CN104087615B - A kind of hemangioma animal model builds system, method - Google Patents

Abstract

The present invention relates to a kind of system, methods of building of hemangioma animal model, including：(1) structure of the specifically expressed PyMT gene plasmids of vascular endothelial cell；(2) by the above-mentioned plasmid built through PvuI linearization for enzyme restriction, then in microinjection to mouse fertilized egg；(3) mouse of birth is subjected to PCR identifications, obtains the transgenic mice that qualification result is positive；There is angiomatoid phenotype in the transgenic mice；(4) above-mentioned transgenic mice is built into mouse as the head for cultivating transgenic animals strain basis population and establishes hemangioma animal model.Target gene PyMT is only expressed in vascular endothelial cell in the present invention, is avoided it and is induced generation malignant tumour in its hetero-organization, animal pattern phenotype is single-minded, shows typical angiomatous change；Significantly improve the embryotoxicity of PyMT genes, the quantity that the positive head of generation builds mouse is apparently higher than conventional method, and it is that offspring rat also has hemangioma phenotype that can stablize passage, build.

Description

A kind of hemangioma animal model builds system, method

Technical field

The invention belongs to the research field of angiocardiopathy, more particularly to a kind of hemangioma animal model builds system, method.

Background technology

Benign congenital vascular tumor is the common disease of infant.Neonatal incidence is 1~2%, is sent out within 1 years old or so Sick rate rises to 12%, and in premature of the weight less than 1000g, incidence may be up to 23%.It is ground to break through hemangioma Study carefully bottleneck, more effectively recognize angiomatous generation, the rule of development, it is when business to establish an ideal hemangioma animal model It is anxious.

Angiomatous animal model is earliest using cockscomb model, but its tissue occurs and structure has with hemangioma Greatest differences, this model have been eliminated.Currently, the method for building up of the generally accepted hemangioma animal model of home and abroad scholar Mainly there are 2 kinds：1. by being inoculated with hemangioma or endothelial cell, animal is set to generate close with derived cell biological character Hemangioma model.Although this method is easy to operate, success rate is high, and the animal model generated only simulates angiomatous office Portion's morbid state can not reflect the system biological network change rule in disease progression, and its in body integral level There is also larger differences for the hemangioma of generation and the naturally-occurring process of disease.2. being incited somebody to action by virus infection, transgenic technology Certain channel genes Animal genomes generate hemangioma phenotype.Williams uses polyomavirus MiddleT earliest (Polyomavirus Middle T, PyMT) gene establishes transgenosis hemangioma mouse model, and the animal model of induction is going out There is angiomatoid phenotype within 2 weeks or so after life, it is very much like with abiogenous hemangioma.But using the transgenosis sides PyMT Method establishes hemangioma mouse model, and there are 2 obvious shortcomings：(1) not only cause angiomatous generation after PyMT transgenosis, also can It induces animal and generates various other malignant tumours, cause the specificity of model poor, reduce its value in hemangioma research. (2) PyMT genes have embryonic lethal, and the birth rate of transgenic positive animal is extremely low, and animals' reproduction power is low, causes difficulty To obtain sufficient amount of animal pattern due to follow-up study.These problems are because PyMT genes are in different tissues Middle expression can cause different pathological changes, for example, expression causes hemangioma phenotype in skin in the blood vessels, in breast tissue Expression can cause the generation of breast cancer, embryonic tissue wide expression PyMT genes to cause serious embryotoxicity, reproduction cell It expresses the gene and causes mouse propagation inferior capabilities.

Invention content

Technical problem to be solved by the invention is to provide a kind of system, method of building of hemangioma animal model, this method makes The target gene PyMT of hemangioma animal model be only expressed in vascular endothelial cell, avoid it and induced in its hetero-organization Malignant tumour occurs, animal pattern phenotype is single-minded, shows typical angiomatous change.

A kind of hemangioma animal model of the present invention builds system, method, including：

(1) structure of the specifically expressed PyMT gene plasmids of vascular endothelial cell；

Include Kozak needed for the specifically expressed promoter Tie2 of vascular endothelial cell, eucaryote transcription in the plasmid Sequence, PyMT genes complete sequence, SV40 polyA signals and Tie2 enhancer sequences；

(2) the above-mentioned plasmid built is recycled into the DNA fragmentation of 7.0kb through PvuI linearization for enzyme restriction；It then will be above-mentioned DNA fragmentation is injected into the male pronucleus of fertilized eggs, then is transplanted in the fallopian tubal of 0.5 day false pregnancy mouse, and mouse is obtained；

(3) mouse of birth is subjected to PCR identifications, obtains the transgenic mice that qualification result is positive；Described turns base Because there is angiomatoid phenotype in mouse；

(4) it builds mouse using above-mentioned transgenic mice as the head for cultivating transgenic animals strain basis population and establishes hemangioma and move Object model.

The concrete operation method of the specifically expressed PyMT gene plasmids structure of vascular endothelial cell described in step (1) For：Experiment mice is C57BL/6J transgenic mices, is provided by Shanghai Nanfangmoshi Biological Sci-Tech Dev Co., Ltd. and is bred, The preparation of mouse genome：The rat-tail 0.3cm for taking out raw 10 days or so newborn rats, adds 450 μ l lysates and 50 μ l Proteinase Ks (10mg/ml), 56 DEG C of digestion are overnight；Centrifuging and taking supernatant, absolute ethyl alcohol precipitation, the washing of 70% ethyl alcohol are dissolved in 200 after slightly drying In μ l pure water；

Using rat-tail DNA as template, difference PCR amplification Tie2 promoters, Tie2 enhancers, using pPymt as template PCR amplifications PyMT full length genes, using pGL3-Basic as template amplification A；PCR system is：Template DNA：1 μ l, 5xPCR buffer solutions：4 μ l, three Phosphoric acid dezyribonucleoside：1 μ l, PCR primer mixture：2 μ l, PCR polymerases：0.2 μ l, distilled water：11.8μl；Response procedures For：95 DEG C 3 minutes, 98 DEG C 15 seconds, 55 DEG C -68 DEG C 15 seconds, 72 DEG C 90 seconds, 72 DEG C 5 minutes, 35 cycle；With KpnI and SalI Digestion Tie2 promoter sequences, XhoI and NheI digestion PyMT gene orders, XbaI and ClaI digestion carrier junction fragment sequences, ClaI and SalI digestion Tie2 enhancers, are consecutively connected on pGL3-Basic carriers；

Above-mentioned structure primer is as follows：

Tie2 promoter sense primers catggtaccgcggaagcttactaagatctaatgaaaatc；

Tie2 promoter downstream primers catgtcgacTTCAACAACTCACAACTTTGCG；

Pymt sense primers catctcgagagcctcaccaccatcATGGATAGAGTTCTGAGCAGAG；

Pymt downstream primers catgctagcCTAGAAATGCCGGGAACG；

Carrier junction fragment sense primer GTGTAATTCTAGAGTCGGGGC；

Carrier junction fragment downstream primer CGACGGATCCTTATCGATTTTACC；

Tie2 enhancer sense primers catatcgatctcgaggtccagtatggcttc；

Tie2 enhancer downstream primers catgtcgacgtaccattattgttttacttgggagg.

