CN111808859B

CN111808859B - gRNA of WAS gene and application thereof

Info

Publication number: CN111808859B
Application number: CN202010668606.8A
Authority: CN
Inventors: 赖良学; 周娟娟; 廖媛
Original assignee: Guangzhou Institute of Biomedicine and Health of CAS
Current assignee: Guangzhou Institute of Biomedicine and Health of CAS
Priority date: 2020-07-13
Filing date: 2020-07-13
Publication date: 2022-09-13
Anticipated expiration: 2040-07-13
Also published as: CN111808859A

Abstract

The invention provides gRNA of a WAS gene and application thereof, wherein a target sequence of the gRNA is positioned in No. 2 exon and No. 7 exon of the WAS gene and comprises SEQ ID NO. 1 or a nucleic acid sequence shown as SEQ ID NO. 2. The target sequence of the gRNA comprises the exon 2 and the exon 7 of the WAS gene, and the constructed Wiskot-Aldrich syndrome rabbit model can accurately simulate the phenotype of human Wiskot-Aldrich syndrome by knocking out the WAS gene in a rabbit fertilized egg, is favorable for better understanding the pathogenic mechanism of the Wiskot-Aldrich syndrome, and provides important reference for developing a high-efficiency and accurate diagnosis method and providing more effective treatment schemes.

Description

gRNA of WAS gene and application thereof

Technical Field

The invention belongs to the technical field of biology, relates to gRNA of a WAS gene and application thereof, and particularly relates to gRNA of the WAS gene and application thereof in construction of a Wiskott-Aldrich syndrome rabbit model.

Background

Wiskott-Aldrich syndrome (WAS) is an X-linked recessive genetic disorder caused by a mutation in the WAS gene. The Wiskott-Aldrich syndrome is currently clinically classified into classical WAS, X-linked thrombocytopenia (XLT), intermittent X-linked thrombocytopenia (IXLT) and X-linked neutropenia (X-linked neutropenia, XLN) according to the type of gene mutation, WAS protein expression and clinical symptoms. Typical WAS is the most severe, and median survival for patients is only 10-15 years if not treated in time.

The WAS gene is specifically expressed in hematopoietic cells, and the encoded WAS protein (WASP) is an actin nucleation promoting factor, has complex functions and is involved in a plurality of important biological activities. At present, the pathological mechanism of Wiskott-Aldrich syndrome is not clear, and it is relatively well understood that WASP deficiency has certain influence on T cells, but has unclear influence on other immune cells such as B cells, natural killer cells and dendritic cells. In addition, the cause of platelet abnormalities and autoimmune diseases in WAS patients is unclear. The clinical symptoms of Wiskott-Aldrich syndrome are very complex and it is up to establish a highly effective systematic diagnostic method. Patients with WAS, especially XLT/IXLT patients, are often misdiagnosed with Idiopathic Thrombocytopenia (ITP) and do not receive timely effective treatment; and effective treatment and intervention of Wiskott-Aldrich syndrome is also dependent on the determination of the Wiskott-Aldrich syndrome class (typical WAS, XLT/IXLT and XLN). For a typical WAS, the currently available treatment is hematopoietic stem cell Transplantation (Ozsana H, Cavazzana-Calvo M, Notarangelo LD, et al, Long-term outer pigment following hematogenous stem-cell Transplantation in Wiskott-Aldrich synthesis: collagen driven study of the European Society for Immunodeficiency and European Group for Blood and Marrow Transplantation [ J ] Blood,2008,111(1):439-745.Catucci M, Castiello MC, Pala F, et al, Autoimminization in Wiskott-Aldrich synthesis: isolated [ J ] Front, Imont 3: HLA type 209, but otherwise the success rate is low; stem Cell Gene Therapy strategies are also in the process of exploration (Toru Uchiyama, Marsilio Adriani, G Jayashred Jagadeseh, et al. the American Society of Gene & Cell Therapy [ J ].2012,20(6): 1270-.

