-directed hybrid mice model building method for knocking in 2A-Cre of Amh and its application - Google Patents

Abstract

The invention discloses the gene site-directed hybrid mice model building method for knocking in 2A-Cre of Amh and its applications.The available hybrid mice model of the construction method through the invention provides effective experimental animal model for the research of POF pathogenesis and medicament research and development and evaluating drug effect.The present invention provides application of the gene site-directed hybrid mice model for knocking in 2A-Cre of Amh in screening preparation detection/treatment reproductive development disease medicament, detection/treatment disease of ovary drug and gonad granulocyte aging and apoptosis disease medicament.The present invention provides the construction method of the gene site-directed hybrid mice model for knocking in 2A-Cre of Amh for the first time, has no any domestic and foreign literature report before this.With good clinical medicine application prospect, there is very big application value in preparation detection/treatment disease of ovary drug, there is biggish social benefit.

Description

The gene site-directed hybrid mice model building method for knocking in 2A-Cre of Amh and its Using

Technical field

The present invention relates to biotechnologys, and in particular to the gene site-directed hybrid mice model construction for knocking in 2A-Cre of Amh Method and its application.

Background technique

Gonad granulocyte is of great significance to follicular development maturation as sertoli cell.But gonad granulocyte Mechanism of action is still not clear.AMH, i.e., anti-gyneduct hormone, is secreted by gonad granulocyte, is had and is adjusted follicle cell development And the effect of differentiation.Due to currently, constraining ovary hair without gonad granulocyte internal specific Cre transgenosis tool mouse Educate the progress with functional study.Amh gene: anti-mullerian duct hormone (anti-Mullerian hormone, AMH) is conversion life One of the member of long factor beta superfamily, by two identical 70KD subunits, the dimerization glycoprotein being made up of disulfide bond connection, Relative molecular mass is 140KD；Mankind's AMH encoding gene is located at No. 19 the short arm of a chromosome, and 2.4~2.8kb of size contains 5 Exon.2A-Cre: segment name.The present inventor pinpoints 2A-Cre gene using CRISPR/Cas9 technology building 3 ' UTR of AMH Knock in mouse model.Effective reality is provided for reproduction phenogenetics and disease of ovary research and medicament research and development and evaluating drug effect Test animal model.

Summary of the invention

Technical problem to be solved by the present invention lies in above-mentioned shortcoming is overcome, researching and designing Amh is gene site-directed to be struck Enter hybrid mice model and its construction method and the application of 2A-Cre.

Target gene title (No. MGI): Amh (MGI:88006)

Target gene MGI website links: http://www.informatics.jax.org/marker/MGI:88006 mesh Gene Ensembl website links: http://asia.ensembl.org/Mus_musculus/Gene/Summary? g= ENSMUSG00000035262；R=10:80805248-80807648；The transcript that t=ENSMUST00000036016 is directed to (No. Ensembl): Amh-201 (ENSMUST00000036016.5)

Knock in position: at terminator codon

Knock in segment name: 2A-Cre-polyA

The present invention provides the gene site-directed hybrid mice model building method for knocking in 2A-Cre of Amh, this method are as follows: benefit With CRISPR/Cas9 technology, by way of homologous recombination, fixed point knocks in 2A-Cre- at Amh gene end codon PolyA expression cassette.

The gene site-directed hybrid mice model building method for knocking in 2A-Cre of Amh provided by the invention, the mouse is such as Amino acid sequence shown in SEQ ID NO.1

Specifically, the gene site-directed hybrid mice model building method for knocking in 2A-Cre of Amh of the present invention includes following step It is rapid:

(1) by way of in-vitro transcription, Cas9mRNA and gRNA is obtained；

(2) determine that site where the Amh gene on No. 5 and No. 3 chromosomes of mouse is site1 as shown in SEQ ID NO:1；

The design recognition site of gRNA1 is designed as shown in SEQ ID NO:2 and SEQ ID NO:3；

(3) expression vector of building expression gRNA1；Homologous recombination is constructed by the method for In-Fusion cloning to carry Body (donor vector), the carrier include 5 ' homology arm of 4.7kb, 3 ' homology arm of 1.4kb 2A-Cre-polyA and 4.3kb；

(4) by Cas9mRNA, gRNA and vector supplier microinjection into the fertilized eggs of C57BL/6J mouse, F0 generation is obtained Mouse is identified through Long fragment PCR, obtains the F0 of 3 correct homologous recombinations altogether for mouse；

(5) F0 is for mouse and C57BL/6J mouse (the mouse strain of nineteen twenty-one Little Abby Lathrop, female mice No. 57 mate with male mice 52 obtained by C57BL, be " standard " inbred mouse) to obtain 10 positive F1 generations small for mating Mouse.

What the present invention finally obtainedF1 generation mouseFor C57BL/6J-Amh^{em(2A-Cre)2Smoc}。

Correlation english note herein:

MRNA: mRNA, a chain by DNA instruct protein as from template transcription, carrying hereditary information A kind of singlestranded RNA of synthesis.

GRNA: guide RNA, it acts in kinetoplast body in a kind of rear transcription modification for being known as rna editing, it can be with Pre-mRNA pairing, and it is inserted into some uracils (U) wherein, it generates and has effective mRNA.The RNA of guide rna editing points Son, length are about 60~80 nucleotide, are the tails by individual genetic transcription, with 3' oligomerization U, centre has one section With by the sequence of editor's mRNA exact complementarity, the end 5' is an anchor series, it is complementary with unedited mRNA sequence.

In-Fusion cloning: being the In-Fusion patent enzyme of Clontech, this enzyme passes through identification DNA fragmentation and line DNA fragmentation and linearized vector are efficiently accurately fused together by the 15bp homologous sequence of property carrier end.

