CN111979265A - Construction method of spontaneous squamous cell lung carcinoma mouse model - Google Patents

Abstract

The invention provides a construction method of a spontaneous squamous cell lung carcinoma mouse model, and relates to the technical field of mouse model construction; the invention constructs a mouse with conditional Yap1 knock-in (Yap 1) by designing a targeting vector for the conditional Yap1 knock-in^KI) Because of the cancer promotion effect of Yap1, the spontaneous lung squamous cell carcinoma has the characteristic of rapid tumor formation, then a negative selection marker (DTA) and a positive selection marker (Neo) are introduced into a targeting vector according to the standard design of a transgenic mouse, so that positive clones can be conveniently and rapidly obtained, and finally the Trp53 gene is utilized to knock out the mouse and the Yap1^KIThe mice are hybridized to obtain the Yap1^KI/Trp53^KOAnd (5) finishing the construction of the spontaneous squamous cell lung carcinoma mouse model.

Description

Construction method of spontaneous squamous cell lung carcinoma mouse model

Technical Field

The invention belongs to the technical field of mouse model construction, and particularly relates to a construction method of a spontaneous squamous cell lung carcinoma mouse model.

Background

Lung cancer is the first malignant tumor in human at present, and the morbidity and mortality of lung cancer are the first. Non-small cell lung cancer (NSCLC) accounts for 85% of all lung cancer patients; in NSCLC, 60-80% of lung adenocarcinoma and 20-40% of lung squamous cell carcinoma are present, and the animal model is essential for the treatment and mechanism research of lung cancer, especially lung squamous cell carcinoma. However, the existing lung squamous carcinoma mouse model has a plurality of obvious defects, mainly: (1) spontaneous tumor formation is extremely slow, often requiring months or even 1 year, and is very unfavorable for experimental research; (2) the pathological type in the spontaneous tumor tissue is not pure, and a plurality of pathological subtypes exist in the same tumor tissue; (3) since the knockout of the oncogene does not have the specificity of the development of squamous cell lung carcinoma, etc., the research of animal models into which oncogenes are introduced is lacking. Therefore, a more scientific and reasonable spontaneous lung squamous carcinoma mouse model is urgently needed.

Disclosure of Invention

In view of the above, the invention aims to provide a method for constructing a spontaneous squamous cell lung carcinoma mouse model, which is simple and has the characteristic of rapid tumor formation.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a construction method of a spontaneous squamous cell lung carcinoma mouse model, which comprises the following steps: (1) construction of mouse Yap1 with conditional Yap1 knockin Using the targeting vector for conditional Yap1 knockin^KI；

(2) Mouse Yap1 into which the conditional Yap1 was knocked^KITrp53 gene knockout mouse Trp53^KOHybridizing to obtain Yap1^KI/Trp53^KOA mouse.

Preferably, the conditional Yap1 knock-in targeting vector in step (1) further comprises a negative selection marker DTA and a positive selection marker Neo.

Preferably, the targeting vector for the conditional Yap1 knock-in takes KI431-basic vector as a basic vector, and also comprises a mouse Yap1 gene, a human SP-C promoter and a mouse ROSA26 gene which are connected in sequence; the nucleotide sequence of the SP-C promoter is shown as SEQ ID NO. 1.

Preferably, the point mutation site of the mouse Yap1 gene is TCC 336 GCC.

Preferably, the construction method of the conditional Yap1 knock-in targeting vector comprises the following steps: (a) introducing point mutation into TCC 336GCC site of the mouse Yap1 gene to obtain a mutant Yap1 gene;

(b) connecting the SP-C promoter from Human with the mutant Yap1 gene to obtain a Human SP-C promoter-mutant mouseYap1 CDS-ployA box;

(c) cloning the Human SP-C promoter-mutant mouse Yap1 CDS-ployA box into an intron1 of ROSA26 in the opposite direction to obtain the Human SP-C promoter-mutant mouse Yap1 CDS;

(d) the sequence of the Human SP-C promoter-mutant mouse Yap1 CDS was ligated into the KpnI/PmlI cleavage backbone of the base vector.

Preferably, the conditional Yap1 knock-in targeting vector is knocked into a mouse blastocyst in step (1) by using an ES targeting method.

Preferably, the hybridization in the step (2) is to select the mouse Yap1 with the conditional Yap1 knock-in function^KIIs homozygote of (2) with Trp53^KOHomozygotes from knockout mice were mated with cages.

Preferably, the pups obtained after mating with the cages are subjected to PCR verification.

Preferably, the PCR verified primers comprise primers Neo-del-F, Neo-del-R and WT-F for detecting Yap 1; primers Trp53-F1, Trp53-R1 and Trp53-F3 for detecting Trp 53;

the nucleotide sequence of the Neo-del-F is shown as SEQ ID NO.2, the nucleotide sequence of the Neo-del-R is shown as SEQ ID NO.3, and the nucleotide sequence of the WT-F is shown as SEQ ID NO. 7;

the nucleotide sequence of Trp53-F1 is shown as SEQ ID NO.4, the nucleotide sequence of Trp53-R1 is shown as SEQ ID NO.5, and the nucleotide sequence of Trp53-F3 is shown as SEQ ID NO. 6.