In order to better understand the pathogenesis of Wiskott-Aldrich Syndrome, develop highly efficient and accurate diagnostic methods, and provide effective treatment regimens, researchers have used gene editing techniques to construct animal models that mimic patients with WAS (Scott B. Snapper, free S. Rosen, Emiko Mizoguchi, Paul Cohen, et al. Wiskott-Aldrich synthetic Protein-deficiency Rice recent a roll for WASP in T but Not B Cell Activation [ J ]. Immunity,1998,9: 81-91.). However, to date, the animal models of WAS gene knock-out are almost mice, and although these mouse models do make an important contribution to the study of Wiskott-Aldrich syndrome, the phenotype of the mouse models and the patients with WAS still very different, such as the mice have less thrombocytopenia, no serious infection, and no eczema and joint abnormality observed; moreover, these WASP-deficient mice have normal growth and survival, and most of the WAS patients die before adulthood if they do not receive appropriate treatment.

Rabbits are one of the commonly used experimental animals, and have been widely used in the field of biomedical research. Compared with the big mouse and the small mouse, the rabbit is closer to the human in the aspects of evolution degree, physiological structure, anatomical structure and pathological characteristics of a plurality of diseases; compared with non-human primates, the rabbit has the advantages of easy control of heredity, early sexual maturity, short pregnancy period and the like.

Therefore, in order to further understand the pathogenesis of the Wiskott-Aldrich syndrome, a rabbit model simulating the human Wiskott-Aldrich syndrome can be constructed, which is beneficial to developing a high-efficiency and accurate diagnosis method and providing more effective treatment schemes.

Disclosure of Invention

Aiming at the defects and practical requirements of the prior art, the invention provides a gRNA of a WAS gene and an application thereof, wherein a target sequence of the gRNA comprises a No. 2 exon and a No. 7 exon of the WAS gene, and a Wiskot-Aldrich syndrome rabbit model constructed by knocking out the WAS gene in a rabbit fertilized egg can accurately simulate the phenotype of human Wiskot-Aldrich syndrome, is favorable for better understanding the pathogenic mechanism of the Wiskot-Aldrich syndrome, and provides important references for developing efficient and accurate diagnosis methods and providing more effective treatment schemes.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention provides grnas of a WAS gene, the target sequences of which are located in exon 2 and exon 7 of the WAS gene.

In the invention, because the rabbit WAS gene exon 2 has the highest homology with human, WAS gene pathogenic mutation is distributed on the whole gene, and adverse effects of gene knockout on embryonic development are avoided, two gRNA strategies are finally adopted and target sites are searched on exon 2 and exon 7.

Preferably, the gRNA includes SEQ ID NO 1 or a nucleic acid sequence as set forth in SEQ ID NO 2;

SEQ ID NO:1(gRNA1)：ACTTCATCCGCCTTTACGGC；

SEQ ID NO:2(gRNA2)：ACAAACTGGCCCACTGTCC。

in the invention, the gRNA shown in SEQ ID NO 1-2 guides CRISPR/Cas9 to perform specific recognition and cutting near a target site, so as to realize mutation of the WAS gene No. 2 exon and/or No. 7 exon partial sequence.

In a second aspect, the present invention provides a gRNA expression vector comprising the gRNA of the first aspect.

In a third aspect, the present invention provides a method for preparing a gRNA expression vector according to the second aspect, the method comprising the steps of:

(1) designing gRNA according to the exon 2 and exon 7 sequences of the WAS gene;

(2) and inserting the obtained gRNA into an expression vector to obtain the gRNA expression vector.

In a fourth aspect, the present invention provides a vector composition comprising a gRNA expression vector of the second aspect.

Preferably, the vector composition further comprises a Cas9 expression vector.

In a fifth aspect, the present invention provides a CRISPR/Cas9 gene editing system comprising a gRNA of the first aspect.

Preferably, the gene editing system further comprises Cas9 mRNA.

Preferably, the mass ratio of the gRNA to the Cas9mRNA is (1-5): 20, for example, 1:20, 2:20, 3:20, 4:20 or 5:20, preferably 3:20, and more preferably, the ratio of gRNA1: gRNA2: Cas9mRNA is 1.5:1.5: 20.

In the invention, a gene editing system formed by the gRNA and the Cas9mRNA targets a specific site of the WAS gene by using the gRNA and cuts the target site by using Cas9 to realize mutation of the WAS gene.

In a sixth aspect, the invention provides a host cell which is a fertilized rabbit egg transfected with the CRISPR/Cas9 gene editing system of the fifth aspect.

