CN110951787B

CN110951787B - Immunodeficiency mouse, preparation method and application thereof

Info

Publication number: CN110951787B
Application number: CN201911347317.1A
Authority: CN
Inventors: 请求不公布姓名
Original assignee: Hunan Zhao Tai Biological Medicine Co ltd
Current assignee: Hunan Zhao Tai Biological Medicine Co ltd
Priority date: 2016-02-25
Filing date: 2017-01-19
Publication date: 2023-08-08
Anticipated expiration: 2037-01-19
Also published as: CN106661593A; CN107119076A; WO2017143894A1; CN110951787A

Abstract

The application is a divisional application of 201780000020.0, and belongs to the technical field of animal genetic engineering, in particular relates to an immunodeficiency mouse, a preparation method and application thereof, wherein the preparation method adopts NOD-Scid IL2 rg-/-immunodeficiency mouse (NSI mouse) to knock out Foxnl gene or Fah gene. The NSIF mouse is obtained by knocking out the Fah gene on the NSI mouse, can be used for efficiently constructing a novel humanized mouse model, and can be used for liver physiology and pathology research; according to the invention, the NSIN mice are obtained by knocking out Foxn1 genes on NSI mice, and have no body hair, further defects of immune system, and are easy to construct, monitor and measure solid tumors.

Description

Immunodeficiency mouse, preparation method and application thereof

The application is a divisional application, the application number of the original application is 201780000020.0, the application date is 2017, 01 and 22, and the invention is named as an immunodeficiency mouse, a preparation method and application thereof.

Technical Field

The invention belongs to the technical field of animal genetic engineering, and particularly relates to an immunodeficiency mouse, a preparation method and application thereof.

Background

The liver plays a strategic role in the human body in detoxification and metabolism of exogenous compounds. Due to the advantages of low mouse raising cost, fast breeding speed, short experimental period, clear genetic background, high experimental repeatability and the like, researchers construct various mouse liver disease models, such as liver injury, viral hepatitis, liver fibrosis, liver cancer and the like, by using the mice, and liver disease research is carried out. However, these models are difficult to compensate for the huge species difference between human and mouse (for example, many liver metabolic enzymes have species specificity, some human liver viruses such as HBV, HCV, etc. cannot infect mouse liver cells), and the research results or therapeutic drugs obtained on these models cannot reproduce the same effects on human body. The research by using the in vitro culture of the human liver cells is limited to the in vitro survival period of the primary cells of the human body, the freezing technology and the irreproducibility of the in vivo organ cooperation.

Thus, researchers have conducted liver humanized mouse studies. The liver humanized mouse model is transplanted in an immune deficiency mouse body which can induce liver injury and rebuilds human liver tissues or organs. The higher the immune deficiency degree of the recipient mice used in the liver humanized model, the smaller the rejection of xenografts and xenografts; and immune cells participate in inflammatory reaction caused by liver injury, if an immune system is perfect, liver failure is accelerated while liver injury is induced and human liver tissues or organs are not reconstructed, and the death rate of mice is improved. In addition, the controlled induced mouse liver cell damage provides sufficient space for survival, proliferation and development of transplanted human liver cells.

The optimal immunodeficient mice inducing liver injury in the prior art: TK-NOG (ThymdineKinase, namely thymidine pyrimidine kinase deficient NOD-Scid IL2 rg-/-) immunodeficient mice (Masami Hasegawa et al., 2013), uPA-SCID (urokinase-type Plasminogen Activator, namely urokinase-fibrinogen activator deficient Scid) immunodeficient mice (Mercer et al., 2001), FRG (Fah-/-Rag 2-/-IL2 yc-/-) and FRGN (Fah-/-Rag 2-/-IL2 yc-/-NOD) immunodeficient mice (Hisaya Azuma et al.,2007;Elizabeth M.Wilson et al, 2014). However, TK transgenic male mice are sterile, only by heterozygous female mice and wild male mice, there are no homozygous mouse lines, whereas uPA mice have very high requirements on donor liver cells, and uPA gene deletion can cause rapid and severe liver damage with uncontrollable selectivity. Liver-induced damage mice based on Fah gene knockout, such as FRG, FRGN, are currently the most widely used liver model tools with best controllability and high transplantation efficiency, and Fah-deficiency-induced liver damage can be controlled by the liver protection drug NTBC (2-nitro-4-benzotrifluoride-1, 3-cyclohexanedione) (Grompe et al, 1995;).

However, the immune gene defect backgrounds of FRG and FRGN Rag2-/-IL2 rg-/-and NOD Rag2-/-IL2 rg-/-are not the highest in the prior art, and in constructing a liver humanized mouse model, a certain rejection effect is generated on exogenous xenogeneic (human body) and allogeneic cells to influence the transplantation efficiency. Wei Ye et al Journal of Hematology & Oncology 2015 reported that NOD-scid IL2 rg-/-mice were found to have the highest immunodeficiencies and that humanized mouse models were constructed with the best results. Fah knockout mice based on the NOD-scid IL2 rg-/-immunodeficiency background will be the best model tool for liver disease patient-derived mice. However, researchers have encountered a number of difficulties in exploring the development of mice of this genotype. Because of the complex genetic background of NOD (non-obese diabetes) mice and spontaneous non-obese diabetes, gene knockdown in NOD mice may induce mortality or diabetic onset (Baxter AG et al, 1995;Nichols J et al, 2009;) furthermore, scid (Severe Combined Immunodeficiency Disease) mice have a Prkdc gene defect, a partial loss of DNA repair capacity, affecting gene repair after the knockdown tool is off target, increasing mortality in the knockout mice, and researchers have found that NOD-scid fat-/-mice rapidly fail after NTBC (hepatoprotectant) withdrawal, mice die (Blunt, t.et al, 1996) and NOD-scid IL2rg has a higher degree of genetic background defect than NOD and NOD-scid mice.

In addition, all mice (immune cells such as deletion B, T, NK) which are highly immune, including NOD-Scid IL2rg-/-, rag2-/-IL2rg-/-, rag1-/-IL2 rg-/-and the like, have extremely high efficiency in constructing tumor models, however, all have hairs, and when in vivo growth and distribution of tumor cells with fluorescent markers (particularly fluorescent proteins) are detected by using techniques such as in vivo imaging, the hairs have serious interference with the detection results.

Disclosure of Invention

Aiming at the defects and actual requirements of the prior art, the invention provides an immunodeficiency mouse, a preparation method and application thereof, wherein the immunodeficiency mouse has better effect than the existing NSI or other third generation immunodeficiency mice.

To achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention provides a method of gene knockout using NOD-Scid IL2 rg-/-immunodeficient mice (NSI mice), the knockout of the Fah gene or Foxnl gene.

In the invention, a sustainable reproduction NSIF (NOD-Scid IL2 rg-/-Fah-/-) mouse strain is obtained by carrying out Fah gene knockout on the NOD-Scid IL2 rg-/-background of an immunodeficient mouse with the highest immune deficiency degree, and a novel liver humanized mouse model with high chimeric rate and high success rate (humanized mouse model transplanted with organ cells or tissues of human liver and the like) is constructed by utilizing the NSIF mouse, and the model can be used for scientific research of human liver diseases (such as fatty liver, liver injury, hepatitis, liver cancer and the like) and curative effect evaluation of treatment methods (such as chemical drugs, biological preparations and the like) and drug catabolism and toxicity evaluation.

In the present invention, by Foxn1 gene knockout in the now recognized immunodeficient mice NOD-Scid IL2 rg-/-background with the highest immunodeficiency, highly immunodeficient mice NSIN (NOD-Scid IL2rg-/-Foxn 1-/-) with defective body hair growth (almost no body hair) were obtained. In the condition of no body hair, a tumor receptor mouse or a receptor mouse with fluorescent marked cells is easier to observe the cell growth, development and migration conditions of the mouse, and is easy to observe and measure the size of solid tumors; since Foxn1 gene plays an important role in thymic epithelial cell development and lymphogenesis, foxn1 gene deficiency will not only further prevent probabilistic thymic regeneration events in NOD-Scid IL2 rg-/-hyperimmune mice with aging, but also correlate with the extent of primary immunodeficiency due to Foxn1 gene deficiency, and construction of solid tumor models in nude mice will be better than other generations of immunodeficient mice.

Preferably, the nucleotide target sequence of the Fah gene is shown as SEQ ID NO.1, and the nucleotide target sequence of the Foxn1 gene is shown as SEQ ID NO. 2.

The nucleotide sequence is as follows:

Fah：aagctgcatggaagg(SEQ ID NO.1)；

Foxn1：ggaagtgcctcttgtagggg(SEQ ID NO.2)。

in a second aspect, the present invention provides a method of knocking out a Fah gene as described in the first aspect, comprising the steps of:

(1) Constructing a TALEN plasmid to obtain TALEN mRNA;

(2) Obtaining a fertilized egg of an NSI mouse, injecting a TALEN mRNA prokaryotic obtained in the step (1) into the cytoplasm of the fertilized egg of the NSI mouse, culturing for 24 hours, and then transplanting into the uterus of a pseudopregnant mouse to obtain a chimeric or heterozygous NSIF (NOD-scid IL2 rg-/-Fah-/-) immunodeficient mouse;

(3) Hybridizing the chimeric or heterozygous NSIF immunodeficient mice obtained in step (4) with NSI mice to obtain more heterozygous NSIF immunodeficient mice, and hybridizing the heterozygous NSIF immunodeficient mice to obtain NSIF homozygous immunodeficient mice.

Preferably, the construction of the TALEN plasmid in the step (1) includes the following steps: and respectively obtaining a TALEN left arm recognition binding sequence and a TALEN right arm recognition binding sequence according to the target sequence of the Fah gene, designing and encoding a TALEN left arm and right arm repetitive sequence, and connecting the repetitive sequences to a TALEN expression vector to obtain pCAG-TALEN L (left arm) -X-pA and pCAG-TALEN R (right arm) -X-pA plasmids.

Preferably, the recognition binding sequence of the left TALEN arm is SEQ ID NO.3, and the recognition binding sequence of the right TALEN arm is SEQ ID NO.4;

TALEN left arm recognition binding sequence: 5-aacttcatgggtctgggtc-3 (SEQ ID NO. 3);

TALEN right arm recognition binding sequence: 5-aaggatgctcttgcct-3 (SEQ ID NO. 4).

Preferably, the TALEN mRNA is obtained according to the procedure of kit m MESSAGE SP (Ambion) and e.coli Poly (a) Polymerase (NEB).

Preferably, the concentration of TALEN mRNA injected into the cytoplasm of a fertilized egg of an NSI mouse in step (2) is 10-200 ng/. Mu.L, for example, 10 ng/. Mu.L, 11 ng/. Mu.L, 12 ng/. Mu.L, 13 ng/. Mu.L, 15 ng/. Mu.L, 18 ng/. Mu.L, 20 ng/. Mu.L, 25 ng/. Mu.L, 30 ng/. Mu.L, 35 ng/. Mu.L, 40 ng/. Mu.L, 45 ng/. Mu.L, 50 ng/. Mu.L, 55 ng/. Mu.L, 60 ng/. Mu.L, 65 ng/. Mu.L, 70 ng/. Mu.L, 75 ng/. Mu.L, 80 ng/. Mu.L, 85 ng/. Mu.L, 90 ng/. Mu.L, 100 ng/. Mu.L, 110 ng/. Mu.L, 120 ng/. Mu.L, 130 ng/. Mu.L, 140 ng/. Mu.L, 150 ng/. Mu.L, 160 ng/. Mu.L, 170 ng/. Mu.L, 180 ng/. Mu.L, 190 ng/. Mu.L, or 200 ng/. Mu.L, preferably is further 20 ng/. Mu.L.

Preferably, the embryo manipulation of the NSI mouse fertilized egg with the Fah gene knocked out uses 10-40mmol/L HEPES, pH 7.0-8, 0.05-1mmol/L nonessential amino acid, 0.1-2mmol/L HEPES, preferably 20mmol/L HEPES, pH 7.4-7.8, 0.1mmol/L nonessential amino acid and 0.1-0.6mmol/L nonessential amino acid.

Preferably, the culture medium used for the embryo culture of the mouse with the Fah gene knocked out is pyruvic acid with the concentration of 0.1-2mmol/L, glutamine with the concentration of 0.5-3mmol/L and glucose with the concentration of 0.01-1mmol/L, preferably pyruvic acid with the concentration of 0.35mmol/L, glutamine with the concentration of 1mmol/L and glucose with the concentration of 0.1mmol/L.

Preferably, the number of fertilized eggs transplanted into uterus of the pseudopregnant mice in the step (2) is 10-20, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, preferably 10-15.

Preferably, the pseudopregnant mouse is any one of NOD mouse, NOD-SCID mouse or NSI mouse.

Preferably, the method of knocking out the Fah gene further comprises selecting a replacement mouse for a mammalian neonatal mouse.

Preferably, the replacement mice are ICR mice.