Donor vector: vector supplier

C57BL/6J mouse: the mouse strain of nineteen twenty-one Little Abby Lathrop, it is female mice 57 small with male C57BL obtained by mouse No. 52 mating is " standard " inbred mouse

F0 is for mouse: Primary mouse

F1 generation mouse: generation mice is bred by F0 for mouse.

Further, the gene site-directed hybrid mice model building method for knocking in 2A-Cre of Amh of the present invention includes following Step:

(1) by way of in-vitro transcription, Cas9mRNA and gRNA is obtained；Fig. 1

(2) determine that site where the Amh gene on No. 5 and No. 3 chromosomes of mouse is site1 as shown in SEQ ID NO:1, Sequence table 2,

The design recognition site of gRNA1 is designed as shown in SEQ ID NO:2 and 3, the former is sequence table 3, and the latter is sequence Table 4；

Knock in site upstream and downstream sequence information

Before 2A-Cre coexpression structure fixed point is inserted into terminator codon.For the 5th exon design primer of Amh RNA。

Exon5 Partial sequence information is following (being written as code area greatly, small to be written as 3 ' downstream sequences):

Site 1 (site 1)

CATCCCGGAGACCTACCAAGCCAACAACTGCCAAGGCGCCTGCGCGTGGCCGCAGTCTGACCGTAATC CGCGCTACGGGAACCACGTGGTGCTGCTGCTAAAAATGCAGGCTCGCGGGGCTGCCCTGGGCCGCCTGCCCTGCTG CGTGCCCACTGCCTACGCGGGCAAGCTGCTCATCAGCCTGTCCGAGGAGCGCATCAGCGCGCACCACGTGCCCAAC ATGGTAGCCACCGAGTGCGGCTGCCGGTGAcgcccgccctcctcctcccctccccccccccccccgcccccagtca gcgccctaataaagatcagcaaacactcagctggggtatctgtgggtggaggaaactcctgtcaacctcccttctg The target sequence of suitable design guide-RNA in the above-mentioned sequence of gaatgcaaggcctgagtccttcccatccagccccta:

SEQ ID NO:2

Guide#1AACATGGTAGCCACCGAGTG CGG

SEQ ID NO:3

Guide#2TCACCGGCAGCCGCACTCGG TGG

Result (Fig. 2, table 2) is transcribed in vitro in Cas9 and gRNA

Table 1

gRNA	Sequence (5 ' -3 ')
		gRNA1	AACATGGTAGCCACCGAGTG GGG
gRNA2	TCACCGGCAGCCGCACTCGG TGG

Fig. 2: Cas9, gRNA electrophoresis result is transcribed in vitro.

Table 2

(3) homologous recombination plasmid construction

Homologous recombination plasmid map (see Fig. 3, table 3)

Fig. 3: homologous recombination vector plasmid map

Table 3

Homologous recombination plasmid enzyme restriction identifies (see Fig. 4)

Fig. 4: electrophoretogram is identified in homologous recombination vector digestion.B:BamHI digestion qualification result, theoretical stripe size are

9.1kb,5.8kb,1.3kb；M:1kb DNA ladder.

Fig. 5: homologous recombination positive mice PCR qualification program:

5 ' arm homologous recombination positive gene groups should amplify 5.5kb segment, and negative genes group is without product；3 ' arm homologous recombinations Positive gene group should amplify 5.3kb segment, and negative genes group should amplify 11.1kb segment.

(4) F0 is identified for murine genes type

Through fertilized eggs microinjection, the present invention obtains 16 F0 for mouse altogether.By way of Long fragment PCR, to F0 generation The genotype of mouse is identified that PCR result confirms through sequencing, which obtains the positive F0 generation of 3 correct homologous recombinations altogether Mouse；

Homologous recombination positive mice PCR qualification program:

5 ' arm homologous recombination positive gene groups should amplify 5.5kb segment, and negative genes group is without product；3 ' arm homologous recombinations Positive gene group should amplify 5.3kb segment, and negative genes group should amplify 11.1kb segment；

Homologous recombination positive F0 is for mouse PCR qualification result:

The F0 of the both arms homologous recombination positive is 6,7, No. 8 for mouse, and Long fragment PCR identifies that electrophoresis result is as shown in Figure 5:

Fig. 5: homologous recombination positive F0 identifies electrophoretogram for mouse PCR.6,7,8 be the positive.

Homology arm recombinates positive F0 for mouse PCR identification method: (table 4)

Table 4

Primer	Sequence 5'-- > 3'	Primer type
			I	CTCCTTTCTCTTTGCAGGGG	Forward
II	GCATCTTCCAGGTGTGTTCA	Reverse

Reaction system:

Reaction component	Volume (μ l)
		ddH2O	13.2
Gxl PCR Buffer	2
		2.5mMdNTP	2
Primer I(10pmol/μl)	0.5
		Primer II(10pmol/μl)	0.5
Gxl DNA Polymerase*	0.8
		Tail genomic DNA	1
Total	20

* PrimeStar GXL (TaKaRa, Code No:R050A)

Reaction condition:

Homology arm recombinates positive F0 for mouse PCR identification method: table 5

Primer	Sequence 5'-- > 3'	Primer type
			III	TGTGTGCTCTGGGAATGACC	Forward
IV	AAGAGTGACAGCCAGAAGCC	Reverse

Reaction system:

Reaction component	Volume (μ l)
		ddH2O	13.2
Gxl PCR Buffer	2
		2.5mMdNTP	2
Primer I(10pmol/μl)	0.5
		Primer II(10pmol/μl)	0.5
Gxl DNA Polymerase*	0.8
		Tail genomic DNA	1
Total amount	20

* PrimeStar GXL (TaKaRa, Code No:R050A)

Reaction condition:

(5) acquisition of F1 generation mouse and genotype identification

F0 mates for positive mice with wild type C57BL/6J mouse, and breeding obtains F1 generation mouse.It identifies and is sequenced through PCR Confirmation obtains positive F1 generation mouse 3, number are as follows: 2,3, No. 4 altogether；

5 ' and 3 ' homology arm PCR of F1 generation mouse identification

PCR identifies that strategy and method identify part for mouse with F0, and 5 ' and 3 ' homology arm PCR of F1 generation mouse identifies electrophoresis knot Fruit is as shown in Figure 6.PCR identifies positive mice are as follows: No. 2,3,4,10,11,13,14,15,16,22；It is sun through sequencing confirmation Property；

Fig. 6: 5 ' homology arm of F1 generation mouse (5 ' arm) and 3 ' homology arms (3 ' arm) PCR identify electrophoretogram.