In the invention, mixed solution of gRNA and Cas9mRNA is introduced (preferably injected cytoplasm) into rabbit fertilized eggs before and after prokaryotic stage, a CRISPR/Cas9 gene editing system is utilized to target WAS gene of the rabbit fertilized eggs, and the WAS gene knockout type newborn rabbit can be obtained by transplanting the WAS gene knockout type newborn rabbit into a recipient female rabbit.

In a seventh aspect, the present invention provides a WAS gene editing method, including:

and (3) transfecting a rabbit fertilized egg by using the CRISPR/Cas9 gene editing system of the fifth aspect, and performing rabbit WAS gene editing.

In an eighth aspect, the invention provides a Wiskott-Aldrich syndrome model organism, wherein the model organism is a WAS gene defective rabbit.

In the invention, the rabbit is used as a model organism because compared with a mouse, the rabbit is closer to human in terms of evolution degree, physiological structure, anatomical structure and pathological characteristics of a plurality of diseases, and compared with a non-human primate, the rabbit has the advantages of easy genetic control, early sexual maturity, short pregnancy period and the like.

The Wiskott-Aldrich syndrome rabbit model constructed based on the rabbits completely lacks WAS protein, and simulates various typical symptoms of Wiskott-Aldrich syndrome patients, including severe platelet reduction and peripheral CD8 ⁺ T cell depletion, severe infection and greatly reduced survival; in addition, we observed eczema, renal abnormalities and joint abnormalities. Compared with a related mouse model, the WAS protein-deficient rabbit constructed by the invention can more accurately simulate the disease symptoms of Wiskott-Aldrich syndrome patients, and has important significance in the aspects of researching the pathogenic mechanism and clinical treatment of the Wiskott-Aldrich syndrome.

In a ninth aspect, the invention provides a gRNA of the first aspect, a gRNA expression vector of the second aspect, a vector composition of the fourth aspect, a CRISPR/Cas9 gene editing system of the fifth aspect, a host cell of the sixth aspect, or an application of the Wiskott-Aldrich syndrome model organism of the eighth aspect in the preparation of a Wiskott-Aldrich syndrome diagnostic drug and/or therapeutic drug.

Compared with the prior art, the invention has the following beneficial effects:

(1) the method comprises the steps of designing gRNAs shown in SEQ ID No. 1-2 according to WAS gene No. 2 exon and/or No. 7 exon sequences, forming a WAS gene editing system with Cas9, and guiding CRISPR/Cas9 to perform specific recognition and cutting near a target site by the gRNAs to realize gene mutation;

(2) the invention can obtain WAS gene knockout type baby rabbits by introducing mixed liquor of gRNA and Cas9mRNA into rabbit fertilized eggs before and after prokaryotic period, targeting WAS genes of the rabbit fertilized eggs by using a CRISPR/Cas9 gene editing system, and transplanting the WAS genes into a recipient female rabbit body;

(3) the invention utilizes a CRISPR/Cas9 gene editing system to edit a rabbit zygote WAS gene, thereby successfully generating a first Wiskott-Aldrich syndrome rabbit model. These Wiskott-Aldrich syndrome rabbits were completely deficient in WAS protein, mimicking many of the typical symptoms of Wiskott-Aldrich syndrome patients, including severe thrombocytopenia and peripheral CD8 ⁺ T cell depletion, severe infection and greatly reduced survival; in addition, we observed eczema, renal abnormalities and joint abnormalities. Compared with a related mouse model, the WAS protein-deficient rabbit constructed by the invention can more accurately simulate the disease symptoms of Wiskott-Aldrich syndrome patients, and has important significance in the research of Wiskott-Aldrich syndrome pathogenesis and clinical treatment.