In a third aspect, the present invention provides a NSIF mouse obtained by knocking out the Fah gene according to the method of gene knockout described in the second aspect.

In a fourth aspect, the present invention provides an immunodeficient mouse model which is further genetically engineered on the basis of the NSIF mouse of the third aspect.

In a fifth aspect, the present invention provides the use of a mouse model as described in the third or fourth aspect as a model mouse for the study of pathology and physiology of humans, preferably as a model mouse for the study of liver disease and/or as a model mouse for liver humanisation.

In a sixth aspect, the present invention provides a method for knocking out Foxnl gene, comprising the steps of:

(1) Constructing a Foxn1 gene knockout recombinant vector, and in vitro transcribing gRNA;

(2) In vitro transcription of Cas9 mRNA;

(3) Obtaining a fertilized egg of an NSI mouse, injecting the gRNA obtained in the step (1) and the Cas9mRNA obtained in the step (2) into the fertilized egg cytoplasm of the NSI mouse, culturing for 24 hours, and then transplanting into the uterus of a pseudopregnant mouse to obtain a heterozygous NSIN (NOD-scid IL2rg-/-Foxn 1-/-) immunodeficient mouse;

(4) Hybridizing the chimeric or heterozygous NSIN immunodeficient mice obtained in step (3) with NSI mice to obtain more heterozygous NSIN immunodeficient mice, and hybridizing the heterozygous NSIN immunodeficient mice to obtain NSIN homozygous immunodeficient mice.

In the invention, the mRNA obtained by prokaryotic injection is injected into fertilized ovum cells of a mouse, and various embryo culture mediums in the prokaryotic injection process are adjusted to be suitable for NSI embryos, so that the efficiency of embryo prokaryotic injection and recovery of the embryos after injection are improved.

Preferably, the step of constructing a Foxn1 gene knockout recombinant vector comprises: linearized guide DNA (L-gDNA) is obtained through a primer, and then is connected to a linearized L-pT7 vector through DNA ligase to obtain the pT7-gDNA complete vector.

Preferably, the nucleotide sequence of the primer is shown in SEQ ID NO. 5-6;

the nucleotide sequence is as follows:

SEQ ID NO.5：5’-ATAGGN ggaagtgcctcttgtagggg GT-3’；

SEQ ID NO.6：5’-TAAAACN cccctacaagaggcacttccG-3’；

wherein, N can represent any one nucleotide of A, T, G or C.

Preferably, the in vitro transcription of the gRNA comprises the steps of: the pT7-gDNA complete vector is used as a template, gDNA gene fragments are amplified by primers, and then in vitro transcription is carried out to obtain gRNA.

Preferably, the nucleotide sequence of the primer is shown in SEQ ID NO. 7-8;

SEQ ID NO.7：5’-GAAATTAATACGACTCACTATA-3’；

SEQ ID NO.8：5’-AAAAAAAGCACCGACTCGGTGCCAC-3’。

preferably, the in vitro transcription of Cas9mRNA of step (2) comprises the steps of: linearizing the pcDNA3.3-hCAs9 vector, recovering the linearized pcDNA3.3-hCAs9 vector as a template for in vitro transcription, transcribing Cas9mRNA in vitro by using an SP6 polymerase promoter, recovering capped Cas9mRNA by a Licl method, adding poly A, purifying and preserving.

Preferably, the concentration of gRNA and Cas9mRNA injected into the cytoplasm of the fertilized egg of NSI mouse in step (3) is 10-200 ng/. Mu.L, which may be, for example, 10 ng/. Mu.L, 11 ng/. Mu.L, 12 ng/. Mu.L, 13 ng/. Mu.L, 15 ng/. Mu.L, 18 ng/. Mu.L, 20 ng/. Mu.L, 25 ng/. Mu.L, 30 ng/. Mu.L, 35 ng/. Mu.L, 40 ng/. Mu.L, 45 ng/. Mu.L, 50 ng/. Mu.L, 55 ng/. Mu.L, 60 ng/. Mu.L, 65 ng/. Mu.L, 70 ng/. Mu.L, 75 ng/. Mu.L, 80 ng/. Mu.L, 85 ng/. Mu.L, 90 ng/. Mu.L, 100 ng/. Mu.L, 110 ng/. Mu.L, 120 ng/. Mu.L, 130 ng/. Mu.L, 140 ng/. Mu.L, 150 ng/. Mu.L, 160 ng/. Mu.L, 170 ng/. Mu.L, 180 ng/. Mu.L, 190 ng/. Mu.L, or 200 ng/. Mu.L, preferably is further preferably 20 ng/. Mu.L.

Preferably, the culture medium for embryo manipulation of fertilized eggs of NSI mice with Foxn1 gene knocked out is HEPES with the concentration of 10-40mmol/L, pH of 7.0-8, nonessential amino acid of 0.05-1mmol/L, essential amino acid of 0.1-2mmol/L, preferably HEPES with the concentration of 20mmol/L, pH of 7.4-7.8, nonessential amino acid of 0.1mmol/L and essential amino acid of 0.1-0.6mmol/L.

Preferably, the culture medium used for the culture of the Foxn1 gene knocked-out mouse embryo is 0.1-2mmol/L of pyruvic acid, 0.5-3mmol/L of glutamine, 0.01-1mmol/L of glucose, preferably 0.35mmol/L of pyruvic acid, 1mmol/L of glutamine and 0.1mmol/L of glucose.

Preferably, the number of fertilized eggs transplanted into uterus of the pseudopregnant mice in the step (3) is 10-20, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, preferably 10-15.

Preferably, the method of knocking out Foxnl gene further comprises selecting a replacement mouse for a mammalian neonatal mouse.

Preferably, the replacement mice are ICR mice.

In the invention, mice knocked out Foxn1 and Fah genes adopt NSI female mice as surrogate female mice, and ICR female mice with at least one production experience are adopted as surrogate female mice. The NSI female mouse is adopted as a surrogate female mouse, so that the growth environment and in-vivo microenvironment of the genotype are more suitable for the growth of the deficient mice, and the survival rate can be improved; and ICR female mice are adopted as substitution female mice, so that the lactation rate can be improved.

In a seventh aspect, the present invention provides a NSIN mouse obtained by knocking out Foxnl gene according to the method of gene knockout of the first aspect.

In the invention, the NSIN mice are obviously superior to other immunodeficiency mice in the transplanting rate of transplanted tumors and the survival and growth of heterogeneous cells, and the NSIN mice have high immunodeficiency degree and can be used as model mice for the optimal tumor disease research.