The sequence of the specifically expressed promoter Tie2 of vascular endothelial cell described in step (1) is：

AAGCTTACTAAGATCTAATGAAAATCAAGATGTTAGGCACAGTGCCAGATACTTTAACATAGTAATATGACTCTTTA GAGTTTTGAGACAGGGCCTCATATAGTTTATGATGAATTCACTGTTTTGTCAAAGATGACCTTGAACTCTTAATCCA TTCCCAAAGTGTTGTTGTCATATGTTTGCACCACTCCTGGCTTCATAGTGTTTTTAAAACACCCATGGAGAGTCGGG TGTGAAGATCCACACGTCTAACCTCAGCATCTGGTGAATCAAGGCAGGAGGGCGGGTGGTTGCAGGCTGGCTATAAT ATCTAAGTTTCAGTTAGTAAGGGCTGCATAATGAAACACTGTCTTAAACACAAAACCAAAACCCATGAAGGAGATAC TATTGCCATTTAAAAGTCTCTGGAATGGAAATAGCTATCATAATCTTACCTCTGAGCCAGTGTCTGCCCTCAGGTGT GCCTGAGGACTGAACAGGGCTATGCACTCCTCAGGTTGGAAACATTACTAGTCCTCAGTGTCTGCTCTTGACCTGTT AACAGCTGAGTCAGGGTCTGCCCTCAGCTGTGCCTGAGGACAGAGCTGAGCTATCTACCCCTGCAGATTGGAAGCAT TACAGGCACTCAAGATCAGCCCTGAAGTGATAAAACCTAAGGCAGAAATCCACCAAGACTAGCAGTGCCTCCGTGTC TCTTCCTGTGGCTGGTGGGAAAGGGAGGGGCAGTCCTTCCTTGATGCAAGGTCGTGTGTCTAGTGGCATGCTTGCTT CATTCCCAGTGAGAGCAAGTGATCACCTGGGTAAGGAAGGTTCAGGTGCCTGAGCTTGCTGGAGAATTCATCACTCA TCCATCACTCTGCTCCTGTAGACATAATCACTTCTGTTGGGTCTTTATAGAGATGATTTATAACTTTGTTGTTTATA GTTTTTATGAATGTGTGTATTCATTTAGGTCACATGGGAGGTGCACATTTTCAGGTGTCTGTCTTTCCATCACACGG GCTTTGAATTAAACTCAGTCTTGGTTTTACCGGCTGAGCCATCTCACCTGCCTGATTATTTAAAAATCTCCGGAGTA ATCCAAGAGTGTGGTTTATGATTGTAGTATCAACACTCGGGAGGCTGAGGGAGCATCGTTATCATGAGCTCCAGGCT AGTTCCAGGCTTGCCTAAGCTGTAGAGCAAGTCACTCTCTTAAAAAGTGCCTCTCCCATATTTTTGTATATAATTTG CATCTGAAATTCTGTTTGCCAATAACTATGAAATTATTCACATTACTAAAATCTTCCTGTGCCAAGTTCTCCAACGA ATTAGATCACACTCAGATGAAATGCTAATAAAAATTAAAGCTGTAGCCAGTAGCATGCGTATATTTGGGCTCAGGGC CAACAGGCAGGCGATCTGGGTGTAAGAAAATAGGCTAATGGCTGTGGAATCTGGTCTCTAGTGGCTCCGCTGAGAGC TGACCTCAACCACGCTCCCTCAAATTGATTGCCTTCCAGGTTATGATTTCTCATCACAGGAAACTTTGTTGCCCAAT TCAAACCCTGTGAGTGAAAACAAAAACAGGAGAGCAAGTGCTGCTCCCCGTGCCCCAAAGCCCCTTCTGTCAGGGAT CCCAAATGCACCCCAGAGAACAGCTTAGCCTGCAAGGGCTGGTCCTCATCGCATACCATACATAGGTGGAGGGCTTG TTATTCAATTCCTGGCCTATGAGAGGATACCCCTATTGTTCCTGAAAATGCTGACCAGGACCTTACTTGTAACAAAG ATCCCTCTGCCCCACAATCCAGTTAAGGCAGGAGCAGGAGCCGGAGCAGGAGCAGAAGATAAGCCTTGGATGAAGGG CAAGATGGATAGGGCTCGCTCTGCCCCAAGCCCTGCTGATACCAAGTGCCTTTAAGATACAGCCTTTCCCATCCTAA TCTGCAAAGGAAACAGGAAAAAGGAACTTAACCCTCCCTGTGCTCAGACAGAAATGAGACTGTTACCGCCTGCTTCT GTGGTGTTTCTCCTTGCCGCCAACTTGTAAACAAGAGCGAGTGGACCATGCGAGCGGGAAGTCGCAAAGTTGTGAGT TGTTGAA。

The sequence of Kozak is needed for eucaryote transcription described in step (1)：

AGCCTCACCACCATC。

The total order of PyMT genes described in step (1) is classified as：

ATGGATAGAGTTCTGAGCAGAGCTGACAAAGAAAGGCTGCTAGAACTTCTAAAACT

TCCCAGACAACTATGGGGGGATTTTGGAAGAATGCAGCAGGCATATAAGCAGCAGT

CACTGCTACTGCACCCAGACAAAGGTGGAAGCCATGCCTTAATGCAGGAATTGAAC

AGTCTCTGGGGAACATTTAAAACTGAAGTATACAATCTGAGAATGAATCTAGGAGGAACCGGCTTCCAGGTAAGAAG GCTACATGCGGATGGGTGGAATCTAAGTACCAAAGACACCTTTGGTGATAGATACTACCAGCGGTTCTGCAGAATGC CTCTTACCTGCCTAGTAAATGTTAAATACAGCTCATGTAGTTGTATATTATGCCTGCTTAGAAAGCAACATAGAGAG CTCAAAGACAAATGTGATGCCAGGTGCCTAGTACTTGGAGAATGTTTTTGTCTTGAATGTTACATGCAATGGTTTGG AACACCAACCCGAGATGTGCTGAACCTGTATGCAGACTTCATTGCAAGCATGCCTATAGACTGGCTGGACCTGGATG TGCACAGCGTGTATAATCCAAAACGGCGGAGCGAGGAACTGAGGAGAGCGGCCACAGTCCACTACACGATGACTACT GGTCATTCAGCTATGGAAGCAAGTACTTCACAAGGGAATGGAATGATTTCTTCAGAAAGTGGGACCCCAGCTACCAG TCGCCGCCTAAGACTGCCGAGTCTTCTGAGCAACCCGACCTATTCTGTTATGAGGAGCCACTCCTATCCCCCAACCC GAGTTCTCCAACAGATACACCCGCACATACTGCTGGAAGAAGACGAAATCCTTGTGTTGCTGAGCCCGATGACAGCA TATCCCCGGACCCCCCCAGAACTCCTGTATCCAGAAAGCGACCAAGACCAGCTGGAGCCACTGGAGGAGGAGGAGGA GGAGTACATGCCAATGGAGGATCTGTATTTGGACATCCTACCGGGGGAACAAGTACCCCAGCTCATCCCCCCCCCTA TCATTCCCAGGGCGGGTCTGAGTCCATGGGAGGGTCTGATTCTTCGGGATTTGCAGAGGGCTCATTTCGATCCGATC CTAGATGCGAGTCAGAGAATGAGAGCTACTCACAGAGCTGCTCTCAGAGCTCATTCAATGCAACGCCACCTAAGAAG GCTAGGGAGGACCCTGCTCCTAGTGACTTTCCTAGCAGCCTTACTGGGTATTTGTCTCATGCTATTTATTCTAATAA AACGTTCCCGGCATTTCTAG。