Drawings

FIG. 1A is a partial sequence of exon 2 of rabbit WAS gene, highlighted sequence is the target sequence of gRNA1, FIG. 1B is a partial sequence of exon 7 of rabbit WAS gene, highlighted sequence is the target sequence of gRNA 2;

fig. 2 is a schematic gene editing diagram of CRISPR/Cas 9;

FIG. 3 shows the sequencing results of TA clone F0;

FIG. 4A shows the F1 generations (numbered F1-191117# N, N is 1, 2,3 … 8) of F0-4 mated with wild-type male rabbits, FIG. 4B shows the F1 generations (numbered F1-200115# N, N is 1, 2,3 … 12) of F0-2 mated with wild-type male rabbits, FIG. 4C shows the sequencing results of F1-191117#3, 4, 5, and FIG. 4D shows the sequencing results of F1-200115#3, 8, 12;

FIG. 5A shows 3 months old wild type rabbits (left) and WAS generations F0 ^-/ Rabbit (Right), WAS ^-/ The rabbits had poor mental status and obstructed breathing, and FIG. 5B shows the WAS generation F0 at the age of 5 months ^-/ Rabbits, severe asthma, hind limb articular abnormality, FIG. 5C is the F1 WAS generation at 1 month of age ^-/ Rabbit, severe asthma, poor mental status;

FIG. 6A shows WAS generation F0 ^-/- Skin of rabbit back with skin eczema shown in the dotted frame portion, fig. 6B shows skin of WT rabbit back, fig. 6C shows 5 months old WAS generation F0 ^-/ Rabbits developed infected and swollen hind limbs, FIG. 6D is a 15-day-old F1-generation WAS ^-/ Hind limbs with infection and swelling;

FIG. 7 is a growth curve, WAS, of F1 generation rabbits ^-/ The growth ability of rabbits is obviously inferior to that of WAS ^-/+ Rabbits and WT rabbits;

FIG. 8 is the survival curve, WAS, of F1 rabbit ^-/ The survival of the rabbits WAS clearly inferior to WAS ^-/+ And WT rabbits; about one month, WAS ^-/ The survival rate of the rabbits is less than 20 percent;

FIG. 9A shows WAS protein expression in thymus, FIG. 9B shows WAS protein expression in spleen, and β -actin is an internal reference protein;

FIG. 10A shows the number of CD8+ T cells in peripheral blood of WT rabbits, and FIG. 10B shows WAS ^-/ Peripheral blood CD8+ T cell number, WAS, in rabbits ^-/ Significantly less peripheral blood CD8+ T cells than WT;

FIG. 11A shows HE staining of WT kidney showing no significant inflammatory cell infiltration, FIG. 11B shows HE staining of WT kidney showing no significant tubule shape, and FIG. 11C shows WAS ^-/ Renal HE staining results of (1), WAS ^-/ The kidneys showed significant inflammatory cell infiltration, and FIG. 11D is WAS ^-/ Renal HE staining results of (1), WAS ^-/ The kidney has a distinct renal tubule type;

FIG. 12A shows the lung HE staining results of WT and FIG. 12B shows WAS ^-/ Lung HE staining results, WAS ^-/ Most of the alveoli collapse, inflammatory exudation in the alveoli cavity, large numbers of neutrophils and alveoliFoam cells (indicated by black dashed arrows) and local lung abscess formation (indicated by black solid arrows) are visible.

Detailed Description

To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention.

The examples do not specify particular techniques or conditions, and are to be construed in accordance with the description of the art in the literature or with the specification of the product. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

Example 1 design and construction of CRISPR/Cas9 Gene editing System

(1) Designing gRNA

In this example, first, the homology between rabbit WAS gene and human WAS gene, and the site with higher mutation frequency of WAS gene causing Wiskott-Aldrich syndrome reported at present were analyzed, and the target site around exon 2 and exon 7 of rabbit WAS gene WAS determined;

downloading a rabbit WAS gene sequence from NCBI, selecting target sites around exon 2 and exon 7 according to the selection requirement of a spCas9 gene target site and the transcription requirement of a pT7-gRNA in-vitro transcription vector, and designing to obtain two gRNAs (gRNA1 and gRNA2), wherein the sequences are partial sequences of exon 2 and exon 7 of the rabbit WAS gene as shown in figures 1A and 1B, and the high-light sequences are target sequences of gRNA1 and gRNA2 respectively;