Preferably, the PCR verification procedure includes: the PCR program for detecting Tap1 by using primers Neo-del-F, Neo-del-R and WT-F comprises: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 64 ℃ for 35s, extension at 72 ℃ for 35s, and 33 cycles; extending for 5min at 72 ℃;

the PCR program for detecting Trp53 by using the primers Trp53-F1 and Trp53-R1 comprises the following steps: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 70 ℃ for 30s, and extension at 72 ℃ for 50s for 35 cycles; extending for 10min at 72 ℃;

the PCR program for detecting Trp53 by using the primers Trp53-F3 and Trp53-R1 comprises the following steps: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 70 ℃ for 30s, and extension at 72 ℃ for 50s, for 33 cycles; extension at 72 ℃ for 10 min.

The invention provides a construction method of a spontaneous squamous cell lung carcinoma mouse model, which is characterized in that a conditional Yap1 knock-in mouse (Yap 1) is constructed by designing a targeting vector for conditional Yap1 knock-in^KI) Because of the cancer promotion effect of Yap1, the spontaneous lung squamous cell carcinoma has the characteristic of rapid tumor formation, then a negative selection marker (DTA) and a positive selection marker (Neo) are introduced into a targeting vector according to the standard design of a transgenic mouse, so that positive clones can be conveniently and rapidly obtained, and finally the Trp53 gene is utilized to knock out the mouse and the Yap1^KIThe mice are hybridized to obtain the Yap1^KI/Trp53^KOAnd (5) finishing the construction of the spontaneous squamous cell lung carcinoma mouse model.

Drawings

FIG. 1 is a conditional Yap1 typing construction strategy;

FIG. 2 shows the construction process of Yap1 knock-in mice;

FIG. 3 is a targeting vector plasmid map;

FIG. 4 is a graph of the results of targeted ES clones;

FIG. 5 shows the selection of regions for southern Blots;

FIG. 6 is a graph showing southern blot results;

FIG. 7 is a sequencing diagram of the Yap1 mutant;

FIG. 8 is a graph showing the results of HE staining, in which Yap1 is shown in the order from left to right^KITrp53^KO(pulmonary trachea), Yap1^KITrp53^KO(lung lobes) and control);

FIG. 9 shows immunohistochemical results, wherein KI67, P63 and Yap1 are represented in order from left to right;

fig. 10 shows the results of a CT experiment on lung volumes.

Detailed Description

The invention provides a construction method of a spontaneous squamous cell lung carcinoma mouse model, which comprises the following steps:

(1) construction of mouse Yap1 with conditional Yap1 knockin Using the targeting vector for conditional Yap1 knockin^KI；

(2) Mouse Yap1 into which the conditional Yap1 was knocked^KIHybridizing with Trp53 knockout mice to obtain Yap1^KI/Trp53^KOA mouse.

The invention utilizes the targeting vector of the conditional Yap1 knock-in to construct the mouse Yap1 of the conditional Yap1 knock-in^KI. The conditional Yap1 knock-in targeting vector of the invention preferably further comprises a negative selection marker D TA and a positive selection marker Neo. The targeting vector for the conditional Yap1 knock-in is preferably a K I431-basic vector-based vector, and further comprises a mouse Yap1 gene, a human SP-C promoter and a mouse ROSA26 gene which are sequentially connected; the nucleotide sequence of the SP-C promoter is shown as SE Q ID NO.1 (amplification primers CF and CR, CF (SEQ ID NO.8) -GGCTGTTG CGCGGGCTCCAT; CR (SEQ ID NO.9) -TTAAAGTTAGTAGCGTCGACC ACGTGACTAG). The mouse Yap1 gene is positioned on a mouse chromosome 9, and the NCBI reference sequence: NM _001171147.1 (amplification primers AF/AR and BF/B, AF (SEQ ID N O.10) -GCAGCCTGCACCTGAGGATAATCGATCTATAACCACGTGAGAAA GCTTTCT, AR (SEQ ID NO.11) -TCCACAGCATGTTCGAGCTCACGCC TCTCCAGCCTCCCTGCAGCTG, BF (SEQ ID NO.12) -CAGCTGCAGGG AGGCTGGAGAGGCGTGAGCTCGAACATGCTGTGGA and BR (SEQ ID NO.13) -ATGGAGCCCGCGCAACAGCCGCC), when the mouse Yap1 gene is knocked in, point mutation is preferably introduced into the S112A site (336 TCC GCC) of the mouse Yap1 gene, and the point mutation is to change TCC into GCC. Mouse ROSA26 gene is located on mouse chromosome 6, NCBI reference sequence: NR _ 027008.1.