(number: F1 generation mouse number；WT: wild type control；M:1kb DNA ladder)

Upper figure: 5arm identifies electrophoretogram

The following figure；3arm identifies electrophoretogram

F1 generation mouse PCR identification sequencing comparison result

F1 generation positive mice PCR identifies product sequencing, has carried out 4 sequencing reactions altogether.The corresponding region of sequencing reaction, In, 5 ' homology arms identification, PCR product sequencing has carried out 2 sequencing reactions altogether, is respectively labeled as: 1,2；The identification of 3 ' homology arms, PCR product sequencing has carried out 2 sequencing reactions altogether, is respectively labeled as: 3,4.

1# sequencing reaction comparison result is shown in Fig. 9:

2# sequencing reaction comparison result is shown in Figure 10；

3# sequencing reaction comparison result is shown in Figure 11；

4# sequencing reaction comparison result, is shown in Figure 12；

Query is purpose sequence (Amh KI recombinated genomic DNA sequence), and Subject is to survey Sequence result.

F1 generation positive mice number and essential information

F1 generation positive mice number and essential information are shown in Table 6.

Table 6:F1 is for positive mice essential information

The mouse that the present invention finally obtains is C57BL/6J-Amh^{em(2A-Cre)2Smoc}

(3) PCR is identified

Table 7

It is a further object of the present invention to provide the gene site-directed heterozygote for knocking in 2A-Cre of construction method Amh of the present invention is small Application of the mouse model in screening preparation detection/treatment reproductive development disease medicament.

Provide mouse model the answering in screening preparation detection/treatment disease of ovary drug that the construction method obtains With.

It provides the mouse model that the construction method obtains and prepares the aging of detection/treatment gonad granulocyte in screening With the application in apoptosis disease medicament.

The present invention provides small using CRISPR/Cas9 technology building 3 ' UTR of AMH fixed point 2A-Cre gene knock-in for the first time Mouse model has no any domestic and foreign literature report.The mouse model of the method for the present invention building is reproduction phenogenetics and preparation Detection/treatment disease of ovary drug and related drugs screening provide effective experimental animal model, and there is good medicine to face Bed application prospect has very big application value in preparation detection/treatment disease of ovary drug, there is biggish social benefit.

Detailed description of the invention

Fig. 1: by way of in-vitro transcription, Cas9mRNA and gRNA is obtained；Pass through the method for In-Fusion cloning Construct homologous recombination vector (donor vector), the carrier include 5 ' homology arm of 4.7kb, 1.4kb 2A-Cre-polyA and 3 ' homology arm of 4.3kb

Fig. 2: Cas9, gRNA electrophoresis result is transcribed in vitro

Fig. 3: homologous recombination vector plasmid map

Fig. 4: electrophoretogram B:BamHI digestion qualification result is identified in homologous recombination vector digestion, and theoretical stripe size is 9.1kb,5.8kb,1.3kb；M:1kb DNA ladder.

Fig. 5: homologous recombination positive F0 identifies that electrophoretogram 6,7,8 is positive, M:1kb DNA marker Fig. 6 for mouse PCR: 5 ' homology arm of F1 generation mouse (5 ' arm) and 3 ' homology arms (3 ' arm) PCR identification electrophoretogram (number: F1 generation mouse number；WT: wild Raw type control；M:1kb DNA ladder)

Fig. 7: F1 generation mouse PCR product sequence verification schematic diagram

Fig. 8: gene knock-in mouse process is established using CRISPR/Cas9 technology

Fig. 9: 1# sequencing reaction comparison result:

Figure 10: 2# sequencing reaction comparison result:

Figure 11: 3# sequencing reaction comparison result:

Figure 12: 4# sequencing reaction comparison result.

Specific embodiment

The raw materials and reagents that embodiment uses unless otherwise stated, by being commercially available.

Embodiment 1

One, experimental animal

The C57BL/6 type mouse (weight is in 18 ± 2g) of 5 week old health, male and female each 100, by Shanghai south model organism Science and Technology Co., Ltd. provides, and can reach 6 week old of requirement of experiment after a week through isolated rearing；6~8 week old health ICR mouse 60, half male and half female, weight is purchased from Shanghai south model organism Science and Technology Co., Ltd. in 24 ± 2g, and mouse is equal It is fed under SPF grades of environment, in strict accordance with animal house administrative provisions, guarantees daily temperature at 22 DEG C, humidity 40%~60% is moved Light application time and interlunation are fifty-fifty in object room, and all relevant operation processing of zoopery follow strictly animal center related management Regulations.

Two, experiment reagent

Cas9Nuclease (U.S. NEB)；Premix TaqTM PCR enzyme (TAKARA Japan)；DNA purification and recovery reagent Box (Tianjin TIANGEN China)；Injection Cas9mRNA (the biology China difficult to understand of Beijing hundred)；Short interfering RNA purification kit (U.S. Invitrogen)；Pregnant mare serum (PMSG), human chorionic gonadotrophin (hCG) (China, Ningbo the second hormone factory)； KSOM culture solution (U.S. Millipore)；Hyaluronidase, M2, KSOM culture medium (U.S. Sigma)；Mouse gene group DNA mentions Take kit (the good really China in Chengdu)；Chloraldurate (the good source China in Zhejiang).