The sequence of Tie2 enhancers described in step (1) is：

CTCGAGGTCCAGTATGGCTTCTCAACCTTCTTGGCAAGAAGGCTGCAGGGACGACCAGGAAGTTTGAAACAGTCTTA GAAGAAAATGCTGGCTTAGAGACAGGTGGCAATGGGGGATGGGGAGCAGTATTCTGGTTTGCATAGAGGCAGAGTCC TTCCAAGTGCTGGGAAACAAGGCAGGAGGGCAGGGATAGAGCAAATGATGGCTCTGTATGTGTCCCTGTTCAGTTTG CATTTAATCTGAGCAAAATTTGGCTTTTGACATCTGCAACTCAAAAGAAGGTAATTAGGCAAATGACTGACACATAG ATATCTTAATAGTCAAGGAATTTTTTTTTTTTTTTTTTTTTGAAGAGTTAGCAGTCAGGGGATGGTAGAAACTGCAA AACCAATCCGTATTCTTTCTTGAGATTTTTAGACAGTTGATGCTACTAGCCACAAAAAGAGTTTTAAGTGGGAGGAG AGTAAGATGCAGGCACCAAGGTGACAGGCTCCAGGTCTGTAGCATTAGCTTACAGATGAGATTCTTTACAGAGAGCC AGGCAGCTGCATTGGCTAAAGCAGATCTGGGAGGGGGCCAGGAGATCAGCTGGCGGCACTCCCAGCCTCCAGGAAAG GCAACCCTTATTTCTGGAATTTTAAACTGATAACCCAATTCCCACCAGCCTGGCCAGGCTCTTCCTTAGCTCACATC ACAAACACAGAAGGATTGTTTTAGATGGAGTCATGCTTGATTCTTTCTATACCTACTTCCAAGACCAATTTTATAAA AGTTTATTTACCGCCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCATGGTATATATGGACGTCAGAGTTTGGTTCTC TCCTTCTGCAGTGTGGCTCTTAGAGATTGAACTCAGATCATGAGCAAGCACCTTGCTGCCTGCTATGTCCCTCCAGC AGTCTGACCATGTTCCTTCCCCCAAGATTGTGGAAGCTGGACTGAAGATCACAATCTGCCAGATGGGCAGAATCTTT ACTCTTTGGCACATTTGTTGCTGATGGGGAGTGAATACCCATGGGGACATGGCTGTCATGGTGTGGAAGTGATAGAA ATGAAAACATGTATGGATCTGTCACAGGAGCTGGTGAGGCTGATGGGTGTGTGGGTGGCCACTGTTTGCTCTCTGCT TGTCACAGCCTCTTGTTCAGGGCTTGATCAGGGAGGTGTGTGTGTGTGTGTGTGTGGTCACACCCATCTCAGCAGAT CTGTCAGCTTTCCCGCTTTTGTTAGAGGGTGATATCATGCTTCCTGGGGGGAGCTCTGGAAGACAATGAGCAGCCAC TTTCCTCTAGATACAATAGGCGGAGTCAGGAAGGTAGTATTGACATTGCTGGGGCCTAGGAGCTACTCACTGCTCGG TGGCCGTCAGATGGTGAACCGGCGTAACCTTGGCACACAGGCCTGGGCTGTACAAGGCGTCTGGCTGCAGGGCCAAA GAGGACTCCACCCTAGGGACAGGAGTACTTCAGACATCTGGGAATCTGGGATGGGTTTTAAAATTCAGATCCCAATA TAAAAAAACAACTCCCAAACAAACAGCAGCAATTAAAAAAAAAAAAAAAACCAGCCTCCCAAGTAAAACAATAATGG TAC。

The concrete operations that PCR described in step (3) is identified are：Rat-tail 0.3cm is taken, 450 μ l lysates and 10mg/ml are added 50 μ l of Proteinase K, 56 DEG C of digestion are overnight；Centrifuging and taking supernatant, absolute ethyl alcohol precipitation, the washing of 70% ethyl alcohol are dissolved after slightly drying In 200 μ l pure water；The upper design primer Midct2 and Midcl of Pymt, reaction condition are：After 95 DEG C of 3min denaturation, 95 DEG C of 30s, 60 DEG C of 30s, after 65 DEG C of 3min carry out 35 cycles, 65 DEG C of 10min, positive mice should amplify 260bp segments；

Murine genes type identification primer：

Identify sense primer GAACAAGTACCCCAGCTCATCCCCCCCCCTATCATTC；

Identify downstream primer CTAGAAATGCCGGGAACG.

The primary expression sites of angiomatoid phenotype described in step (3) are ear, tongue, skin, mucous membrane, the liver etc. of mouse Position.

The concrete operations for establishing hemangioma animal model described in step (4) are：Using above-mentioned transgenic mice as training The head for educating transgenic animals strain basis population builds mouse, mates with the normal mouse of same germline, obtains the sub- mouse of F1 generation；It will be above-mentioned The sub- mouse of F1 generation mates with the normal mouse of same germline, obtains F2 for sub- mouse.

The present invention uses the tissue-specific promoter Tie2 of vascular endothelial cell expression, control target gene PyMT turning Expression in genetic animal body is only limitted to blood vessel endothelium position.The hemangioma animal model that this kind of method makes, due to purpose base Because PyMT is only expressed in vascular endothelial cell, avoids it and induce generation malignant tumour, animal pattern table in its hetero-organization Type is single-minded, shows typical angiomatous change；Simultaneously as limiting expression range and water of the PyMT genes in embryo It is flat, hence it is evident that improve the embryotoxicity of PyMT genes, the quantity that the positive head that this method generates builds mouse (Founder mouse) is obviously high In conventional method；Also, the specific expressed target gene that avoids of chrotoplast gives birth to mouse to control PyMT genes in the blood vessels Grow the influence of ability, MOUSE REPRODUCTION ability increases compared with conventional method, can stablize passage, build and is, and offspring rat also has blood vessel Tumor phenotype.

The hemangioma transgenic mouse model animal that the present invention establishes can stablize passage and progeny genotypes animals showing positive Also it may occur in which angiomatoid neoformation phenotype.The PyMT that the animal mean survival time (5.5 months) controls compared with no promoter turns base Because animal (0.5 month) obviously increases.But the more common wild-type mice of the fecundity of animals showing positive is low, influences mouse It builds and is.This may be the influence for animals' reproduction cell due to transgenosis.

Advantageous effect：

(1) target gene PyMT is only expressed in vascular endothelial cell in the present invention, is avoided it and is lured in its hetero-organization Generation malignant tumour is led, animal pattern phenotype is single-minded, shows typical angiomatous change；

(2) due to limiting expression range and level of the PyMT genes in embryo, hence it is evident that improve the embryo of PyMT genes The skin infections of newborn infants, the quantity that the positive head that this method generates builds mouse (Founder mouse) are apparently higher than conventional method；

(3) control PyMT genes in the blood vessels the specific expressed target gene that avoids of chrotoplast for mouse propagation ability Influence, MOUSE REPRODUCTION ability increases compared with conventional method, can stablize passage, build and be, and offspring rat also has hemangioma phenotype.