The construction method of the conditional Yap1 knock-in targeting vector is shown in FIG. 1, and preferably comprises the following steps:

(a) introducing point mutation into S112A site of a mouse Yap1 gene to obtain a mutant Yap1 gene, wherein the point mutation is to mutate TCC into GCC;

(b) connecting the SP-C promoter from Human with the mutant Yap1 gene to obtain a Human SP-C promoter-mutant mouseYap1 CDS-ployA box;

(c) cloning the Human SP-C promoter-mutant mouse Yap1 CDS-ployA box into an intron1 of ROSA26 in the opposite direction to obtain the Human SP-C promoter-mutant mouse Yap1 CDS;

(d) the sequence of the Human SP-C promoter-mutant mouse Yap1 CDS was ligated into the KpnI/PmlI cleavage backbone of the base vector.

The S112A (TCC mutated into GCC) mutant (GenBank accession number: NM-001171147.1, Ensembl: ENSMUSG00000053110) of the mouse Yap1 gene has nuclear transcription activity, can play a biological function when entering the nucleus, and can realize fixed-point insertion when being inserted into an intron1 of a Rosa26 gene (GenBank accession number: NR-027008.1, Ensembl: ENSMUSG 00000086429). In the present invention, the KI sequence is preferably ligated in reverse orientation to ROSA26 (forward) arm, i.e., it can be cloned in reverse orientation to ROSA26 intron 1.

The conditional Yap1 knock-in targeting vector is knocked into a mouse blastocyst preferably by an ES targeting method, and before the ES targeting, the conditional Yap1 knock-in targeting vector preferably further comprises amplifying a mouse genome segment containing Homology Arms (HAs) from a BAC clone by using high fidelity Taq, and then assembling the amplified segment together with a recombination site and a selection marker downstream of the amplified segment into a targeting vector to form the targeting vector shown in FIG. 3, wherein the positive selection marker Neo is flanked by an SDA (self-deletion anchor) site, and the negative selection marker DTA is used for negative selection. The invention preferably uses BAC clones from the C57BL/6 library as templates to generate homology arms by PCR. The method of targeting ES in the present invention is not particularly limited, and a conventional ES targeting method in the art may be used.

Mouse Yap1 with conditional Yap1 knock-in^KIThen, the invention uses the mouse Yap1 into which the conditional Yap1 is knocked^KIHybridizing with Trp53 knockout mice to obtain Yap1^KI/Trp53^KOA mouse. The Trp53 gene knockout mouse is a model mouse purchased from Spacerola Biotech limited company, and can be obtained by self-making or purchasing a commercially available product, and when the Trp53 gene knockout mouse is self-made, the sgRNA is preferably designed by adopting a CRISPR/Cas9 technology, and the Trp53 gene knockout mouse is obtained by applying a high-flux electrotransformation zygote mode.

The hybridization according to the invention is preferably a mouse Yap1 which selects the conditional Yap1 knock-in^KIThe homozygote of (4) and the homozygote of a Trp53 knockout mouse (Trp 53)^KO) Mating with cage, and performing mating with Trp53^KOAs male parent, Yap1^KIIs used as a female parent; or Yap1^KIAs male parent, Trp53^KOThe number ratio of the male parent to the female parent is preferably 1: 2. According to the invention, the young animals obtained after mating with the cage are preferably subjected to PCR verification, and the PCR verification primer preferably comprises: detecting primers Neo-del-F, Neo-del-R and WT-F of Yap 1; primers Trp53-F1, Trp53-R1 and Trp53-F3 for detecting Trp 53;

the nucleotide sequence of Neo-del-F is shown as SEQ ID NO.2 (5'-AGTGGTCTTCGTTCCCTGGACT-3'), the nucleotide sequence of Neo-del-R is shown as SEQ ID NO.3 (5'-CAAGAGACCACATGGCAGGAAG-3'), and the nucleotide sequence of WT-F is shown as SEQ ID NO.7 (5'-TTGAAGCATTCCCTAATGAGCCAC-3');

the nucleotide sequence of Trp53-F1 is shown in SEQ ID NO.4 (5'-GCTTTCCCACCCTCGCATAAG-3'), the nucleotide sequence of Trp53-R1 is shown in SEQ ID NO.5 (5'-TTCACTACAAAGGCTGAGCTGGAG-3'), and the nucleotide sequence of Trp53-F3 is shown in SEQ ID NO.6 (5'-CCATAAGACAGGTGCTCCTCCAC-3').

The PCR verification procedure of the present invention preferably comprises: the PCR program for detecting Tap1 by using primers Neo-del-F, Neo-del-R and WT-F comprises: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 64 ℃ for 35s, extension at 72 ℃ for 35s, and 33 cycles; extending for 5min at 72 ℃;

the PCR program for detecting Trp53 by using the primers Trp53-F1 and Trp53-R1 comprises the following steps: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 70 ℃ for 30s, and extension at 72 ℃ for 50s for 35 cycles; extending for 10min at 72 ℃;

the PCR program for detecting Trp53 by using the primers Trp53-F3 and Trp53-R1 comprises the following steps: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 70 ℃ for 30s, and extension at 72 ℃ for 50s, for 33 cycles; extension at 72 ℃ for 10 min.