Three, experimental method

1.Cas9mRNA, gRNA and donor vector preparation

By way of in-vitro transcription, Cas9mRNA and gRNA is obtained；It is constructed by the method for In-Fusion cloning Homologous recombination vector (donor vector), the carrier include 5 ' homology arm of 4.7kb, 1.4kb2A-Cre-polyA and 4.3kb 3 ' homology arms；As shown in Figure 1.

2.C57BL/6 donor female mice fertilized eggs prepare

(1) PMSG 5IU is injected intraperitoneally to donor female mice between 17:00~18:30 in afternoon.

After (2) 48 hours, hCG (10IU/mL) 0.5mL is injected intraperitoneally to every female mice, by after injection female mice and male mouse It is mated, morning next day, 10:00 chose bolt.

(3) it takes off neck execution donor and sees bolt female mice, take its fallopian tubal, be put into the culture dish for the M2 culture drop got ready in advance In.

(4) ampulla is torn with syringe needle under stereomicroscope, it is multiple collects the fertilized eggs-cumulus cell released It is fit.

(5) cell being collected into is transferred in hyaluronidase drop with mouth suction pipe, after 37 DEG C of 3~5min of digestion, is put Enter in the KSOM drop balanced, 37 DEG C of incubations are incubated overnight, and guarantee the CO2 environment in incubator for 5%.

3. microinjection Cas9mRNA, gRNA, donor vector mixture

By mixed in equal amounts after the gRNA purified after synthesis, Cas9mRNA, donor vector dilution, it is mixed to draw a small amount of RNA It closes object to be added in injection needle, syringe needle is packed on microinjection arm, takes the fertilized egg cell being incubated overnight in M2 culture medium It washes to be placed on three times on microinjection platform and carries out microinjection.Successful fertilized egg cell will be injected, new KSOM training is put into 0.5h is cultivated in nutrient solution.

4. embryo transfer

(1) the heat ICR female mice for taking 6 week old, mates with the male mouse of ligation, chooses after next day fertilized egg cell's microinjection Bolt carries out embryo transfer afternoon.

(2) ovum shifting tube is installed, the embryo after injecting in incubator is taken out, stand-by after three times are washed in M2 culture solution, sucking one Quantitative M2 culture medium sucks air, then sucks the embryo for wanting Hui Zhi, then after sucking one section of air, sucks M2 culture medium, avoid rainbow Suction effect controls the liquid outflow of ovum shifting tube.

(3) the ICR mouse for seeing bolt is selected, carries out intraperitoneal administration anesthesia by every kg body weight 5mg dosage after weighing.

(4) after female rat is lost consciousness, abdomen defeathering is carried on the back in Baoding of being lain on one's side, and alcohol disinfecting is placed on paper handkerchief.Body formula Under microscope under last root rib cage of mouse one 1cm of incision of skin or so small wound.

(5) ovary and fallopian tubal position are found according to the anatomical physiology position of mouse, cuts off stomach wall, with elastic fatty tweezer Adipose tissue is held, finds ampulla of uterine tube under stereomicroscope.

(6) ampulla of uterine tube is gently punctured with syringe needle, ovum shifting tube tip is pierced into ampulla, embryo is blown into Tissue is backfilled after transplanting, is sewed up a wound by ampulla of uterine tube, same operation transplanting opposite side ampulla of uterine tube.

(7) female rat is placed on warm stage after it revives naturally, puts back to the letter such as mouse cage and record date, shifting ovum number Breath.It is identified after its production.

The genotype identification of 5.F0 generation positive mouse

(1) it is individually raised after ICR receptor female mice embryo Hui Zhi, the sufficient gestation of water material after three weeks, observes farrowing situation And make a record work.

(2) it after farrowing, is organized in every 0.5~1cm of mouse tail clip, the BufferTL1 solution of 400 μ L is added.

(3) the proteinase Protease Plus of 40 μ L is added into mixed liquor again, 65 DEG C of water-baths are more than half an hour, Pay attention to mixing every 5 minutes primary.

(4) in managing after only surplus hair, bone 400 μ L Buffer TL2 solution are added, to be layered in pipe in digestion Phenomenon is mixed by inversion.

(5) water-bath is adjusted to 65 DEG C, and water-bath 10min, 13400 × g are centrifuged 8min.

(6) supernatant is drawn to centrifugal column, and 13400 × g abandons liquid after being centrifuged 2min, avoids lower sediment sucking centrifugation as far as possible In column.Liquid is abandoned after adding 500 μ L Buffer PW, 13400 × g centrifugation 1min.

(7) centrifugal column is washed with 700 μ L Buffer WB, abandons liquid after 13400 × g centrifugation 1min.

(8) it is washed again one time with 700 μ L Buffer WB.13400 × g sky is from 1min.

(9) it abandons underlying collection pipe and changes new 1.5mL EP pipe into, with 100 μ L Buffer EB, 13400 × g centrifugations DNA is collected in 1min elution.

(10) recovered liquid is rejoined on pellosil, 13400 × g centrifugation 1min is eluted again.

(11) the genomic DNA concentration and OD260/280 value of microplate reader Detection and Extraction are used.

(12) it using the mouse tissue DNA of extraction as template, carries out PCR amplification and send sequencing.

6. obtaining F1 generation mouse

F0 is chosen to mate to obtain F1 generation mouse with wild type C57BL/6J mouse for positive mice.The identification of F1 generation murine genes Method is identical for mouse as F0.

Four, experimental result

1. obtaining mouse situation

F0 obtains 16 for mouse, wherein 3 positive findings, F1 generation mouse obtains positive findings 10.

2. the genotype identification result of gene knock-in mouse

5 ' arm homologous recombination positive gene groups should amplify 5.5kb segment, and negative genes group is without product；3 ' arm homologous recombinations Positive gene group should amplify 5.3kb segment, and negative genes group should amplify 11.1kb segment.The F0 of the both arms homologous recombination positive It is 6,7, No. 8 for mouse, Long fragment PCR identifies that electrophoresis result is as shown in Figure 5.