In an eighth aspect, the present invention provides an immunodeficient mouse model further genetically engineered on the basis of the NSIN mouse of the seventh aspect.

In a ninth aspect, the present invention provides the use of a mouse model as described in the seventh or eighth aspect as a model mouse for human pathology and physiology studies, preferably as a model mouse for oncological disease studies.

In a tenth aspect, the present invention provides a mouse obtained by knocking out the Fah gene and Foxnl gene by the method of gene knockout as described in the first aspect.

In the invention, as a preferable technical scheme, the culture medium used for embryo operation such as fertilized egg transplantation in Foxn1 and Fah gene knockout mice is HEPES with the concentration of 20mmol/L, the pH of 7.4-7.8, the non-essential amino acid is 0.1mmol/L, and the essential amino acid is 0.1-0.6mmol/L.

The culture medium used for embryo culture of the mice with Foxn1 and Fah gene knocked out is pyruvic acid concentration of 0.35mmol/L, glutamine concentration of 1mmol/L and glucose concentration of 0.1mmol/L.

Compared with the prior art, the invention has the following beneficial effects:

(1) The invention performs Foxn1 gene knockout on the NOD-Scid IL2 rg-/-background of the immunodeficient mice with highest immunodeficiency degree, thus obtaining the highly immunodeficient mice NSIN (NOD-Scid IL2rg-/-Foxn 1-/-) with body hair growth defect, the mice have no body hair, the cell growth, development and migration conditions of the mice are easier to observe, and the observation and the size measurement of solid tumors are easy, and the probability thymus regeneration event of the highly immunodeficient mice along with the growth of age can be prevented;

(2) The invention carries out Fah gene knockout on the NOD-Scid IL2 rg-/-background of an immunodeficiency mouse to obtain a sustainable reproduction NSIF (NOD-Scid IL2 rg-/-Fah-/-) mouse strain, the Fah deletion can induce liver failure, immune cells participate in subsequent liver failure, the higher the immune deficiency degree of the NSIF is, the liver failure can be relieved in a controllable range, a novel liver humanized mouse model with high chimeric rate and high success rate is constructed by utilizing the NSIF mouse, and the model can be used for scientific research of human liver diseases (such as fatty liver, liver injury, hepatitis, liver cancer and the like) and curative effect evaluation of treatment methods (such as chemical drugs, biological preparations and the like) and for catabolism and toxicity evaluation of the treatment methods;

(3) The invention adopts NSI mice to replace pregnant, ICR mice to replace raising mode to cultivate NSIN and NSIF mice, improves survival rate and lactation rate of defective mice, and adopts a prokaryotic injection mode to inject the obtained mRNA into fertilized eggs, and adjusts various embryo culture mediums suitable for NSI embryo in prokaryotic injection, improves embryo prokaryotic injection efficiency and embryo recovery after injection.

Drawings

FIG. 1 shows the results of PCR cleavage of NSIN mice according to the invention, wherein WT is wild type, foxn1 +/-is heterozygous, foxn 1-/-is homozygous;

FIG. 2 shows the results of PCR cleavage of the NSIF mouse gene of the invention, wherein WT is wild-type, fah+/-is heterozygous, and Fah-/-is homozygous;

FIG. 3 is a graph showing the results of an alignment of NSIF mouse sequencing results of the present invention at NCBI;

FIG. 4 is a graph showing Western Blot results of the detection of the Fah protein of liver injury NSIF mice of the present invention;

FIG. 5 shows liver pathological sections of NSIF mice according to the present invention, wherein FIG. 5 (A) shows liver pathological sections of NSIF mice after the use of NTBC drugs is stopped, and FIG. 5 (B) shows liver pathological sections of NSIF mice after the normal use of NTBC drugs;

FIG. 6 is the expression levels of alanine aminotransferase and aspartate aminotransferase in NSIF mice of the present invention after cessation of NTBC drugs;

FIG. 7 shows the expression levels of glucose in NSIF mice of the invention after cessation of NTBC drug use;

FIG. 8 shows the change in body weight of a mouse after liver transplantation/non-transplantation of C57BL/6 mice according to the present invention and cessation of NTBC drug, wherein NISF-NTBC+lever is a NSIF mouse transplanted with C57BL/6 mice liver and NSIF-NTBC is a NSIF mouse not transplanted with liver;

FIG. 9 shows the expression levels of alanine aminotransferase and aspartic acid aminotransferase after the transplantation/non-transplantation of the liver of C57BL/6 mice and cessation of NTBC drug in NSIF mice of the present invention, wherein NISF-NTBC+river is NSIF mice transplanted with the liver of C57BL/6 mice and NSIF-NTBC is mice not transplanted with the liver;

FIG. 10 shows the expression level of glucose after the transplantation/non-transplantation of the liver of C57BL/6 mice and the cessation of NTBC drug in NSIF mice of the present invention, wherein NISF-NTBC+lever is the liver of C57BL/6 mice transplanted and NSIF-NTBC is the liver-non-transplanted mice;

FIG. 11 is a schematic diagram of the structure of the left and right arms of the Fah target site and the TALEN;

FIG. 12 is 1×10 ⁴ Comparison of NALM6-GFP reconstitution efficiency in mouse peripheral blood after NALM6-GFP cells were transplanted into NOG, NSI, NSIN mice, respectively;

FIG. 13 is 1X 10 ⁵ Comparison of NALM6-GFP reconstitution efficiency in mouse peripheral blood after NALM6-GFP cells were transplanted into NOG, NSI, NSIN mice, respectively;

FIG. 14 is 1×10 ⁶ Comparison of NALM6-GFP reconstitution efficiency in mouse peripheral blood after NALM6-GFP cells were transplanted into NOG, NSI, NSIN mice, respectively;

FIG. 15 is 1×10 ⁴ A549 cells were transplanted into NOG, NSI, NSIN mice for 30 days, respectively, and the mice were subcutaneouslyComparison of tumor tissue weights;

FIG. 16 is 1×10 ⁵ Comparison of the subcutaneous tumor tissue weights of mice 30 days after the respective engraftment of a549 cells into NOG, NSI, NSIN mice;

FIG. 17 is 1×10 ⁶ A549 cells were transplanted into NOG, NSI, NSIN mice for 30 days, respectively, and the weights of the subcutaneous tumor tissues of the mice were compared.

Detailed Description

The technical means adopted by the invention and the effects thereof are further described below by the specific embodiments in combination with the accompanying drawings, but the invention is not limited to the examples.

All animals of the invention were raised and bred in SPF (Specific Pathogen Free) class laboratory animal centers.