The following examples are provided to illustrate the method for constructing the idiopathic squamous cell lung carcinoma mouse model of the present invention, but they should not be construed as limiting the scope of the present invention.

Example 1

Firstly, designing and constructing a conditional Yap1 knock-in targeting vector: a mouse Yap1 conditional knock-in model was created in C57BL/6 mice. (see FIGS. 1 and 2)

1. Vector construction:

(1) ordering BAC, and simultaneously preparing primers required by vector construction; (2) extracting BAC by shaking bacteria, and preparing a basic vector plasmid (KI431-basic vector); (3) PCR amplifying a target fragment Yap1 from BAC DNA, detecting an amplification product through electrophoresis, cutting gel and recovering the target fragment; (4) the target fragment is connected with a basic vector (basic vector is cut by pmlI and KpnI); (5) the ligation products are transformed to be competent and plated overnight for culture; (6) selecting a single colony, and screening positive clones by colony PCR; (7) carrying out enzyme digestion identification on colony PCR positive clone small extract plasmid; (8) sequencing and verifying the positive clone identified by enzyme digestion; (9) sequencing is correct, and the target fragment is successfully connected into a basic carrier; (10) preserving positive clone strains, and connecting plasmids with other fragments; (11) the ligation of each target fragment was completed to obtain the final vector (see Targeting vector in FIG. 1).

2. Plasmid preparation:

(1) preparing reagents and articles required by plasmid preparation; (2) transforming the carrier plasmid into escherichia coli; (3) shaking the bacteria, and then extracting plasmids by using a kit; (4) restriction enzyme digestion with enzymes to verify plasmids (ApaLI, DrdI, NcoI, Agel/Scal, Ahd1, Notl); (5) carrying out plasmid linearization by using NotI single enzyme digestion; (6) recovering the linearized plasmid; (7) verifying the recovered linearized plasmid by AhdI single enzyme digestion; (8) the linearized vector plasmid is used for subsequent ES cell targeting.

ES targeting-electrotransfer:

(1) preparing reagents and articles required by electrotransformation; (2) culturing ES cells (containing ROSA26 Wildtype allel); (3) pancreatin digestion and cell count (6X 10)⁶cells), determining that the cell mass is sufficient for electroporation; (4) centrifuging to collect cells, adding an electrotransfer buffer solution and linearized plasmid DNA, carrying out ice bath for a moment, and adding the mixture into an electrotransfer cup for electrotransfer; (5) after electrotransfer, the cells are immediately inoculated in an ES culture medium in an ice bath; (6) culturing overnight, adding medicine the next day, and screening for drug resistance (screening Neo and DTA, and finally obtaining Targeted allele); (7) continuing culturing, and selecting the monoclonal antibody to be cloned in a 96-well plate after the cells grow stably; (8) transferring the 96-well plate ES cells to a new 96-well plate, and carrying out subculture; (9) after the cells grow stably, the cells of a 96-well plate are subjected to PCR detection and primary targeting screening; at the same time, the backup plates were stored at-80 ℃.

The linearized vector was delivered to ES cells (C57BL/6) by electroporation, followed by drug selection, PCR screening and southern blot confirmation. After 91 resistant clones were obtained, there were 7 potential targeting clones, of which 6 were amplified for southern blot (fig. 4), and samples 1F2, 1D4, 1B5, 1G6, 1H5, 1D8, and 1D9 were confirmed as potential targeting ES clones.

The region shown in FIG. 5 was selected for southern Blots and the expected fragment size was:

Neo Probe(containing 5’HA)–9.7Kbp–HindIII

neo Probe (cloning 3' HA) -12.7 Kbp-Kpn I, and the results are shown in FIG. 6, and the above 6 clones were correct.

ES targeting-PCR screening:

(1) designing and preparing primers, and carrying out primer test to select the optimal primer; (2) the mixed solution of SDS lysate and proteinase K is used for lysing the ES cells of the 96-pore plate and is lysed overnight; (3) precipitating the genome DNA by using a mixed solution of anhydrous glacial ethanol and sodium chloride the next day; (4) washing the precipitate with 70% ethanol, removing residual ethanol, adding mixed solution of RNAaseA and water for injection, sealing the incubator at 37 deg.C overnight, and using as PCR template; (5) preparing a 96-hole PCR plate, and carrying out PCR amplification and electrophoresis detection; (6) and (5) completing electrophoresis and recording the detection result.

Wherein the 3' arm PCR primer:

P1(SEQ ID NO.14)：TCGACTAGAGCTTGCGGAACCCT；

P2(SEQ ID NO.15)：AAGACACCAGTTTCAGCCCAAGTTC；

neo PCR primers:

P1(SEQ ID NO.14):TCGACTAGAGCTTGCGGAACCCT；

P5(SEQ ID NO.16):CAAGAGACCACATGGCAGGAAG；

KI PCR primers:

P3(SEQ ID NO.17)：CAAAGCTGAAAGTCAAGTCTGCAG；

P4(SEQ ID NO.18)：ACCCATGGTGAGAAGTGCAGATGG；

sequencing primer (SEQ ID NO. 19): CTCTTCAATGCCGTCATGAAATG are provided.