Sequence table

<110>Shanghai Geriatric Institute of Chinese Medicine

<120>the gene site-directed hybrid mice model building method for knocking in 2A-Cre of Amh and its application

<130> /

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8400

<212> DNA

<213> Mus musculus

<400> 1

taggacacac agccgacttc tctgtcctca aagcatcttt cccttagtgt tgccaagagc 60

ccccaggtgc tgataagtac catccctact ggcaatctcc agaagcagga gggggaggct 120

ggctgttgca gtcactgccc ctggagcccc tctgcagagg cccctgggtg acgtggccta 180

gccagaagac caatcacatg gccagcagga gcccagggac ccaagttgcc aagagtcccc 240

tttggcaggc agggtccgtc ctggggaggc tgtgacacag cacctccctc ctcatactct 300

tcttggactt caacagctgc ccctgcatag agtgctgggt tgggttgccc tccctcactt 360

taggtcctag ccagtggcct taggcagaga agccaggcct tgtgttgagg aaccctgttc 420

tgttgtgcac acacagcaca taacagcccc atcccttctg ttgcagtgac caagcagagg 480

gacacagaga tgggccagca gagcctgctg ttccaggtga ggtgggacca gtcaggggtg 540

gaccagacac acgggtggtg atgccaatag tgctgtgcat gttttacaga ttgactaccc 600

tgagatcgca gagggtatca tgccacgcca ccgtttcatg tctgcttatg agcagaggat 660

cgagcctcca gaccgccgct ggcagtacct gctcatggct gctgagccct atgagaccat 720

tgctttcaag gtagcgaccc tacaggacag agagagcagc taaattcagc tgtctgtgta 780

tcctagcccc tccttggggt gctgcagcct ctgactttct ccctaggtgc caagccggga 840

gattgacaag gctgagggca agttttggac ccactggaac agagaaacca agcaggtgag 900

gttccacagg ccttgcgtgg gtactctctc agcgctcctc agtggccctg ccccagtcac 960

tgaccctctc tcctacagtt ttttcttcag ttccacttta agatggagaa gcccccagca 1020

cctcccagcc tcccagcagg acccccaggc gtcaagcggc ccccgccccc actcatgaat 1080

ggactgcctc ctcgcccacc actccctgat gccttgcccc cacctccacc tggtggcctg 1140

cctctccctc ctatgccccc cactgggcct gctccctctg ggccccctgg acctccccag 1200

atgcccccac cagctcctgg ggtgcacccc ccggccccag tagtacaccc accaacatct 1260

ggagtccatc ccccagctcc tggggtacac cccccagcac cagtggtcca tccaccaaca 1320

tctggggtcc atcccccagc ccctggagtg cacccaccca cccctggagt gcacccacca 1380

gccccaggag tgcacccacc agctccaggt gtccacccac cagctccagg ggtacacccc 1440

ccaactccag gggtgcaccc accagctcca ggggtgcacc caccagctcc aggggtgcac 1500

ccaccagctc caggggtaca ccctcctcca tcagctggag ttcatcctca ggctccaggg 1560

gtacacccac ctgctcctgc agtacaccct caagcccctg gggtacaccc cccagcccct 1620

gggatccacc ctcaggcacc aggggttcac cctcagccgc ctcctggagt ccaccctgct 1680

gccccggggg tccaccctca gcctccaggg gttcacccct caaatcctgg ggtgcaccct 1740

gctcctatgc cccccatgct gaggccccca ctcccctcag atggccctgg gaacatgcct 1800

ccccctcccc caggcaactg agcagtcccc ccaccagcct ctgttgtctg tgtggtcttt 1860

tcccattgcc agtccttgga aggttttcta tttgtcctgc cttgagccta ttaaacagcc 1920

tcccccgtgt ctccctgtct gctgtgtgtt tggtagtggg gagggtggat actgcttgtc 1980

tctgttgaag ctgtggtgac ctggggcgtc ctccaggtgg gctccccagg gagatgggag 2040

ctactcaagg acagctcagg cctctgcagt tatgggccca gctctgagga cagaaagccc 2100

tttgagacag tcgcctccca cctgctgggc atgaaaagtg ccaggcactg tcccccaagg 2160

tcacctttgg tgttgatagg ggcgtccctc ccaagcaagc aatctggctc agccatacat 2220

ataagcaggg ccacccggac cttgctgtac caccgtacgt gatggactct gtctcagcgc 2280

ccatgatgcc ttgggactga gtgagttagg gcagaagctg ggggaggggg gtttggggga 2340

gggggcctcg ctggattgct aggcagaacc ttatacaccc tttcaggaac tgtagtgggc 2400

aagatggcag gacacacccc aatgatcaca ccttccagac agatgacagc agagctgctg 2460

tgtccttaca agcaaggtct ccacaccttg gatcagggtc cctcaggcct acatggcccc 2520

agaagatctc cagtgaagag tccagctgag ggaatttctg taggacagat cttgagggac 2580

tgaagctaat ggcctcagag actcagtcaa ccaatatttg cccacaggta ccagagactg 2640

gcatgggccc atcccctaac agccttctgg ttgaggttgt gccaaatgga agggttggtg 2700

gggttaggag tacacctggg aggctattcc cagtatggca ggggtggtgc ctgtagcctg 2760

accatcttcc ccagtcctgc tgacaagagt ccctgtgtcc acaggtaggt cctggcagag 2820

gggaggggac agagtggaag gaagctgccc ttaaccccag ccctcagcca gcacgtgccc 2880

accctctaca ggtgcgcaca gggatggagg aggaactggg acgttggagg gggtagttgg 2940

tccaccatag cctcttgtgc tcacagctgg cccacttcgt tctattccag aggaagcgga 3000

gctactaact tcagcctgct gaagcaggct ggagacgtgg aggagaaccc tggacctatg 3060