NSI mice of the invention, genotype: NOD-scid IL2rg-/-, issued patent number: ZL201310229629.9.

Example 1: construction of Cas9 knockout System plasmid

(1) Target selection: designing a sequence of GGN (17-18) NGG (N is any base) following a Cas9 knockout target point by utilizing a ZiFiT Targeter Version website, requiring the target site of the Cas9 knockout, and determining that the target site is a single site in a genome through a "Blast" retrieval function of an Ensembl/NCBI website;

target site sequence: ggaagtgcctcttgtagggg (SEQ ID NO. 2)

Target spot confirmation: designing a high-specificity primer for amplifying a target site according to the genome of the target cell, and performing PCR amplification to obtain a fragment containing the target site; selecting unique restriction enzyme of amplified fragments in target sites for enzyme digestion electrophoresis identification; after the enzyme digestion identification is correct, the PCR amplified product is sent to sequencing identification; through enzyme digestion and sequencing identification, the specificity of the targeting identification primer and the feasibility of enzyme digestion and sequencing identification are confirmed;

(2) Construction of targeting vector pT7-gDNA

(1) Two primers, namely a single polynucleotide chain (Oligo), which are respectively identical and complementary to the target site sequence are synthesized by the gene, namely S Oligo and AS Oligo; adding the reaction components into a 1.5mL EP tube according to the following table, placing the EP tube in boiling water, heating the EP tube for 10 minutes, cooling the EP tube to room temperature, and performing instantaneous centrifugation to obtain a linearized guide DNA sequence (namely L-gDNA) containing a sticky end for encoding guide RNA (gRNA) for later use;

s Oligo sequence: 5'-ATAGGN ggaagtgcctcttgtagggg GT-3' (SEQ ID NO. 5)

AS Oligo sequence: 5'-TAAAACN cccctacaagaggcacttccG-3' (SEQ ID NO. 6)

(2) Cleavage of the empty vector pMD18-T Simple (i.e., pT7 vector with ampicillin resistance) by the restriction endonuclease BbsI gives a linearized empty vector pMD18-T Simple containing a sticky end, i.e., L-pT7;

(3) connecting L-pT7 and L-gDNA into complete vector pT7-gDNA by DNA ligase (such as Solution I of Takara company), transforming, plating, picking up monoclonal, shaking, extracting plasmid DNA, enzyme cutting for identification, sequencing plasmid, and screening and sequencing correct plasmid for later use;

(3) gRNA in vitro transcription

(1) Amplifying gDNA gene fragments by using pT7-gDNA plasmid (1-30 ng) with correct sequence as a template and T7-S and Tracr-Rev as primers, and performing electrophoresis, gel recovery and dissolving in 30 mu L of enzyme-free water for later use;

T7-S primer sequence: 5'-GAAATTAATACGACTCACTATA-3' (SEQ ID NO. 7)

Tracr-Rev primer sequence: 5'-AAAAAAAGCACCGACTCGGTGCCAC-3' (SEQ ID NO. 8)

(2) By in vitro transcription kitThe amplified gDNA gene fragment from PCR was transcribed into gRNA in vitro using the T7 Kit (Ambion Corp.) and mirVana ^TM miRNA Isolation Kit the in vitro transcribed gRNA was recovered and purified from the transcription system using the kit (Ambion, inc.), dissolved in 20. Mu.L of enzyme-free water and stored at-80℃for further use.

(4) Cas9 in vitro transcription

(1) Preparing enzyme digestion reaction liquid according to the following system: cutting pcDNA3.3-hCAs9 (Cas 9 vector, addgene No. MLM 3613) with PmeI restriction endonuclease to linearize the vector, electrophoresis, running gel, recovering, and dissolving with 20 μl of enzyme-free water;

(2) capped Cas9mRNA was transcribed in vitro using the mMESSAGE mMACHINE T7 Kit, electrophoresed, run, and recovered as follows.

(3) Preparing a reaction system according to the following system, adding poly A on the cap Cas9mRNA to obtain RNA with stability and higher translation efficiency;

(4) by mirVana ^TM miRNA Isolation Kit the in vitro transcribed Cas9mRNA was recovered and purified from the transcription system using the kit (Ambion Inc.) and was dissolved in 10-20. Mu.L of enzyme-free water and stored at-80℃until use.

Example 2: construction and validation of NSIN mice

(1) NSI mice superrow: age of the mice: 10-11 weeks, female mice are of week age: 8 weeks. Female mice on day 13: PMSG (7.5 IU/dose) 00 injections, third day 13: HCG (7.5 IU/dose) 00 injections, third day 17:00 female mice were housed in 2 male mice, 8 on day four: 00-9:00 checking female mouse vaginal suppository, and obtaining NSI mouse fertilized eggs from uterus of a female mouse with suppository;

production notice for NSI male and female mice providing sperm: after the NSI female mice and male mice (male mice of NSI male mice and female mice providing sperms) are put into a cage and are subjected to thrombus, the male mice are separated, and the ICR female mice with at least one production experience are put into the cage to ensure that the young of the NSI female mice is sufficiently nursed;

(2) Prokaryotic injection of gRNA and Cas9mRNA with the concentration of 20 ng/. Mu.L into the cytoplasm of fertilized eggs of NSI mice (HEPES with 20mmol/L of all culture media for embryo operation, pH of 7.4-7.8, 0.1mmol/L of nonessential amino acids and 0.1-0.6mmol/L of essential amino acids), culture with embryo culture media of mice for 24 hours (the culture media is adjusted to be that the concentration of pyruvic acid is increased to 0.35mmol/L, the concentration of glutamine is adjusted to 1mmol/L, the concentration of glucose is adjusted to 0.1 mmol/L), and transplanting into the abdomen of pseudopregnant NSI female oviduct pot with the concentration of 0.5dpc (embryo in the two cell phase), wherein the number of transplanted fertilized eggs of each mouse is 15;

replacement pregnancy NSI mice feeding notice: after the NSI female mice and the male mice for producing the surrogate female mice are put into the suppository, the male mice are separated, the ICR female mice with at least one production experience are put into the male mice, and the littermate male mice are taken out 7 days after the birth of the surrogate female mice, so that the sufficient nutrition supply of the surrogate female mice in the lactation period is ensured;

(3) The female mice after fertilized eggs are transplanted are caged with ICR female mice produced more than once (1 female mice for pregnancy NSI and 1 ICR female mice);

after the birth of the surrogate mother mouse, the genotype of the mouse is identified (PCR amplification and sequencing) to obtain heterozygous NSIN (NOD-scid IL2rg-/-Foxn 1-/-) immunodeficient mouse, NSIN homozygote is obtained by further hybridization with NSI mouse, and the PCR result is shown in figure 1;

notice that: because homozygous NSIN female mice are deficient in Foxn1, mammary gland development is incomplete, and good nursing NSIN young is not possible, the NSIN strain is propagated mainly by mating homozygous NSIN male mice with heterozygous NSIN female mice to propagate offspring; homozygous NSIN without body hair, heterozygous NSIN with body hair;

as can be seen from FIG. 1, homozygous NSIN mice were deficient in the Foxn1 gene.