ES targeting-cell resuscitation passage:

(1) preparing reagents and articles required by cell resuscitation; (2) taking out the backup plate frozen at-80 ℃; (3) passaging PCR positive clones from 96-well plates to 12-well plates; (4) after the cells in the 12-hole plate grow stably, transferring the cells to a culture dish of 6 cm; (5) then transferring the cells of the 6cm culture dish to a 10cm culture dish; (6) after the cells grow stably, digesting, centrifugally collecting the cells, and freezing and storing part of the cells; a portion was sent for Southern analysis.

ES targeting-Southern Blot:

(1) designing an enzyme digestion scheme and a probe, and preparing required reagents and articles; (2) preparing a digoxin labeled probe (SEQ ID NO. 20: aaggcgatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaagcacgaggaagcggtcagcccattcgccgccaagctcttcagcaatatcacgggtagccaacgctatgtcctgatagcggtccgccacacccagccggccacagtcgatgaatccagaaaagcggccattttccaccatgatattcggcaagcaggcatcgccatgggtcacgacgagatcatcgccgtcgggcatgcgcgccttgagcctggcgaacagttcggctggcgcgagcccctgatgctcttcgtccagatcatcctgatcgacaagaccggcttccatccgagtacgtgctcgctcgatgcgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcagccgccgcattgcatcagccatgatggatactttctcggcaggagcaaggtgagatga) by a PCR method; (3) extracting ES cell genome DNA; (4) carrying out genome DNA enzyme digestion (BamHI and EcorV), and carrying out electrophoretic separation on enzyme digestion products; (5) transferring the electrophoresis gel to a nylon membrane, and transferring the DNA on the gel to the nylon membrane; (6) fixing a nylon membrane by ultraviolet crosslinking; (7) pre-hybridizing DNA; (8) after the prehybridization is finished, hybridizing overnight; (9) after hybridization, membrane washing and blocking are carried out; (10) adding antibody for incubation (Anti-Digoxigenin-AP, Fab fragments from sheet (Roche 11093274910)), washing with washing buffer, and adding detection buffer for equilibration; (11) putting the membrane into a substrate color development solution, and developing in a dark place; (12) and (4) finishing the color development, washing with a membrane washing buffer solution, and observing the result.

7. And (3) injecting blastocysts:

(1) obtaining blastocysts from the uterus of donor female mice 3.5 days after mating; (2) installing microinjection equipment, and preparing required reagents and articles; (3) selecting blastocysts with good shapes and moderate development states, and transferring the blastocysts into a culture medium of an injection dish; (4) transferring the ES to be injected into a cell culture medium of an injection dish, and uniformly arranging the ES to be injected into the cell culture medium with moderate density; (5) sucking ES cells into an injection needle, and injecting the ES cells into a blastocoel one by one; (6) after injection was complete, the ES cells were visualized within the blastocoel.

8. Preparing a surrogate mouse and transplanting an embryo:

(1) selecting a female mouse with the proper age and ligating a male mouse to be combined into a cage, and obtaining a surrogate female mouse; (2) transplanting the blastocyst injected with the ES cell into the uterus of a surrogate mother mouse; (3) putting the surrogate mother mouse into a clean cage box, preserving heat, and putting the surrogate mother mouse back to a cage frame for feeding after the surrogate mother mouse is clear; (4) completing blastocyst transplantation and allowing the chimeric mouse to be born; (5) chimeras (Targeted allole) were numbered 1 week after birth and caged 3 weeks later.

Region 1 PCR screening of 7 pups (4 males and 3 females) from clone 1D4 was identified as positive, was also confirmed positive by PCR screening of region 2, and after sequencing, the Yap1 mutant sequence was correct (fig. 7).

F1 mouse reproduction:

(1) male chimeras grow full for 8 weeks and are caged with 8-week-old female mice (B6 or Flp/Cre tool mice); (2) placing the young born baby into a new cage box, and numbering; (3) performing primary identification by cutting the toes of the mice at the age of about 1 week and performing detection PCR (the primers are shown as SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO. 7); (4) keeping the positive mice for the primary identification, cutting the mouse tails after about 2 weeks of age, sending to a test PCR, and carrying out secondary identification; (5) positive mice were identified by 2 PCRs as correctly targeted heterozygote mice (constitutive KI allele with neo deletion).

F1 mouse identification:

(1) extracting genome DNA, cracking a sample overnight by using a Triton X-100 and protease mixture lysate; (2) on the next day, protease is inactivated at high temperature, and the supernatant is collected by centrifugation and used as a PCR template; (3) PCR amplification and electrophoresis detection; (4) record the positive sample number.