gtgcccaaga agaagaggaa agtctccaac ctgctgactg tgcaccaaaa cctgcctgcc 3120

ctccctgtgg atgccacctc tgatgaagtc aggaagaacc tgatggacat gttcagggac 3180

aggcaggcct tctctgaaca cacctggaag atgctcctgt ctgtgtgcag atcctgggct 3240

gcctggtgca agctgaacaa caggaaatgg ttccctgctg aacctgagga tgtgagggac 3300

tacctcctgt acctgcaagc cagaggcctg gctgtgaaga ccatccaaca gcacctgggc 3360

cagctcaaca tgctgcacag gagatctggc ctgcctcgcc cttctgactc caatgctgtg 3420

tccctggtga tgaggagaat cagaaaggag aatgtggatg ctggggagag agccaagcag 3480

gccctggcct ttgaacgcac tgactttgac caagtcagat ccctgatgga gaactctgac 3540

agatgccagg acatcaggaa cctggccttc ctgggcattg cctacaacac cctgctgcgc 3600

attgccgaaa ttgccagaat cagagtgaag gacatctccc gcaccgatgg tgggagaatg 3660

ctgatccaca ttggcaggac caagaccctg gtgtccacag ctggtgtgga gaaggccctg 3720

tccctggggg ttaccaagct ggtggagaga tggatctctg tgtctggtgt ggctgatgac 3780

cccaacaact acctgttctg ccgggtcaga aagaatggtg tggctgcccc ttctgccacc 3840

tcccaactgt ccacccgggc cctggaaggg atctttgagg ccacccaccg cctgatctat 3900

ggtgccaagg atgactctgg gcagagatac ctggcctggt ctggccactc tgccagagtg 3960

ggtgctgcca gggacatggc cagggctggt gtgtccatcc ctgaaatcat gcaggctggt 4020

ggctggacca atgtgaacat agtgatgaac tacatcagaa acctggactc tgagactggg 4080

gccatggtga ggctgctcga ggatggggac gtcagcgccc taataaagat cagcaaacac 4140

tcagctgggg tatctgtggg tggaggaaac tcctgtcaac ctcccttctg gaatgcaagg 4200

cctgagtcct tcccatccag cccctaactc ccgtgtgtcc ctctcacttt tctgatttca 4260

aaacaggatc tgtgtagccc tggtggtcct ggaactctaa ctcactcact ctcaccctct 4320

ctctcctctc tctgctctct cttctctctc tcttctctcc tctctcgacc agcttgcctc 4380

tgtctcccca gtgctaggat taaactcctg gaccctgtca ctttttaatt agttaattaa 4440

tttgttatgt gtggcgggga gagataggtg tctggccgga aggaagttaa agcaggagaa 4500

atgcttcaag tcagcctgaa attaaagagc aaaactgttt caaaaacagg ggagctggag 4560

aaatggctca gccccaaagg acacttgcac accccaacat acacgcgccc agatctttaa 4620

aagcaaaaca aacagccaag tatagcggtg cacacctgtc accccagcac tctggaggtg 4680

gacccaagag gatcaggact taaagccagg cttggttgca caggcttacg caggcgcata 4740

gggtacagat ggattgcaga aggcagaact aagtggagtt cattccgtgt gggtcgcgag 4800

atcgaactca ggcggtcagg cttggcagca agcgccttta cccatttcac tatctcaccg 4860

gccctatccc catctctgcg acccttaggg tccaggcaca aaggagtaga tgatcttgct 4920

gtcacaacac ggcctttatt tgctggtgct acagggagaa gggacacagg attcgcccag 4980

gggacacagg atcagtcacg ccccttccct cgcttctgtc tgggccggtc atcacggtca 5040

tgccttcgcc ggggagccca ggcctgcagc ttcccatgct cgaggaggtc cctggagtcc 5100

cgtccccatg gccgacggcc tccttcccgc gcctcccagc gccgtggcag tgattgacgg 5160

ggctccccag tgacctgtga cttatcctct ctcctcggct tctcccttct cggcttctcc 5220

ttcttcagtt tctccccttt acttggcttc tctttccgtg gcttctcctg ggaccctcgg 5280

tccccaaggg gtacgctctc ctccccagag gcttccgaga tggaccctcc acgttctacc 5340

cgggtttctg tagcttcagg gctcccggga agctcaggct catcctgcat ccgtgcctgg 5400

ggtggcccag gcttcggctg aggagacccg gatggagaca ccaaaaccgg aggcttaggc 5460

tgccaagaga caaagtgggg acttgggatc cgcgtgctca ggcctggtct ccttctccct 5520

tggtgagcag ccccatcagg tgaaatctct ggaaggaagg cttaccgctg gcgacgcttc 5580

cttctttggt ggagagctgg gcgggaccca tgggtgaggg gcagccacga cctccccagc 5640

cactgcgtct gaaaggcagg cagtctgaag tggaggaatg agcacagcca cccacctctt 5700

ctttgccctc acccccagaa ctccactggg ataccccaac ctcctcctag agacctctct 5760

tttttctctt tggagtggcc attccccgcc cccagctgca cgagggttgc tagcaataat 5820

aatcgtgggg gcgatcctct gctccaggat gaagtggaga acccttctcg gatggagtgg 5880

gaggacccgg ctcagtcgtg tatgtctgtc atcctggctg gaggaatgct gaggcacaag 5940

gattgccatg agacccaggc tagcttgtgc ctttgtaaag ggagcccttg attcaaaaca 6000

aaagccaggg cccaaggtat actcctgcca ttcctagatc ttgggaggtc aaagtaggga 6060

gggtcaggag accagcctaa gctacataga gaggttgagg tcttgagagt tttgtctttt 6120

ttctttcttt tttttttctt ttcttttttt ctttttcttt ttcttttctt ttcttttttt 6180

tttttttaag gtctggatgg tggtggcaca ctttccagca ttcaggaggg agagacaggc 6240

agagctctct aagtttgtgg ccagcctgga atatatattg gattccagcc agctagggct 6300