Example 3: construction of TALEN plasmid

(1) Analyzing the Fah gene CDS sequence (NOD-scid IL2 rg-/-mouse background) by using TELAN Targeter software, and screening out the gene locus with highest specificity from the Fah gene CDS sequence as a TALEN target;

TALEN target sequence: 5-aagctgcatggaagg-3;

TALEN left arm recognition binding sequence: 5-aacttcatgggtctgggtc-3;

TALEN right arm recognition binding sequence: 5-aaggatgctcttgcct-3;

(2) The sequences of the left and right arms of the TALEN are designed according to the sequences of the left and right arms of the TALEN for targeting the Fah gene and the TALE recognition coding principle, as shown in FIG. 11:

TALEN left arm: AACTTCATGGGTCTGGGTCAAG;

TALEN right arm: AAGGATGCTCTTGCCTCCT;

(3) The left and right repeat sequences of TALEN containing BsmBI (namely Esp I, thermo Scientific company, model FD 0454) restriction enzyme cutting sites at two sides of the gene synthesis are subjected to enzyme cutting by BsmBI and are connected into a TALEN expression vector pCAG-TALEN-X-pA (Addgene company) to obtain pCAG-TALEN L (left arm) -X-pA and pCAG-TALEN L (right arm) -X-pA plasmids;

(4) TALEN activity assessment: in vitro test of TALEN activity adopts Single-strand annealing (SSA) method, wherein a reporter gene in SSA report vector is fluorescein (Luciferase) gene, and a promoter is CMV. The operation method is that 24-well plate 293T cells are transfected with 200ng of TALENs expression plasmid, 50ng of SSA report plasmid and 10ng Renilla plasmid,1d, and then transfected cells are collected and treated with Luciferase Cell Lysis Buffer (NEB), luciferase activity is detected, and cleavage activity of TALENs is predicted;

(5) TALEN mRNA acquisition: TALENs plasmids require synthesis of mrna encoding TALENs by in vitro transcription and injection of embryonic cytoplasm after termination with poly (a). The experimental procedure of in vitro transcription of TALEN mrna and addition of polyadenylation was performed according to the procedure of kit m MESSAGE SP (Ambion) and e.coli Poly (a) Polymerase (NEB), the method being briefly described as follows:

(1) taking 15 mug of L-TALENs and R-TALENs obtained from large plasmids, performing enzyme digestion at 37 ℃ overnight, taking 0.2 mug of enzyme digestion products, loading the enzyme digestion products into 1% agarose gel holes, respectively taking the original plasmids as a reference, performing electrophoresis to determine complete linearization, recovering the enzyme digestion products by using a DNA recovery kit (DP 214), and measuring the concentration;

(2) in vitro transcription: thawing the reagent in the SP 6m MESSAGE m MACHINE Kit (Ambion, AM 1340) kit on ice, centrifuging briefly, thawing the solution at room temperature after buffer thawing, placing the rest solution on ice, setting the total system to 10 mu L, fully mixing the sample after sample addition, and incubating at 37 ℃ for 3h;

(3) adding 0.5 mu L TURBO DNase, mixing well, and incubating at 37 ℃ for 15min;

(4) the relevant reagents in the E.coil Poly (A) polymerase kit are thawed on ice after the RNA is added with Poly A tail, the total amount is set to be 50 mu L, the samples are added according to a table system, and after the sample is added, the samples are fully mixed and incubated for 45min at 37 ℃.

(5) TALEN mrna was precipitated and recovered, and Cas9 RNA transcribed in vitro was recovered and purified from the transcription system using mirVanaTMmiRNA Isolation Kit kit (Ambion corporation), dissolved in 10-20 μl of enzyme-free water, and stored at-80 ℃ for later use.

Example 4: construction and validation of NSIF mice

production notice for NSI male and female mice providing sperm: after the NSI female mice and the male mice (the female mice and the male mice providing sperms) are put into the male mice and the female mice, the male mice are separated, and the female mice with at least one production experience are put into the ICR female mice, so that the sufficient lactation of the young animals produced by the NSI female mice is ensured.

(2) The mRNA pronucleus with the concentration of 20 ng/mu L TALEN is injected into the fertilized egg cytoplasm of NSI mice (HEPES with 20mmol/L culture medium for embryo operation, pH 7.4-7.8, 0.1mmol/L of nonessential amino acid and 0.1-0.6mmol/L of essential amino acid), and after the culture for 24 hours with the embryo culture medium of the mice (the culture medium is adjusted to be that the pyruvic acid concentration is increased to 0.35mmol/L, the glutamine concentration is adjusted to 1mmol/L, the glucose concentration is adjusted to 0.1 mmol/L), the fertilized eggs are transplanted into the oviduct pot abdomen of pseudopregnant NSI mice with 0.5dpc (two-cell embryo), and the number of fertilized eggs of each mouse is preferably transplanted to 13;

replacement pregnancy NSI mice feeding notice: after the NSI female mice and the male mice for producing the surrogate female mice are put into the suppository, the male mice are separated, the ICR female mice with at least one production experience are put into the male mice, and the littermate male mice are taken out 7 days after the birth of the surrogate female mice, so that the sufficient nutrition supply of the surrogate female mice in the lactation period is ensured.

(4) After the birth of the surrogate mother mouse, the genotype of the mouse is identified (PCR amplification and sequencing) to obtain heterozygous NSIF (NOD-scid IL2 rg-/-Fah-/-) immunodeficient mouse, the NSIF homozygote is obtained by further hybridization with the NSI mouse, the NSIF sequencing result is compared on NCBI, the result is shown in figure 3, and the PCR electrophoresis result is shown in figure 2;

notice that: NTBC (final concentration: 7.5 mg/L) was added to drinking water (pH 3.0, autoclaved) of the surrogate mother; one week before the female mice are born, 120 ul/mouse of NTBC (final concentration: 7.5 mg/L) is injected subcutaneously; after female mice farrowing, less than 4 weeks old mice must be subcutaneously injected with NTBC 10-20 uL/day, and lactating female mice injected with NTBC 120 uL/day;

as can be seen from FIGS. 2 and 3, the sequencing result and the electrophoresis result after PCR amplification of the gene reflect the defect and incompleteness of the Fah gene in the NSIF mouse genome.