Trp53 knockouts (Trp 53)^KO) Establishment of mice of (1), creation of a mouse Trp53 conditional knock-out model in C57BL/6 mice

1) Subsequent studies were performed using Trp53 knockout mice purchased from seiko biotechnology limited;

2) trp53^KOThe male and female of the mouse are separately raised for one week, and the environment is familiar;

3) trp53^KOMouse sex cage (Henan: 1)&♀：2)；

4) Numbering postnatal cubs, cutting toes of mice to extract genome DNA, inactivating protease at high temperature, centrifuging and collecting supernatant serving as a PCR template; then detecting by PCR amplification and electrophoresis, and recording the experimental result, wherein the young mouse is F₂；

5) F is to be₂The mice are mated in the same cage (sex: 1)&Male parent: 2) DNA extraction, PCR amplification and electrophoresis detection are carried out in the same way, the experimental result is recorded, and the young mouse is marked as F₃；

Yap1 knock-in Trp53 knock-out (Yap 1)^KI/Trp53^KO) Mouse construction of

1) And selecting a mouse homozygous from Yap1 knock-in mice and mice homozygous from Trp53 knock-out mice to mate with a cage (male: 1 &: 2) (ii) a

2) Numbering postnatal cubs, cutting toes of mice to extract genome DNA, inactivating protease at high temperature, centrifuging and collecting supernatant as a PCR template; then PCR amplification and electrophoresis detection are carried out, and the experimental result is recorded.

HE staining

The lung trachea and lung lobes were extracted and subjected to HE staining, and the results are shown in FIG. 8, Yap1^KI/Trp53^KOObvious cancer nests appear in both the trachea and the lobes of the lungs of the group, and the cancer nests are large. Description of Yap1^KI/Trp53^KOMice have spontaneously developed tumors.

14. Immunohistochemistry

The results of immunohistochemical analysis using rabbit antibodies are shown in FIG. 9, where KI67, P63, and Yap1 are all in Yap1^KI/Trp53^KOHigh expression in the mouse lung.

CT analysis

The lung volume of the mice was analyzed by CT, and the results are shown in FIG. 10, Yap1^KI/Trp53^KOThe lung volume of the mouse is obviously higher than that of the wild mouse, which shows that Yap1^KI/Trp53^KOThe lung tissue of the mice proliferated significantly compared to wild-type mice.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> second subsidiary hospital of China civil liberation army, military and medical university

<120> construction method of spontaneous squamous cell lung carcinoma mouse model