Description of the drawings

The structure of the specifically expressed pGL3-PyMT gene plasmids of Fig. 1 vascular endothelial cells.

Fig. 2 transgenic animals substantially phenotype, in the skin parts such as ear and the centre of the palm, there are angiomatoid neoformations for arrow instruction.

Phenotype, histological change and the PyMT expression conditions of Fig. 3 transgenic animals hemangioma happening parts.

It is situation that the PyMT transgenosis hemangioma animals of Fig. 4 Tie2 promoters driving, which are built,.

The representative F1 and F2 mouse phenotypes of Fig. 5, arrow meaning are mouse ear angiomatoid neoformation.

Specific implementation mode

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.In addition, it should also be understood that, after reading the content taught by the present invention, people in the art Member can make various changes or modifications the present invention, and such equivalent forms equally fall within the application the appended claims and limited Range.

Embodiment 1

(1) structure (such as Fig. 1) of the specifically expressed PyMT gene plasmids of vascular endothelial cell.

PyMT gene plasmid construction methods

A. material

Plasmid and bacterial strain：Plasmid pGL3-Basic is purchased from Promega companies.D-H5 α are Tiangeng product.PPymt is purchased from ATCC。

Reagent：Various restriction enzymes, T4DNA ligases, T4DNA polymerase, Taq enzyme and PCR related reagents Purchased from Takara and NEB companies；Glue recycles Kit and is purchased from Tiangeng biotech firm；Plasmid extraction Kit is purchased from Qiagen companies；

Mouse：C57BL/6J mouse and transgenic mice are provided by Shanghai Nanfangmoshi Biological Sci-Tech Dev Co., Ltd. And breeding, all zooperies follow NIH formulations about animal feeding and the regulation used, and obtain Shanghai south pattern The approval of administration committee is raised and used to biological study central animals.

Primer：By Shanghai, handsome biotech firm synthesizes

Structure primer：

Tie2 promoter sense primers catggtaccgcggaagcttactaagatctaatgaaaatc

Tie2 promoter downstream primers catgtcgacTTCAACAACTCACAACTTTGCG

Pymt sense primers catctcgagagcctcaccaccatcATGGATAGAGTTCT

GAGCAGAG

Pymt downstream primers catgctagcCTAGAAATGCCGGGAACG

Carrier junction fragment sense primer GTGTAATTCTAGAGTCGGGGC

Carrier junction fragment downstream primer CGACGGATCCTTATCGATTTTACC

Tie2 enhancer sense primers catatcgatctcgaggtccagtatggcttc

Tie2 enhancer downstream primers catgtcgacgtaccattattgttttacttgggagg

B. method：The structure of transgenosis plasmid：Using rat-tail DNA as template, difference PCR amplification Tie2 promoters (2086bp), Tie2 enhancers (1620bp), using pPymt as template PCR amplifications PyMT full length genes (1266bp), with pGL3- Basic is template amplification A (260bp).PCR system is：Template DNA：1 μ l, 5*PrimeSTAR buffer：4 μ l, dNTP：1μ L, Primer mix：2 μ l, PrimeSTAR HS DNA Polymerase：0.2 μ l, dH2O：11.8μl.Response procedures are：95 DEG C 3min, 98 DEG C of 15sec, 55 DEG C of -68 DEG C of 15sec, 72 DEG C of 1min30sec, 72 DEG C of 5min, 35 cycles.With KpnI and SalI Digestion Tie2 promoter sequences, XhoI and NheI digestion PyMT gene orders, XbaI and ClaI digestion carrier junction fragment sequences, ClaI and SalI digestion Tie2 enhancers, are consecutively connected on pGL3-Basic carriers.It is finally carried by digestion and sequence verification Body.

C. result：In Pymt, TIE2 promotor, TIE2 enhancer gene clonings to pGL3 carriers, through digestion and Sequence analysis confirms that each constituent element is correct, and reading frame is correct.Transgenosis plasmid construct is shown in Fig. 1.

The plasmid includes the specifically expressed promoter Tie2 of vascular endothelial cell, the required Kozak sequences of eucaryote transcription Row), on PyMT gene complete sequences are shown in, SV40polyA signals (plasmid is included), Tie2 enhancer sequences.

(2) preparation of transgenic mice：Turn said gene plasmid with PvuI digestions (Takara companies, Dalian), recycles The DNA fragmentation of 7.0kb is used for microinjection.Take after the super row of 5-6 week old C57BL/6J female mices with sexually matured C57BL/6J heros mouse Mating is selected and sees that bolt mouse takes fertilized eggs, cultivates in M16 culture solutions, Plasmid DNA after purification is dissolved in TE buffer solutions, dense Degree is that DNA is injected into the male pronucleus of fertilized eggs by 5ng/ μ l using M2 as manipulation in vitro liquid, and the zygote transplation after injection arrives About 25 pieces of ovum is moved in the fallopian tubal of 0.5 day false pregnancy mouse, every false pregnancy mouse fallopian tubal unilateral side.

The preparation of mouse genome：False pregnancy mouse raising after transplanting waits for that newborn mouse is born 10 days or so and cuts in SPF grades of animal houses Rat-tail 0.3cm is taken, adds 450 μ l lysates and 50 μ l Proteinase Ks (10mg/ml), 56 DEG C of digestion are overnight.Centrifuging and taking supernatant, it is anhydrous Ethanol precipitation, 70% ethyl alcohol washing, is dissolved in after slightly drying in 200 μ l pure water.

PCR identifies transgenic positive mouse：The upper design primer Midct2 and Midcl of Pymt, reaction condition are：95 DEG C of 3min become Property after, 95 DEG C of 30s, 60 DEG C of 30s, after 65 DEG C of 3min carry out 35 cycles, 65 DEG C of 10min, positive mice should amplify 260bp pieces Section

Murine genes type identification primer：

Identify sense primer GAACAAGTACCCCAGCTCATCCCCCCCCC

TATCATTC

Identify downstream primer CTAGAAATGCCGGGAACG

Transgenic animals microinjection and Birth Situation：Using C57BL/6 Strains of Mouse (in Chinese Academy of Sciences Shanghai experimental animal The heart) it is used as transgenic models animal.440 pieces of fertilized eggs are injected, be born transgenic animals 82, and wherein genotype identification is the positive Transgenosis head build mouse 7, animal birth rate (birth number of animals/injection fertilized eggs number) 18.6%, the gross efficiency (sun of transgenosis Property offspring animal/injection fertilized eggs sums) be 1.6%.Compared with the PyMT transgenic animals that no promoter controls, using Tie2 Promoter controls the strategy of destination gene expression, and animal birth rate increases by 3.9 times, and the gross efficiency of transgenic animals increases by 2.7 Times (it reports before, the PyMT transgenic animals birth rates of no promoter control are 4.8%, and transgenosis gross efficiency is 0.5%, Transgenic Res(2009)18:399–406).Should the result shows that, using promoter regulation express PyMT genes, embryo The gene that tire lethal and embryotoxicity are controlled compared with no promoter is decreased obviously, to help to obtain more animals showing positives.