The result of detecting the expression of the Fah protein in the liver of the NSIF mouse (taking the NSI mouse as a positive control) by Western Blot is shown in figure 4, and the NSI expresses the Fah protein, and the NSIF mouse does not express the Fah protein, so that the successful knockout of the Fah gene is proved.

Example 5: construction of liver injury animal model

(1) The addition of NTBC to normal drinking water of NSIF mice (without injection of NTBC) was stopped

(2) Weighing and recording the-NTBC NSIF mice every day, and comparing the weight change curve with the NSIF mice drinking NTBC acidic water to remove the influence of NTBC on the weight change of the NSIF mice;

(3) After stopping the administration of NTBC for 40 days, pathological sections of livers of mice stopped and mice normally administered are shown in fig. 5 (A) and 5 (B), 300mL of peripheral blood of mice in an experimental group is extracted, serum samples are extracted, and alanine aminotransferase (ALT, alanine Aminotransferase), aspartate aminotransferase (AST, aspartate Aminotransferase) and Glucose (Glucose) levels in the serum are detected, and the results are shown in fig. 6-7;

from the liver physical image and pathological section results fig. 5 (a) and (B), it can be seen that after the NSIF mouse stops feeding NTBC, macroscopic damage occurs to the liver, and tissue section staining shows hepatocyte necrosis (a); the liver cells of the mice with continuous administration did not show obvious liver injury and liver cell necrosis (B). Indicating that NSIF mice spontaneously induced liver injury, which injury was alleviated and controlled by NTBC-based drugs, the results are also corroborated in FIGS. 6-7;

FIGS. 6-7 show that, after NSIF mice were stopped with NTBC, the levels of alanine aminotransferase and aspartate aminotransferase in serum were significantly increased, and glucose levels were significantly decreased.

Example 6: liver transplantation experiments for mice of different strains

(1) Selecting 6 NSIF mice (with birth of the same fetus) with birth date not more than one week and sex, dividing into two groups (3 of each group), wherein one group is NSIF-NTBC+Liver (namely, NSIF mice are transplanted with Liver cells of C57BL/6 mice and gradually stop NTBC administration), and the other group is NSIF-NTBC (namely, NSIF mice which are not transplanted with Liver cells of C57BL/6 mice and are synchronously subjected to NTBC gradual stopping administration with the NSIF-NTBC+Liver experimental group);

(2) Killing 1C 57BL/6 mouse by carbon dioxide method, grinding and lysing red blood cells of C57BL/6 mouse liver to obtain single liver cell suspension (concentration is 2×107 cells/mL) for use;

(3) 100. Mu.L of the C57BL/6 mouse single Liver cell suspension in step 2 was injected intravenously into each NSIF-NTBC+Liver mouse, i.e.2X 106 cells were injected into each mouse;

(4) After the mouse liver cell transplantation test, NTBC dosing was stopped for two groups of experimental mice, and the experimental mice were weighed daily and the weights were recorded as shown in fig. 8;

(5) After 40 days of liver cell transplantation, 300ml of peripheral blood of two groups of experimental mice are extracted, serum samples are extracted, and alanine aminotransferase (ALT, alanine Aminotransferase), aspartic acid aminotransferase (AST, aspartate Aminotransferase) and Glucose (Glucose) levels in the serum are detected, as shown in figures 9-10;

as can be seen from FIG. 8, after the NSIF mice not transplanted with liver cells of C57BL/6 mice were stopped, the body weight was gradually decreased until death, and the NSIF mice transplanted with liver cells of C57BL/6 mice were slowly restored to their body weight for more than 33 days. It is demonstrated that transplanted mouse liver cells of different strains can grow in mice and replace the liver function of recipient mice.

As can be seen from FIGS. 9-10, NSIF mice not transplanted with C57BL/6 mice liver cells had significantly increased levels of alanine aminotransferase and aspartate aminotransferase synthesis in serum after discontinuation of dosing, and significantly decreased levels of glucose synthesis.

Example 7: construction of solid tumor humanized mouse model by NSIN

(1) Will be of different orders of magnitude (1X 10 ⁴ 、1×10 ⁵ 、1×10 ⁶ ) NALM6-GFP cells (human B-cell line of acute leukemia BALL, labeled with green fluorescent protein) were transplanted into NSIN (NOD/SCID IL2rg-/-Foxn 1-/-), NSI (NOD/SCID IL2 rg-/-), NOG (NOD. Cg-Prkdc) by tail vein injection, respectively ^scid IL2rg ^tm1Sug Immunodeficient mice of Jiccrl, japan CIEA/IVS company, constructing a blood tumor (B-ALL) humanized mouse model;

(2) After NALM6-GFP cell transplantation, observing the state of a tumor transplanted mouse, taking peripheral blood of the mouse when the mouse is ill, detecting the proportion of NALM6-GFP cells in the peripheral blood by a flow cytometry, recording and preparing tumor weight comparison bar graphs of different orders of magnitude, and the results are shown in figures 12-14;

(3) From the histogram comparisons of different orders of magnitude, fig. 12-14 can be derived: the in vivo environment in NSIN immunodeficient mice is better suited for the survival and growth of xenogenic (hematological tumor, normal blood) cells; particularly, the transplanting efficiency of NSIN mice is obviously higher than that of NSI and NOG mice when cells are few; preliminary conclusions can be drawn that the ranking of the immunodeficiencies of the three mice is NSIN > NSI > NOG.

Example 8: construction of solid tumor humanized mouse model by NSIN

(1) Will be of different orders of magnitude (1X 10 ⁴ 、1×10 ⁵ 、1×10 ⁶ ) Is transplanted into NSIN (NOD/SCID IL2rg-/-Foxn 1-/-), NSI (NOD/SCID IL2 rg-/-), NOG (NOD. Cg-PrkdcsccidIL 2rgtm1Sug/Jiccrl, japan CIEA/IVS) immunodeficient mice by subcutaneous injection, respectively, to construct a solid tumor (lung cancer) humanized mouse model;

(2) After 30 days of A549 cell transplantation, mouse tumor tissues were taken, tumor tissue weights were weighed, and tumor weight comparison bar graphs of different orders of magnitude were recorded and made, and the results are shown in FIGS. 15-17.