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3722

<212> DNA

<213> Homo sapiens

<400> 1

actagtgctg cctgggcttc tagtcttgtg ctttttgcac accagtccag ggaacgaaga 60

ccactggctt taagatgctt ccccagctgt ccccagactc tgccagcagg ggattctctg 120

gtctgagctt aagttgtgtt ctcccagcca gggatgcccc tgccctttga tgtctccttg 180

ctgccacaca tttagccgcc ctccccatgc cagcttgggg ggagggaagc agtgagggta 240

gggaggtggc tggggcagct gggcaactgt ccccacccgt ccctggcacg gctctgccca 300

gtacacaaag agcaaagtga atcttgtccc cacccctgca gctgaggggc tggaggagga 360

aacggggagg cccacacaga aggggtggcc accgtggggc tgtccatcac tcagggctct 420

cagagggagt caacccagaa acagacaaag agggtgagtc tgggctgtgt tcttagctag 480

tgagaggtcc cctagaggat gaagtagatg atgctaatga ggatgactgg atgtcacacc 540

catgatgcta ttaggtcctc ataatagcat agtgaggtgg acagctagta cctgacccat 600

ctcacagatg aacatactaa tgcctaacaa agcagaacga ctcacgctgg gtcccagagc 660

tggccagtgg aagcactgag acctccacat actgaaggca tggactattg accgctgttg 720

gtattggtct catcattgac tatcattaag tgttggctgt ttgcatgctt cctgcccagt 780

ggcaggttca aagaagcccg caggaagcgt gctcctttct ttcccagggc ccgcaattgg 840

gctggaagat agagcaacaa aaagcgccca tgtaactcat gggaacattc atgtgtgctg 900

aatggcaggt gaaggtgcca cagagaggct gaggatttca gagggcacca tgaactggag 960

tgaggtcgca gagcaggtgc cattggctct tggcctgttt gggtgggtgg cattcagaga 1020

ggtggaaggt cagatgcact gttcacgcct gtaatctcag cactttggaa ggccaaggta 1080

ggaggatcac acgaggccag gagatcaacg ctgcagtgag ctatgaagct gtgattgcac 1140

cactgcactg cagcttgggt aacagagtga gaccctgtct ctaaataatt aaataaataa 1200

aataaaaata aaaccggaga agtggagagg gattggaggt gggctttcac agagggagaa 1260

acggcttaag tacaggccaa aaagtgagaa ggctgcagac agggctggta gggggagggg 1320

gaaatttggc acacccagct aaaggtcctt ctgtgtctcc ttctccaagg aacccaagac 1380

cttcacttgg ttggtgtgag cactccagga ggcaggcacc ctccctcagc cctcaagcaa 1440

gcaaaaatgg gtttaaaaaa agaaggagaa gaagcagcag cagcagccgc cacagagctt 1500

gtgacagcta cagcctaagg gcaacaggca ggggagacca aggaccagaa agagcagagg 1560

ctttttcaaa gaaagagatc cctctcccag cacccagcga tggcggcaaa ccccacccac 1620

agtgcctgct aagaacaagt cccacgtgag aacaacatgg ccccccgaga tgcccacagg 1680

gaccccgaga tgcctgcagt gcttggctct cccgctggcc agctgcccac ctggctcagg 1740

cccagtactc gtgagtcagc cgatcaatcc caatgttgcc aggatgatgg gggcgggagt 1800

aagggccctg ggggagggca ggggtgggca ctgcaggcga gctgtctccc acatctggca 1860

cctgcacaca gctgaggccg agctgagagg atgcttctgt gggctccccc tcctcccggc 1920

acccctcccc tcctttcact gtcctaggac actctctggc tgctggagtc ttaggcaaat 1980

atttaaaggg gcagcaaggg ggtgaggagg gtggtgggag caaacacttc cctccctttc 2040

ttcctccctg cgcttctcag gggctctcag ttcagatgcc atgctgttat gcaaccttgg 2100

ggctgaaggc cctccagatg gagaggggga caggggaacc tgccagctca tgaccgaagg 2160

gcagggccca ggtgggaggg ggctggggca ggggacagga actggggtgg catgttaaag 2220

gacaggaggc tggttgggca tggtggctca cacctgtaat cctagcactt taggaggccg 2280

agatcacttg agcccaggag ttcgagacca gcctgggcaa catggtgaaa actcatctct 2340

ataaaacaag caaaaattag ctgggcacaa tggcatgcac tggtagtccc agctacttgg 2400

gatgctgagg tgtgaggatc accggagtcc aggaggtcaa cgctgcagtg agcagtgatc 2460

tcgctactgc atgccagcct gggtgataaa gtgagaccct gtctcacaac aaaacaaaac 2520

aaaacaaaac aaaaggatag gaggttaagg gagcgagccc aggcctggac tctgccacag 2580

tcacctgagt ttagaggtga agggacttta gagaccacct ggcccaagga gtgaaaggga 2640

acctgagaga aagggtgagc cagcccaaag tcattggcag atttgacctc gtaaatacat 2700

agagatggct ttgggaaggc actaggaaag acagagaaaa gagaaggaga cagtcctcaa 2760

agctgatcgt atttgggtga gtattattct cagggcaaat ttaggatcag aggatgcaga 2820

aaggggagtc tagaggggta gagtgtagac cacagggtga gtgagctgat tcgaggatgg 2880

ggagactggg agcccaccag tgaccagagc cagccctgtt cagggctgtc cgggcagaag 2940

aaagcagtgt cagacctgga atctgccatc agcacagcct gcaattgaca gacaagccca 3000

gagcaaagaa ggaagcactg cacatgagta agagcttgcc accagtgggg acagagtttc 3060

cagaattagg aaaataatca ctgggggcaa gtttgaggtt ggtaccagat atgtgggagg 3120

aggcaaggta agggaaagag tacttgaagt tggaactggt ccttgcaggg aaatgcacat 3180

ttatgaaacc ccgaaaactg atgtcaaagc acctcctgcc ttgggcagag tcctctcaga 3240

gtctacaggt gctgcctcca gaaccctctt cctggagcgc atccctatgt atctagaaat 3300

tctgctggga aatatgatgg tcagaccctt ggccacctga aaggttcagg gtggtagaag 3360

aaaaaggaaa gccacagggc agcaggggca ggtgccagca aggaaggcag gcacgccagg 3420

aagacaccca tggtgagaag tgcagatggc ccgagggcaa gtttgctcaa ctcacccagg 3480

tttgctcttg ctggggccaa gaggactcat gtgccagggc caagggccct tgggggctct 3540

cacagggggc ttatctgggc ttcggttctg gagggccagg aacaaacagg cttcaaagcc 3600

aagggcttgg ctggcacaca gggggcttgg tccttcacct ctgtcccctc tccctacgga 3660

cacatataag accctggtca cacctgggag aggaggagag gagagcatag cacctgccgc 3720

gg 3722

<210> 2

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

agtggtcttc gttccctgga ct 22

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

caagagacca catggcagga ag 22

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gctttcccac cctcgcataa g 21

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ttcactacaa aggctgagct ggag 24

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccataagaca ggtgctcctc cac 23

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ttgaagcatt ccctaatgag ccac 24

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggctgttgcg cgggctccat 20

<210> 9

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttaaagttag tagcgtcgac cacgtgacta g 31

<210> 10

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gcagcctgca cctgaggata atcgatctat aaccacgtga gaaagctttc t 51

<210> 11

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tccacagcat gttcgagctc acgcctctcc agcctccctg cagctg 46

<210> 12

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cagctgcagg gaggctggag aggcgtgagc tcgaacatgc tgtgga 46