(3) phenotype of transgenic animals：Murine genes type of being born is identified through PCR confirms 7 positive transgenic mices, There is angiomatoid phenotype (Fig. 2).Neoformation primary expression sites are in the positions such as the ear of mouse, tongue, skin, mucous membrane, liver, tissue It learns inspection and turns out to be angiomatous change, immunohistochemical method identification confirms that PyMT is expressed at neoplastic endothelial cell position Albumen (Fig. 3).It confirms, will not interfere transgenic animals that hemangioma phenotype occurs using Tie2 promoters control strategy.

(4) it the survival of transgenic animals and builds and is：It is that 7 positive transgenosis head build mouse as training using genotype identification Educate the basic population of transgenic animals strain.Head is built mouse to mate with the C57BL/6 normal mouses of same germline, obtains F1 generation Mouse, rat-tail DNA is prepared and genotype identification, it was demonstrated that and establish the positive F1 generation mouse of 3 strains, the F1 generation mouse of 3 strains It mates with same germline normal mouse, through genotype identification, obtains F2 for sub- mouse (Fig. 4), F1 generation is with F2 for mouse phenotype and head It is similar to build mouse, in skin, mucosa visible vessels tumor sample neoformation (Fig. 5).It confirms to obtain using the transgenic method of this strategy The animal phenotype obtained can stablize passage.

SEQUENCE LISTING

<110>Shanghai Ninth People's Hospital Affiliated to Shanghai Jiao Tong University Sch