(3) From the histogram comparisons of different orders of magnitude, fig. 15-17 can be derived: the in vivo environment in NSIN immunodeficient mice is better suited for the survival and growth of xenogenic (solid tumor, non-hematologic normal cells) cells; particularly, the transplanting efficiency of NSIN mice is obviously higher than that of NSI and NOG mice when cells are few; it was further verified that the ranking of the immunodeficit levels for the three mice was NSIN > NSI > NOG.

The applicant states that the detailed method of the present invention is illustrated by the above examples, but the present invention is not limited to the detailed method described above, i.e. it does not mean that the present invention must be practiced in dependence upon the detailed method described above. It should be apparent to those skilled in the art that any modification of the present invention, equivalent substitution of raw materials for the product of the present invention, addition of auxiliary components, selection of specific modes, etc., falls within the scope of the present invention and the scope of disclosure.

SEQUENCE LISTING

<110> Hunan Zhaotai biological medicine Co., ltd

<120> an immunodeficiency mouse, its preparation method and application

<130> 2016

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 15

<212> DNA

<213> synthetic sequences

<400> 1

aagctgcatg gaagg 15

<210> 2

<211> 20

<212> DNA

<213> synthetic sequences

<400> 2

ggaagtgcct cttgtagggg 20

<210> 3

<211> 19

<212> DNA

<213> synthetic sequences

<400> 3

aacttcatgg gtctgggtc 19

<210> 4

<211> 16

<212> DNA

<213> synthetic sequences

<400> 4

aaggatgctc ttgcct 16

<210> 5

<211> 28

<212> DNA

<213> synthetic sequences

<220>

<221> DNA

<222>

<223> n is a, c, g, t or u

<400> 5

ataggnggaa gtgcctcttg tagggggt 28

<210> 6

<211> 28

<212> DNA

<213> synthetic sequences

<220>

<221> DNA

<222>

<223> n is a, c, g, t or u

<400> 6

taaaacnccc ctacaagagg cacttccg 28

<210> 7

<211> 22

<212> DNA

<213> synthetic sequences

<400> 7

gaaattaata cgactcacta ta 22

<210> 8

<211> 25

<212> DNA

<213> synthetic sequences

<400> 8

aaaaaaagca ccgactcggt gccac 25

Claims

1. A method of gene knockout, characterized in that the method uses NOD-Scid IL2 rg-/-immunodeficient mice (NSI mice) to knock out Foxnl gene;

the nucleotide target sequence of the Foxn1 gene is shown as SEQ ID NO. 2.

2. The method according to claim 1, wherein the method of knocking out Foxnl gene comprises the steps of:

(2) In vitro transcription of Cas9 mRNA;

(3) Obtaining a fertilized egg of an NSI mouse, injecting the gRNA obtained in the step (1) and the Cas9mRNA obtained in the step (2) into the fertilized egg cytoplasm of the NSI mouse, culturing for 24 hours, and then transplanting into the uterus of a pseudopregnant mouse to obtain a chimeric or heterozygous NSIN (NOD-scidIL 2rg-/-Foxn 1-/-) immunodeficient mouse;

3. The method of claim 2, wherein the step of constructing a Foxn1 knockout recombinant vector comprises: obtaining linearized guide DNA through a primer, and connecting the linearized guide DNA to a linearized L-pT7 vector through DNA ligase to obtain a pT7-gDNA complete vector;

the nucleotide sequence of the primer is shown in SEQ ID NO. 5-6;

the L-pT7 vector is a cohesive-end-containing linearized empty vector obtained by cleavage of the empty vector pMD18-T Simple by the restriction enzyme BbsI.

4. The method of claim 3, wherein the in vitro transcription of the gRNA comprises the steps of: amplifying gDNA gene fragments by using pT7-gDNA complete vector as a template through primers, and then carrying out in vitro transcription to obtain gRNA;

the nucleotide sequence of the primer is shown as SEQ ID NO. 7-8.

5. The method of claim 2, wherein the in vitro transcription of Cas9mRNA of step (2) comprises the steps of: linearizing the pcDNA3.3-hCAs9 vector, recovering the linearized pcDNA3.3-hCAs9 vector as a template for in vitro transcription, transcribing Cas9mRNA in vitro by using an SP6 polymerase promoter, recovering capped Cas9mRNA by a Licl method, adding poly A, purifying and preserving.

6. The method of claim 2, wherein the concentration of gRNA and Cas9mRNA injected into the cytoplasm of the fertilized egg of the NSI mouse in step (3) is 10-200ng/μl.

7. The method of claim 6, wherein the concentration of gRNA and Cas9mRNA injected into the cytoplasm of the fertilized egg of the NSI mouse in step (3) is 12-100ng/μl.

8. The method of claim 7, wherein the concentration of gRNA and Cas9mRNA injected into the cytoplasm of the fertilized egg of the NSI mouse in step (3) is 20ng/μl.

9. The method according to claim 2, wherein the embryo manipulation of the fertilized eggs of the NSI mouse with the Foxn1 gene knocked out uses 10-40mmol/L HEPES, pH 7.0-8, 0.05-1mmol/L of nonessential amino acids and 0.1-2mmol/L of essential amino acids.

10. The method according to claim 9, wherein the embryo manipulation of the fertilized eggs of the NSI mouse with the Foxn1 gene knocked out uses 20mmol/L HEPES, pH 7.4-7.8, 0.1mmol/L nonessential amino acids and 0.1-0.6mmol/L essential amino acids.

11. The method according to claim 2, wherein the culture medium used for the culture of the Foxn1 gene knockout mouse embryo is pyruvic acid concentration of 0.1-2mmol/L, glutamine concentration of 0.5-3mmol/L, and glucose concentration of 0.01-1mmol/L.

12. The method according to claim 11, wherein the culture medium used for the culture of the Foxn1 gene knockout mouse embryo is pyruvic acid concentration of 0.35mmol/L, glutamine concentration of 1mmol/L, and glucose concentration of 0.1mmol/L.

13. The method according to claim 2, wherein the number of fertilized eggs transplanted into the uterus of the pseudopregnant mouse in the step (3) is 10-20;

the pseudopregnant mouse is any one of NOD mouse, NOD-SCID mouse or NSI mouse;

the method for knocking out Foxnl gene also comprises selecting a substitution mice to mammal the neonatal mice.

14. The method according to claim 13, wherein the number of fertilized eggs transplanted into the uterus of the pseudopregnant mouse in step (3) is 10-15;

the mice were ICR mice.

15. Use of a NSIN mouse obtained after knockout of Foxnl gene according to any one of claims 1-14 as a model mouse for research of human pathology and physiology.

16. The use according to claim 15, characterized in that it is the use of model mice studied as tumor diseases.