<210> 13

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

atggagcccg cgcaacagcc gcc 23

<210> 14

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

tcgactagag cttgcggaac cct 23

<210> 15

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

aagacaccag tttcagccca agttc 25

<210> 16

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

caagagacca catggcagga ag 22

<210> 17

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

caaagctgaa agtcaagtct gcag 24

<210> 18

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

acccatggtg agaagtgcag atgg 24

<210> 19

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

ctcttcaatg ccgtcatgaa atg 23

<210> 20

<211> 468

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

aaggcgatag aaggcgatgc gctgcgaatc gggagcggcg ataccgtaaa gcacgaggaa 60

gcggtcagcc cattcgccgc caagctcttc agcaatatca cgggtagcca acgctatgtc 120

ctgatagcgg tccgccacac ccagccggcc acagtcgatg aatccagaaa agcggccatt 180

ttccaccatg atattcggca agcaggcatc gccatgggtc acgacgagat catcgccgtc 240

gggcatgcgc gccttgagcc tggcgaacag ttcggctggc gcgagcccct gatgctcttc 300

gtccagatca tcctgatcga caagaccggc ttccatccga gtacgtgctc gctcgatgcg 360

atgtttcgct tggtggtcga atgggcaggt agccggatca agcgtatgca gccgccgcat 420

tgcatcagcc atgatggata ctttctcggc aggagcaagg tgagatga 468

Claims (10)

1. A method for constructing an idiopathic squamous cell carcinoma mouse model is characterized by comprising the following steps: (1) construction of mouse Yap1 with conditional Yap1 knockin Using the targeting vector for conditional Yap1 knockin^KI；

(2) Crossing the mice with the conditional Yap1 knock-in gene with Trp53 knockout mice to obtain Yap1^KI/Trp53^KOA mouse.

2. The construction method according to claim 1, wherein the conditional Yap1 knock-in targeting vector of step (1) further comprises a negative selection marker DTA and a positive selection marker Neo.

3. The construction vector according to claim 2, wherein the conditional Yap1 knock-in targeting vector is based on KI431-basic vector, and further comprises a mouse Yap1 gene, a human SP-C promoter and a mouse ROSA26 gene which are connected in sequence; the nucleotide sequence of the SP-C promoter is shown as SEQ ID NO. 1.

4. The construction method according to claim 3, wherein the point mutation site of the mouse Yap1 gene is TCC 336 GCC.

5. The method for constructing the conditional Yap1 knock-in targeting vector according to claim 3, comprising the following steps: (a) introducing point mutation into TCC 336GCC site of the mouse Yap1 gene to obtain a mutant Yap1 gene;

(b) connecting the SP-C promoter from Human with the mutant Yap1 gene to obtain a Human SP-C promoter-mutant mouseYap1 CDS-ployA box;

(c) cloning the Human SP-C promoter-mutant mouse Yap1 CDS-ployA box into an intron1 of ROSA26 in the opposite direction to obtain the Human SP-C promoter-mutant mouse Yap1 CDS;

(d) the sequence of the Human SP-C promoter-mutant mouse Yap1 CDS was ligated into the KpnI/PmlI cleavage backbone of the base vector.

6. The construction method according to claim 1, wherein the conditional Yap1 knock-in targeting vector is knocked into mouse blastocysts in step (1) by ES targeting.

7. The method for constructing a transgenic animal of claim 1, wherein the crossing of step (2) is performed by selecting the mouse Yap1 for conditional Yap1 knock-in^KIThe homozygote of (2) and Trp53 knock-out mouse Trp53^KOThe homozygote is mated with the cage。

8. The method of claim 7, wherein the pups obtained after mating with a cage are subjected to PCR validation.

9. The construction method according to claim 8, wherein the PCR-verified primers comprise primers Neo-del-F, Neo-del-R and WT-F for detecting Yap 1; primers Trp53-F1, Trp53-R1 and Trp53-F3 for detecting Trp 53;

the nucleotide sequence of the Neo-del-F is shown as SEQ ID NO.2, the nucleotide sequence of the Neo-del-R is shown as SEQ ID NO.3, and the nucleotide sequence of the WT-F is shown as SEQ ID NO. 7;

the nucleotide sequence of Trp53-F1 is shown as SEQ ID NO.4, the nucleotide sequence of Trp53-R1 is shown as SEQ ID NO.5, and the nucleotide sequence of Trp53-F3 is shown as SEQ ID NO. 6.

10. The construction method according to claim 9, wherein the PCR verification procedure comprises: the PCR program for detecting Tap1 by using primers Neo-del-F, Neo-del-R and WT-F comprises: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 64 ℃ for 35s, extension at 72 ℃ for 35s, and 33 cycles; extending for 5min at 72 ℃;

the PCR program for detecting Trp53 by using the primers Trp53-F1 and Trp53-R1 comprises the following steps: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 70 ℃ for 30s, and extension at 72 ℃ for 50s for 35 cycles; extending for 10min at 72 ℃;

the PCR program for detecting Trp53 by using the primers Trp53-F3 and Trp53-R1 comprises the following steps: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 70 ℃ for 30s, and extension at 72 ℃ for 50s, for 33 cycles; extension at 72 ℃ for 10 min.

Images