<120>A kind of hemangioma animal model builds system, method

<130>12

<160>14

<170>PatentIn version 3.3

<210>1

<211>39

<212>DNA

<213>Tie2 promoters

<400>1

catggtaccg cggaagctta ctaagatcta atgaaaatc 39

<210>2

<211>31

<212>DNA

<213>Tie2 promoters

<400>2

catgtcgact tcaacaactc acaactttgc g 31

<210>3

<211>46

<212>DNA

<213>Pymt

<400>3

catctcgaga gcctcaccac catcatggat agagttctga gcagag 46

<210>4

<211>27

<212>DNA

<213>Pymt

<400>4

catgctagcc tagaaatgcc gggaacg 27

<210>5

<211>21

<212>DNA

<213>Carrier junction fragment

<400>5

gtgtaattct agagtcgggg c 21

<210>6

<211>24

<212>DNA

<213>Carrier junction fragment

<400>6

cgacggatcc ttatcgattt tacc 24

<210>7

<211>30

<212>DNA

<213>Tie2 enhancers

<400>7

catatcgatc tcgaggtcca gtatggcttc 30

<210>8

<211>35

<212>DNA

<213>Tie2 enhancers

<400>8

catgtcgacg taccattatt gttttacttg ggagg 35

<210>9

<211>2086

<212>DNA

<213>Promoter Tie2

<400>9

aagcttacta agatctaatg aaaatcaaga tgttaggcac agtgccagat actttaacat 60

agtaatatga ctctttagag ttttgagaca gggcctcata tagtttatga tgaattcact 120

gttttgtcaa agatgacctt gaactcttaa tccattccca aagtgttgtt gtcatatgtt 180

tgcaccactc ctggcttcat agtgttttta aaacacccat ggagagtcgg gtgtgaagat 240

ccacacgtct aacctcagca tctggtgaat caaggcagga gggcgggtgg ttgcaggctg 300

gctataatat ctaagtttca gttagtaagg gctgcataat gaaacactgt cttaaacaca 360

aaaccaaaac ccatgaagga gatactattg ccatttaaaa gtctctggaa tggaaatagc 420

tatcataatc ttacctctga gccagtgtct gccctcaggt gtgcctgagg actgaacagg 480

gctatgcact cctcaggttg gaaacattac tagtcctcag tgtctgctct tgacctgtta 540

acagctgagt cagggtctgc cctcagctgt gcctgaggac agagctgagc tatctacccc 600

tgcagattgg aagcattaca ggcactcaag atcagccctg aagtgataaa acctaaggca 660

gaaatccacc aagactagca gtgcctccgt gtctcttcct gtggctggtg ggaaagggag 720

gggcagtcct tccttgatgc aaggtcgtgt gtctagtggc atgcttgctt cattcccagt 780

gagagcaagt gatcacctgg gtaaggaagg ttcaggtgcc tgagcttgct ggagaattca 840

tcactcatcc atcactctgc tcctgtagac ataatcactt ctgttgggtc tttatagaga 900

tgatttataa ctttgttgtt tatagttttt atgaatgtgt gtattcattt aggtcacatg 960

ggaggtgcac attttcaggt gtctgtcttt ccatcacacg ggctttgaat taaactcagt 1020

cttggtttta ccggctgagc catctcacct gcctgattat ttaaaaatct ccggagtaat 1080

ccaagagtgt ggtttatgat tgtagtatca acactcggga ggctgaggga gcatcgttat 1140

catgagctcc aggctagttc caggcttgcc taagctgtag agcaagtcac tctcttaaaa 1200

agtgcctctc ccatattttt gtatataatt tgcatctgaa attctgtttg ccaataacta 1260

tgaaattatt cacattacta aaatcttcct gtgccaagtt ctccaacgaa ttagatcaca 1320

ctcagatgaa atgctaataa aaattaaagc tgtagccagt agcatgcgta tatttgggct 1380

cagggccaac aggcaggcga tctgggtgta agaaaatagg ctaatggctg tggaatctgg 1440

tctctagtgg ctccgctgag agctgacctc aaccacgctc cctcaaattg attgccttcc 1500

aggttatgat ttctcatcac aggaaacttt gttgcccaat tcaaaccctg tgagtgaaaa 1560

caaaaacagg agagcaagtg ctgctccccg tgccccaaag ccccttctgt cagggatccc 1620

aaatgcaccc cagagaacag cttagcctgc aagggctggt cctcatcgca taccatacat 1680

aggtggaggg cttgttattc aattcctggc ctatgagagg atacccctat tgttcctgaa 1740

aatgctgacc aggaccttac ttgtaacaaa gatccctctg ccccacaatc cagttaaggc 1800

aggagcagga gccggagcag gagcagaaga taagccttgg atgaagggca agatggatag 1860

ggctcgctct gccccaagcc ctgctgatac caagtgcctt taagatacag cctttcccat 1920

cctaatctgc aaaggaaaca ggaaaaagga acttaaccct ccctgtgctc agacagaaat 1980

gagactgtta ccgcctgctt ctgtggtgtt tctccttgcc gccaacttgt aaacaagagc 2040

gagtggacca tgcgagcggg aagtcgcaaa gttgtgagtt gttgaa 2086

<210>10

<211>15

<212>DNA

<213>The sequence of Kozak

<400>10

agcctcacca ccatc 15

<210>11

<211>1266

<212>DNA

<213>PyMT genes

<400>11

atggatagag ttctgagcag agctgacaaa gaaaggctgc tagaacttct aaaacttccc 60

agacaactat ggggggattt tggaagaatg cagcaggcat ataagcagca gtcactgcta 120

ctgcacccag acaaaggtgg aagccatgcc ttaatgcagg aattgaacag tctctgggga 180

acatttaaaa ctgaagtata caatctgaga atgaatctag gaggaaccgg cttccaggta 240

agaaggctac atgcggatgg gtggaatcta agtaccaaag acacctttgg tgatagatac 300

taccagcggt tctgcagaat gcctcttacc tgcctagtaa atgttaaata cagctcatgt 360

agttgtatat tatgcctgct tagaaagcaa catagagagc tcaaagacaa atgtgatgcc 420

aggtgcctag tacttggaga atgtttttgt cttgaatgtt acatgcaatg gtttggaaca 480

ccaacccgag atgtgctgaa cctgtatgca gacttcattg caagcatgcc tatagactgg 540

ctggacctgg atgtgcacag cgtgtataat ccaaaacggc ggagcgagga actgaggaga 600

gcggccacag tccactacac gatgactact ggtcattcag ctatggaagc aagtacttca 660

caagggaatg gaatgatttc ttcagaaagt gggaccccag ctaccagtcg ccgcctaaga 720

ctgccgagtc ttctgagcaa cccgacctat tctgttatga ggagccactc ctatccccca 780

acccgagttc tccaacagat acacccgcac atactgctgg aagaagacga aatccttgtg 840

ttgctgagcc cgatgacagc atatccccgg acccccccag aactcctgta tccagaaagc 900

gaccaagacc agctggagcc actggaggag gaggaggagg agtacatgcc aatggaggat 960

ctgtatttgg acatcctacc gggggaacaa gtaccccagc tcatcccccc ccctatcatt 1020

cccagggcgg gtctgagtcc atgggagggt ctgattcttc gggatttgca gagggctcat 1080

ttcgatccga tcctagatgc gagtcagaga atgagagcta ctcacagagc tgctctcaga 1140

gctcattcaa tgcaacgcca cctaagaagg ctagggagga ccctgctcct agtgactttc 1200

ctagcagcct tactgggtat ttgtctcatg ctatttattc taataaaacg ttcccggcat 1260

ttctag 1266

<210>12

<211>1620

<212>DNA

<213>Tie2 enhancers

<400>12

ctcgaggtcc agtatggctt ctcaaccttc ttggcaagaa ggctgcaggg acgaccagga 60

agtttgaaac agtcttagaa gaaaatgctg gcttagagac aggtggcaat gggggatggg 120

gagcagtatt ctggtttgca tagaggcaga gtccttccaa gtgctgggaa acaaggcagg 180

agggcaggga tagagcaaat gatggctctg tatgtgtccc tgttcagttt gcatttaatc 240

tgagcaaaat ttggcttttg acatctgcaa ctcaaaagaa ggtaattagg caaatgactg 300

acacatagat atcttaatag tcaaggaatt tttttttttt tttttttttg aagagttagc 360

agtcagggga tggtagaaac tgcaaaacca atccgtattc tttcttgaga tttttagaca 420

gttgatgcta ctagccacaa aaagagtttt aagtgggagg agagtaagat gcaggcacca 480

aggtgacagg ctccaggtct gtagcattag cttacagatg agattcttta cagagagcca 540

ggcagctgca ttggctaaag cagatctggg agggggccag gagatcagct ggcggcactc 600

ccagcctcca ggaaaggcaa cccttatttc tggaatttta aactgataac ccaattccca 660

ccagcctggc caggctcttc cttagctcac atcacaaaca cagaaggatt gttttagatg 720

gagtcatgct tgattctttc tatacctact tccaagacca attttataaa agtttattta 780

ccgccgtgtg tgtgtgtgtg tgtgtgtgtg tgtgcatggt atatatggac gtcagagttt 840

ggttctctcc ttctgcagtg tggctcttag agattgaact cagatcatga gcaagcacct 900

tgctgcctgc tatgtccctc cagcagtctg accatgttcc ttcccccaag attgtggaag 960

ctggactgaa gatcacaatc tgccagatgg gcagaatctt tactctttgg cacatttgtt 1020

gctgatgggg agtgaatacc catggggaca tggctgtcat ggtgtggaag tgatagaaat 1080

gaaaacatgt atggatctgt cacaggagct ggtgaggctg atgggtgtgt gggtggccac 1140

tgtttgctct ctgcttgtca cagcctcttg ttcagggctt gatcagggag gtgtgtgtgt 1200

gtgtgtgtgt ggtcacaccc atctcagcag atctgtcagc tttcccgctt ttgttagagg 1260

gtgatatcat gcttcctggg gggagctctg gaagacaatg agcagccact ttcctctaga 1320

tacaataggc ggagtcagga aggtagtatt gacattgctg gggcctagga gctactcact 1380

gctcggtggc cgtcagatgg tgaaccggcg taaccttggc acacaggcct gggctgtaca 1440

aggcgtctgg ctgcagggcc aaagaggact ccaccctagg gacaggagta cttcagacat 1500

ctgggaatct gggatgggtt ttaaaattca gatcccaata taaaaaaaca actcccaaac 1560

aaacagcagc aattaaaaaa aaaaaaaaaa ccagcctccc aagtaaaaca ataatggtac 1620

<210>13

<211>37

<212>DNA

<213>Murine genes type identification sense primer

<400>13

gaacaagtac cccagctcat ccccccccct atcattc 37

<210>14

<211>18

<212>DNA

<213>Murine genes type identification downstream primer

<400>14

ctagaaatgc cgggaacg 18

Claims (9)

1. a kind of hemangioma animal model builds system, method, including：

(1) structure of the specifically expressed PyMT gene plasmids of vascular endothelial cell；

In the plasmid comprising Kozak sequences needed for the specifically expressed promoter Tie2 of vascular endothelial cell, eucaryote transcription, PyMT genes complete sequence, SV40polyA signals and Tie2 enhancer sequences；

(2) the above-mentioned plasmid built is recycled into the DNA fragmentation of 7.0kb through PvuI linearization for enzyme restriction；Then by above-mentioned DNA pieces Section is injected into the male pronucleus of fertilized eggs, then is transplanted in the fallopian tubal of 0.5 day false pregnancy mouse, and mouse is obtained；

(3) mouse of birth is subjected to PCR identifications；

(4) transgenic mice after identifying step (3) is built mouse as the head for cultivating transgenic animals strain basis population and is established Hemangioma animal model.

2. hemangioma animal model according to claim 1 builds system, method, it is characterised in that：Described in step (1) The concrete operation method of vascular endothelial cell specifically expressed PyMT gene plasmids structure is：

Using rat-tail DNA as template, difference PCR amplification Tie2 promoters, Tie2 enhancers, using pPymt as template PCR amplifications PyMT Full length gene；PCR system is：Template DNA：1 μ l, 5xPCR buffer solutions：4 μ l, triphosphoric acid dezyribonucleoside：1 μ l, PCR primer Mixture：2 μ l, PCR polymerases：0.2 μ l, distilled water：11.8μl；Response procedures are：95 DEG C 3 minutes, 98 DEG C 15 seconds, 55 DEG C- 68 DEG C 15 seconds, 72 DEG C 90 seconds, 72 DEG C 5 minutes, 35 cycle；With KpnI and SalI digestion Tie2 promoter sequences, XhoI and NheI digestion PyMT gene orders, XbaI and ClaI digestion carrier junction fragment sequences, ClaI and SalI digestion Tie2 enhancers, It is consecutively connected on pGL3-Basic carriers；

Above-mentioned structure primer is as follows：

Tie2 promoter sense primers catggtaccgcggaagcttactaagatctaatgaaaatc；

Tie2 promoter downstream primers catgtcgacTTCAACAACTCACAACTTTGCG；

Pymt sense primers catctcgagagcctcaccaccatcATGGATAGAGTTCTGAGCAGAG；

Pymt downstream primers catgctagcCTAGAAATGCCGGGAACG；

Carrier junction fragment sense primer GTGTAATTCTAGAGTCGGGGC；

Carrier junction fragment downstream primer CGACGGATCCTTATCGATTTTACC；

Tie2 enhancer sense primers catatcgatctcgaggtccagtatggcttc；

Tie2 enhancer downstream primers catgtcgacgtaccattattgttttacttgggagg.