acatagtgag actctgtctc aaaatgaatg aatgaatgaa tgaatgaatg aatgaatgaa 6360

tgaaaagctc agaacatctg gaactaggcc tggttgtgaa acttaaggta gacaccataa 6420

aactaggagc taggtgtgac cgtgggcctc tcaggctggc ggactggcta ttccaggaat 6480

aggggcagag acgcttgagg ataaggtttg taggaacaga agagtcgcag cctgggcaag 6540

gctacaggga atgcccccaa cccctgtgga gaccctgtct tgtggagctc accccgacac 6600

agctgaagag ccgagcccag cagggccacc agcgaggcca gtaccaggca cttgttgagc 6660

gtcagatctc cccagggcag gtcatcgctt ggcgtccttg ggggcggctg caggggaggc 6720

gggggcggct gcaggggagg cggagcctgc ggcttcctac gtgcaggaac gatccggggg 6780

cctgaaggac aagcatggat ccgcctgtcg cctatggttc ctactccgtc ccagtgtgca 6840

gaccatcccc acctgctcac cctcccccga gcagacccac ttgttcccgc tttgccagct 6900

gtgctctcct tgcccgctag ctctttttcc atcttcttga gcccggcatc cccagcgcca 6960

gcagcaactg ggtcctgaag gacctgtagg gcatcggaga cagttccacg aggagtgtca 7020

gtccagaagt cctgtgggct gccatctcct tacaagtgag ttgtacagac tctgttatcc 7080

caaccctcag gaggatgagt caggaggatt gcttggagtt ggttgccagc ctgagtttca 7140

aagggagact ctgtctctaa aaatcaaaac ggaggagccc agccaagcag ctcagtgggt 7200

gactgcgctg cctacaaatc tgatagcttg agttggacac ccccacccct gacccacctt 7260

gtggaaggag aaaacagagt ctagggattt ggcatctgat ccctggctgt gcatgtgttc 7320

acacacacag acatcattat acatacacat acatacatac atacatacat acatacatac 7380

atacatacat acaaatgtgc atatatatgt atatacatat atactatact ggctggtttt 7440

gtctgtcaac ttgacacaag gtggagttat cacagagaaa ggagcctccc ttgaggaaat 7500

gcctctgaga gatccagctg taaggcattt tctcagttag taatcaagag gggagggccc 7560

actgtgggtg gtgccatccc tgggctatag tcttgagttc tataagaaag cgagctgagc 7620

aagccagggg aagcaaacca gtaagtaaca tccttccatg gcctctgcat cagctcctgc 7680

tttctgacct gcttgagttc cagtcctgac ttcctttgtg gaatgtggaa gtataagctg 7740

aataaatcct ttcctcccta acttgcttct tggtcatgat gtttgtgcag gaatagaaac 7800

cttgactaag acaacctcac acacacacat acatatatgt gtgaatacac agaagctgga 7860

gagacagcta agtagttaca gaaccagctg ctcctgcaga ggactcaggt tcgattccca 7920

gcacccacat gggactccag ctcctggtca gatgtctgca tctgacctct tcaggcatga 7980

ggaacacatg tgtgcaggcg aaactcataa aataaaaata aaatagaagt aagcattcat 8040

agacatcaac taaaaatgag ggaaagaagc cgggcggggt ggcacacgct tttaatccca 8100

gcactcagaa ggcagaggca ggcggatttc tgagttcgag gccagcctgg tctacaaagt 8160

gagttctggg acagccagag ttacacagag aaaccctgtc tcgaaaaaca aaaaaacaaa 8220

aatgagggaa agatttgtaa ggcctgtggg gctatagctc acccagcatg caggaagcca 8280

ggactctgtc cccagcatca cgtaagccag gtgtggggtc aggagggaaa ggcaggaggc 8340

tcagagttca ggatcatcct tgaggtttga atttgaggac agcctgggct atatgagacc 8400

<210> 2

<211> 408

<212> DNA

<213> Mus musculus

<400> 2

catcccggag acctaccaag ccaacaactg ccaaggcgcc tgcgcgtggc cgcagtctga 60

ccgtaatccg cgctacggga accacgtggt gctgctgcta aaaatgcagg ctcgcggggc 120

tgccctgggc cgcctgccct gctgcgtgcc cactgcctac gcgggcaagc tgctcatcag 180

cctgtccgag gagcgcatca gcgcgcacca cgtgcccaac atggtagcca ccgagtgcgg 240

ctgccggtga cgcccgccct cctcctcccc tccccccccc cccccgcccc cagtcagcgc 300

cctaataaag atcagcaaac actcagctgg ggtatctgtg ggtggaggaa actcctgtca 360

acctcccttc tggaatgcaa ggcctgagtc cttcccatcc agccccta 408

<210> 3

<211> 23

<212> DNA

<213> Mus musculus

<400> 3

aacatggtag ccaccgagtg ggg 23

<210> 4

<211> 23

<212> DNA

<213> Mus musculus

<400> 4

tcaccggcag ccgcactcgg tgg 23

Claims (10)

1. The gene site-directed hybrid mice model building method for knocking in 2A-Cre of 1.Amh, which is characterized in that the construction method Are as follows: the gene site-directed hybrid mice model for knocking in 2A-Cre of Amh is constructed using CRISPR/Cas9 technology.
2. 2. the gene site-directed hybrid mice model building method for knocking in 2A-Cre of Amh according to claim 1, feature It is, the murine genes for constructing obtained model are C57BL/6J-Amh^{em(2A-Cre)2Smoc}, as shown in SEQ ID NO.1 Amino acid sequence.
3. 3. the gene site-directed hybrid mice model building method for knocking in 2A-Cre of Amh, feature exist according to claim 1 In this method includes the following steps:

   (1) by way of in-vitro transcription, Cas9 mRNA and gRNA are obtained；

   (2) determine that site where the Amh gene on No. 5 and No. 3 chromosomes of mouse is site1 as shown in SEQ ID NO:1；

   The design recognition site of gRNA1 is designed as shown in SEQ ID NO:2 and SEQ ID NO:3；

   (3) expression vector of building expression gRNA1；Homologous recombination vector is constructed by the method for In-Fusion cloning (donor vector), the carrier include 4.7kb5 ' homology arm, 1.4kb2A-Cre-polyA and 4.3kb3 ' homology arm；

   (4) by the fertilized eggs of Cas9 mRNA, gRNA and vector supplier (donor vector) microinjection to C57BL/6J mouse In, F0 is obtained for mouse, is identified through Long fragment PCR, obtains the F0 of 3 correct homologous recombinations altogether for mouse；

   (5) F0 for mouse and C57BL/6J mouse (the mouse strain of nineteen twenty-one Little Abby Lathrop, female mice 57 C57BL obtained by mating with male mice 52 is " standard " inbred mouse) the positive F1 generation mouse of mating acquisition 10.
4. 4. the gene site-directed hybrid mice model building method for knocking in 2A-Cre of Amh, feature exist according to claim 1 In obtained F1 generation mouse is C57BL/6J-Amh^{em(2A-Cre)2Smoc}。
5. 5. the gene site-directed hybrid mice model building method for knocking in 2A-Cre of Amh, feature exist according to claim 1 In result is transcribed in vitro in step (1) Cas9 and gRNA are as follows:

   GRNA sequence (5 ' -3 ')

   gRNA1 AACATGGTAGCCACCGAGTG GGG

   gRNA2 TCACCGGCAGCCGCACTCGG TGG；

   Cas9, gRNA electrophoresis result is transcribed in vitro are as follows:

   The homologous recombination plasmid map that step (3) the homologous recombination plasmid construction obtains:

   Electrophoretogram is identified in homologous recombination vector digestion.B:BamHI digestion qualification result, theoretical stripe size be 9.1kb, 5.8kb, 1.3kb；M:1kb DNA ladder；

   Electrophoretogram is identified in homologous recombination vector digestion.B:BamHI digestion qualification result, theoretical stripe size be 9.1kb, 5.8kb, 1.3kb；M:1kb DNA ladder；

   Homologous recombination positive mice PCR qualification program:

   5 ' arm homologous recombination positive gene groups should amplify 5.5kb segment, and negative genes group is without product；3 ' arm homologous recombinations are positive Genome should amplify 5.3kb segment, and negative genes group should amplify 11.1kb segment.
6. 6. the gene site-directed hybrid mice model building method for knocking in 2A-Cre of Amh, feature exist according to claim 1 In step (4) F0 includes the following steps: for the identification of murine genes type

   Through fertilized eggs microinjection, the present invention obtains 16 F0 for mouse altogether.By way of Long fragment PCR, to F0 for mouse Genotype identified that PCR result confirms that the project obtains the positive F0 of 3 correct homologous recombinations for mouse altogether through sequencing；

   Homologous recombination positive mice PCR qualification program: 5 ' arm homologous recombination positive gene groups should amplify 5.5kb segment, negative Genome is without product；3 ' arm homologous recombination positive gene groups should amplify 5.3kb segment, and negative genes group should amplify 11.1kb Segment；

   Homology arm recombinates positive F0 for mouse PCR identification method:

   Primer sequence 5'-- > 3' Primer type

   I CTCCTTTCTCTTTGCAGGGG Forward

   II GCATCTTCCAGGTGTGTTCA Reverse；

   Reaction system:

   * PrimeStar GXL (TaKaRa, Code No:R050A)；

   Reaction condition:

   Homology arm recombinates positive F0 for mouse PCR identification method:

   Primer sequence 5'-- > 3' Primer type

   III TGTGTGCTCTGGGAATGACC Forward

   IV AAGAGTGACAGCCAGAAGCC Reverse；

   Reaction system:

   * PrimeStar GXL (TaKaRa, Code No:R050A)；

   Reaction condition:

   Homologous recombination positive F0 is for mouse PCR qualification result: 6,7,8 be the positive.
7. 7. the gene site-directed hybrid mice model building method for knocking in 2A-Cre of Amh, feature exist according to claim 1 In step (5) the F1 generation mouse obtains and genotype identification includes the following steps:

   F0 mates for positive mice with wild type C57BL/6J mouse, and breeding obtains F1 generation mouse.It identifies and is sequenced through PCR and is true Recognize, obtains positive F1 generation mouse 3, number are as follows: 2,3, No. 4 altogether；

   5 ' and 3 ' homology arm PCR of F1 generation mouse identification

   PCR identification method identifies part for mouse with F0,5 ' and 3 ' homology arm PCR of F1 generation mouse identification electrophoresis result: 2,3,4, No. 10,11,13,14,15,16,22 mouse are the positive；

   F1 generation mouse PCR identification sequencing comparison result: No. 2,3,4,10,11,13,14,15,16,22 mouse are the positive.
8. 8. the gene site-directed hybrid mice model building method for knocking in 2A-Cre of Amh, feature exist according to claim 1 In application of the mouse model that the construction method obtains in screening preparation detection/treatment reproductive development disease medicament.
9. 9. the construction method of the gene site-directed hybrid mice model for knocking in 2A-Cre of Amh according to claim 1, feature It is, application of the mouse model that the construction method obtains in screening preparation detection/treatment disease of ovary drug.
10. 10. the construction method of the gene site-directed hybrid mice model for knocking in 2A-Cre of Amh according to claim 1, special Sign is that the mouse model that the construction method obtains is in screening preparation detection/treatment gonad granulocyte aging and apoptosis Application in disease medicament.