3. hemangioma animal model according to claim 2 builds system, method, it is characterised in that：The system of the rat-tail DNA It is standby as follows：The C57BL/6J mouse rat-tail 0.3cm for taking out raw 10 days, add 450 μ l lysates and the 50 μ l Proteinase Ks of 10mg/ml, 56 DEG C of digestion are overnight；Centrifuging and taking supernatant, absolute ethyl alcohol precipitation, the washing of 70% ethyl alcohol are dissolved in 200 μ l pure water after slightly drying In, you can.

4. hemangioma animal model according to claim 1 builds system, method, it is characterised in that：Described in step (1) The sequence of the specifically expressed promoter Tie2 of vascular endothelial cell is：

AAGCTTACTAAGATCTAATGAAAATCAAGATGTTAGGCACAGTGCCAGATACTTTAACATAGTAATATGACTC TTTAGAGTTTTGAGACAGGGCCTCATATAGTTTATGATGAATTCACTGTTTTGTCAAAGATGACCTTGAACTCTTAA TCCATTCCCAAAGTGTTGTTGTCATATGTTTGCACCACTCCTGGCTTCATAGTGTTTTTAAAACACCCATGGAGAGT CGGGTGTGAAGATCCACACGTCTAACCTCAGCATCTGGTGAATCAAGGCAGGAGGGCGGGTGGTTGCAGGCTGGCTA TAATATCTAAGTTTCAGTTAGTAAGGGCTGCATAATGAAACACTGTCTTAAACACAAAACCAAAACCCATGAAGGAG ATACTATTGCCATTTAAAAGTCTCTGGAATGGAAATAGCTATCATAATCTTACCTCTGAGCCAGTGTCTGCCCTCAG GTGTGCCTGAGGACTGAACAGGGCTATGCACTCCTCAGGTTGGAAACATTACTAGTCCTCAGTGTCTGCTCTTGACC TGTTAACAGCTGAGTCAGGGTCTGCCCTCAGCTGTGCCTGAGGACAGAGCTGAGCTATCTACCCCTGCAGATTGGAA GCATTACAGGCACTCAAGATCAGCCCTGAAGTGATAAAACCTAAGGCAGAAATCCACCAAGACTAGCAGTGCCTCCG TGTCTCTTCCTGTGGCTGGTGGGAAAGGGAGGGGCAGTCCTTCCTTGATGCAAGGTCGTGTGTCTAGTGGCATGCTT GCTTCATTCCCAGTGAGAGCAAGTGATCACCTGGGTAAGGAAGGTTCAGGTGCCTGAGCTTGCTGGAGAATTCATCA CTCATCCATCACTCTGCTCCTGTAGACATAATCACTTCTGTTGGGTCTTTATAGAGATGATTTATAACTTTGTTGTT TATAGTTTTTATGAATGTGTGTATTCATTTAGGTCACATGGGAGGTGCACATTTTCAGGTGTCTGTCTTTCCATCAC ACGGGCTTTGAATTAAACTCAGTCTTGGTTTTACCGGCTGAGCCATCTCACCTGCCTGATTATTTAAAAATCTCCGG AGTAATCCAAGAGTGTGGTTTATGATTGTAGTATCAACACTCGGGAGGCTGAGGGAGCATCGTTATCATGAGCTCCA GGCTAGTTCCAGGCTTGCCTAAGCTGTAGAGCAAGTCACTCTCTTAAAAAGTGCCTCTCCCATATTTTTGTATATAA TTTGCATCTGAAATTCTGTTTGCCAATAACTATGAAATTATTCACATTACTAAAATCTTCCTGTGCCAAGTTCTCCA ACGAATTAGATCACACTCAGATGAAATGCTAATAAAAATTAAAGCTGTAGCCAGTAGCATGCGTATATTTGGGCTCA GGGCCAACAGGCAGGCGATCTGGGTGTAAGAAAATAGGCTAATGGCTGTGGAATCTGGTCTCTAGTGGCTCCGCTGA GAGCTGACCTCAACCACGCTCCCTCAAATTGATTGCCTTCCAGGTTATGATTTCTCATCACAGGAAACTTTGTTGCC CAATTCAAACCCTGTGAGTGAAAACAAAAACAGGAGAGCAAGTGCTGCTCCCCGTGCCCCAAAGCCCCTTCTGTCAG GGATCCCAAATGCACCCCAGAGAACAGCTTAGCCTGCAAGGGCTGGTCCTCATCGCATACCATACATAGGTGGAGGG CTTGTTATTCAATTCCTGGCCTATGAGAGGATACCCCTATTGTTCCTGAA AATGCTGACCAGGACCTTACTTGTAACAAAGATCCCTCTGCCCCACAATCCAGTTAAGGCAGGAGCAGGAGCCGGAG CAGGAGCAGAAGATAAGCCTTGGATGAAGGGCAAGATGGATAGGGCTCGCTCTGCCCCAAGCCCTGCTGATACCAAG TGCCTTTAAGATACAGCCTTTCCCATCCTAATCTGCAAAGGAAACAGGAAAAAGGAACTTAACCCTCCCTGTGCTCA GACAGAAATGAGACTGTTACCGCCTGCTTCTGTGGTGTTTCTCCTTGCCGCCAACTTGTAAACAAGAGCGAGTGGAC CATGCGAGCGGGAAGTCGCAAAGTTGTGAGTTGTTGAA。

5. hemangioma animal model according to claim 1 builds system, method, it is characterised in that：Described in step (1) The sequence of Kozak is needed for eucaryote transcription：AGCCTCACCACCATC；

The total order of PyMT genes described in step (1) is classified as：

ATGGATAGAGTTCTGAGCAGAGCTGACAAAGAAAGGCTGCTAGAACTTCTAAAACTTCCCAGACAACTATGGG GGGATTTTGGAAGAATGCAGCAGGCATATAAGCAGCAGTCACTGCTACTGCACCCAGACAAAGGTGGAAGCCATGCC TTAATGCAGGAATTGAACAGTCTCTGGGGAACATTTAAAACTGAAGTATACAATCTGAGAATGAATCTAGGAGGAAC CGGCTTCCAGGTAAGAAGGCTACATGCGGATGGGTGGAATCTAAGTACCAAAGACACCTTTGGTGATAGATACTACC AGCGGTTCTGCAGAATGCCTCTTACCTGCCTAGTAAATGTTAAATACAGCTCATGTAGTTGTATATTATGCCTGCTT AGAAAGCAACATAGAGAGCTCAAAGACAAATGTGATGCCAGGTGCCTAGTACTTGGAGAATGTTTTTGTCTTGAATG TTACATGCAATGGTTTGGAACACCAACCCGAGATGTGCTGAACCTGTATGCAGACTTCATTGCAAGCATGCCTATAG ACTGGCTGGACCTGGATGTGCACAGCGTGTATAATCCAAAACGGCGGAGCGAGGAACTGAGGAGAGCGGCCACAGTC CACTACACGATGACTACTGGTCATTCAGCTATGGAAGCAAGTACTTCACAAGGGAATGGAATGATTTCTTCAGAAAG TGGGACCCCAGCTACCAGTCGCCGCCTAAGACTGCCGAGTCTTCTGAGCAACCCGACCTATTCTGTTATGAGGAGCC ACTCCTATCCCCCAACCCGAGTTCTCCAACAGATACACCCGCACATACTGCTGGAAGAAGACGAAATCCTTGTGTTG CTGAGCCCGATGACAGCATATCCCCGGACCCCCCCAGAACTCCTGTATCCAGAAAGCGACCAAGACCAGCTGGAGCC ACTGGAGGAGGAGGAGGAGGAGTACATGCCAATGGAGGATCTGTATTTGGACATCCTACCGGGGGAACAAGTACCCC AGCTCATCCCCCCCCCTATCATTCCCAGGGCGGGTCTGAGTCCATGGGAGGGTCTGATTCTTCGGGATTTGCAGAGG GCTCATTTCGATCCGATCCTAGATGCGAGTCAGAGAATGAGAGCTACTCACAGAGCTGCTCTCAGAGCTCATTCAAT GCAACGCCACCTAAGAAGGCTAGGGAGGACCCTGCTCCTAGTGACTTTCCTAGCAGCCTTACTGGGTATTTGTCTCA TGCTATTTATTCTAATAAAACGTTCCCGGCATTTCTAG。

6. hemangioma animal model according to claim 1 builds system, method, it is characterised in that：Described in step (1) The sequence of Tie2 enhancers is：

CTCGAGGTCCAGTATGGCTTCTCAACCTTCTTGGCAAGAAGGCTGCAGGGACGACCAGGAAGTTTGAAACAGT CTTAGAAGAAAATGCTGGCTTAGAGACAGGTGGCAATGGGGGATGGGGAGCAGTATTCTGGTTTGCATAGAGGCAGA GTCCTTCCAAGTGCTGGGAAACAAGGCAGGAGGGCAGGGATAGAGCAAATGATGGCTCTGTATGTGTCCCTGTTCAG TTTGCATTTAATCTGAGCAAAATTTGGCTTTTGACATCTGCAACTCAAAAGAAGGTAATTAGGCAAATGACTGACAC ATAGATATCTTAATAGTCAAGGAATTTTTTTTTTTTTTTTTTTTTGAAGAGTTAGCAGTCAGGGGATGGTAGAAACT GCAAAACCAATCCGTATTCTTTCTTGAGATTTTTAGACAGTTGATGCTACTAGCCACAAAAAGAGTTTTAAGTGGGA GGAGAGTAAGATGCAGGCACCAAGGTGACAGGCTCCAGGTCTGTAGCATTAGCTTACAGATGAGATTCTTTACAGAG AGCCAGGCAGCTGCATTGGCTAAAGCAGATCTGGGAGGGGGCCAGGAGATCAGCTGGCGGCACTCCCAGCCTCCAGG AAAGGCAACCCTTATTTCTGGAATTTTAAACTGATAACCCAATTCCCACCAGCCTGGCCAGGCTCTTCCTTAGCTCA CATCACAAACACAGAAGGATTGTTTTAGATGGAGTCATGCTTGATTCTTTCTATACCTACTTCCAAGACCAATTTTA TAAAAGTTTATTTACCGCCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCATGGTATATATGGACGTCAGAGTTTGGT TCTCTCCTTCTGCAGTGTGGCTCTTAGAGATTGAACTCAGATCATGAGCAAGCACCTTGCTGCCTGCTATGTCCCTC CAGCAGTCTGACCATGTTCCTTCCCCCAAGATTGTGGAAGCTGGACTGAAGATCACAATCTGCCAGATGGGCAGAAT CTTTACTCTTTGGCACATTTGTTGCTGATGGGGAGTGAATACCCATGGGGACATGGCTGTCATGGTGTGGAAGTGAT AGAAATGAAAACATGTATGGATCTGTCACAGGAGCTGGTGAGGCTGATGGGTGTGTGGGTGGCCACTGTTTGCTCTC TGCTTGTCACAGCCTCTTGTTCAGGGCTTGATCAGGGAGGTGTGTGTGTGTGTGTGTGTGGTCACACCCATCTCAGC AGATCTGTCAGCTTTCCCGCTTTTGTTAGAGGGTGATATCATGCTTCCTGGGGGGAGCTCTGGAAGACAATGAGCAG CCACTTTCCTCTAGATACAATAGGCGGAGTCAGGAAGGTAGTATTGACATTGCTGGGGCCTAGGAGCTACTCACTGC TCGGTGGCCGTCAGATGGTGAACCGGCGTAACCTTGGCACACAGGCCTGGGCTGTACAAGGCGTCTGGCTGCAGGGC CAAAGAGGACTCCACCCTAGGGACAGGAGTACTTCAGACATCTGGGAATCTGGGATGGGTTTTAAAATTCAGATCCC AATATAAAAAAACAACTCCCAAACAAACAGCAGCAATTAAAAAAAAAAAAAAAACCAGCCTCCCAAGTAAAACAATA ATGGTAC。

7. hemangioma animal model according to claim 1 builds system, method, it is characterised in that：Fertilized eggs in step (2) Preparation method be：It mates with sexually matured C57BL/6J heros mouse after taking the super row of 5-6 week old C57BL/6J female mices, selects and see bolt Mouse takes fertilized eggs, cultivates in M16 culture solutions.

8. hemangioma animal model according to claim 1 builds system, method, it is characterised in that：Described in step (3) The concrete operations that PCR is identified are：Rat-tail 0.3cm is taken, 450 μ l lysates and the 50 μ l of Proteinase K of 10mg/ml, 56 DEG C of digestion are added Overnight；Centrifuging and taking supernatant, absolute ethyl alcohol precipitation, the washing of 70% ethyl alcohol are dissolved in after slightly drying in 200 μ l pure water；It is set on Pymt Primer Midct2 and Midcl are counted, reaction condition is：After 95 DEG C of 3min denaturation, 95 DEG C of 30s, 60 DEG C of 30s, 65 DEG C of 3min carry out 35 After a cycle, 65 DEG C of 10min, positive mice should amplify 260bp segments；

Murine genes type identification primer：

Identify sense primer GAACAAGTACCCCAGCTCATCCCCCCCCCTATCATTC；

Identify downstream primer CTAGAAATGCCGGGAACG.

9. hemangioma animal model according to claim 1 builds system, method, it is characterised in that：Described in step (4) The concrete operations for establishing hemangioma animal model are：Using above-mentioned transgenic mice as cultivation transgenic animals strain basis population Head build mouse, mate with the normal mouse of same germline, obtain the sub- mouse of F1 generation；By the normal of the sub- mouse of above-mentioned F1 generation and same germline Mouse mates, and obtains F2 for sub- mouse.