gRNA1(SEQ ID NO:1)：ACTTCATCCGCCTTTACGGC；

gRNA2(SEQ ID NO:2)：ACAAACTGGCCCACTGTCC。

(2) construction of CRISPR/Cas9 Gene editing System

Adopting BbsI restriction enzyme to perform enzyme digestion to obtain a linearized pT7-gRNA in vitro transcription vector, and using a DNA purification recovery kit (magenta) to perform DNA gel recovery according to the instruction provided by a manufacturer; connecting the designed gRNA1 and gRNA2 with a linearized pT7-gRNA in vitro transcription vector respectively; transforming and plating a ligation product, selecting a monoclonal, extracting a plasmid by using a plasmid miniprep extraction kit (Aiji) according to the instructions provided by a manufacturer, and verifying the sequence to be correct for later use; obtaining gRNA by in vitro transcription with T7 Quick High Yield RNA Synthesis Kit (NEB) Kit;

obtaining a linearized spCas9 plasmid (MLM3613) by adopting a pmei restriction enzyme digestion, and performing DNA gel recovery by using a DNA purification recovery kit (magenta) according to the instruction provided by a manufacturer; using mMESSAGE

T7 Kit and e.coli poly (a) polymerase (neb) Kit for in vitro transcription and tailing of linearized recovered spCas9 plasmid, respectively;

a CRISPR/Cas9 gene editing system of the rabbit WAS gene is constructed, and a schematic diagram is shown in FIG. 2.

Example 2 WAS Gene editing efficiency preliminary estimate of CRISPR/Cas9 Gene editing System

Collecting and selecting rabbit fertilized eggs before and after a prokaryotic period for later use; preparing a micro-operation needle comprising a fixing needle and an injection needle; mixing gRNA and Cas9mRNA according to the proportion of gRNA1 to gRNA2 to Cas9mRNA being 15 ng/muL to 200 ng/muL, and injecting a gRNA and Cas9mRNA mixture to the cytoplasm of rabbit fertilized eggs before and after the prokaryotic stage; culturing the injected fertilized eggs in an incubator, collecting embryos after about 4 days, cracking the fertilized eggs in a PCR instrument by using NP40 lysate (0.45% NP40 and 60 mu g/mL proteinase K), and performing conventional PCR or nested PCR by using a cracking product as a template, wherein PCR primers are shown as SEQ ID NO: 3-9;

WAS-2F(SEQ ID NO:3)：CCTCCTCACCTTCCTTCGG；

WAS-2R(SEQ ID NO:4)：TTCTAGGGTTCAGGGATTTGCT；

WAS-7F(SEQ ID NO:5)：ATGGTTATTAATGGTTTATGGGATC；

WAS-7R(SEQ ID NO:6)：CATGGTATGTGACTTATTTGCCTCT；

WAS-7F-N1(SEQ ID NO:7)：ACGACCAGACCAGACCCACT；

WAS-7F-N1-1(SEQ ID NO:8)：TACATTGAACCACTTGGACCCCT；

WAS-7R-N1(SEQ ID NO:9)：TCATAAGCCACCCCCCTTCATC。

the results are shown in table 1, after RNA injection, no obvious influence is caused on embryonic development, and gene editing efficiency of gRNA is good, so that gRNA1 and gRNA2 are adopted in subsequent establishment of Wiskott-Aldrich syndrome rabbit model, and the RNA injection dosage is according to the ratio of gRNA1: gRNA2: Cas9mRNA, 15ng/μ L:200ng/μ L.

TABLE 1 embryonic development and Gene editing efficiency of the Gene editing System

Example 3 construction of Wiskott-Aldrich syndrome Rabbit model

(1) Fertilized egg microinjection

Collecting and selecting rabbit fertilized eggs before and after a prokaryotic period for later use; preparing a micromanipulation needle which comprises a fixing needle and an injection needle; mixing gRNA and Cas9mRNA according to the proportion of gRNA1, gRNA2, Cas9mRNA (15 ng/muL), 15 ng/muL and 200 ng/muL, and injecting a mixed solution of the gRNA and the Cas9mRNA into the cytoplasm of the rabbit fertilized eggs before and after the prokaryotic stage; and culturing the injected fertilized eggs in an incubator, and selecting embryos in good states to be transplanted into female rabbits.

(2) Delivery and nursing

Embryo transplantation for about 15 days, and judging whether the female rabbit of the receptor is pregnant; the pregnant receptor female rabbits are properly added with feed and green feed such as carrots, green vegetables and the like to ensure the nutritional requirements of the female rabbits; about 28 days after transplantation, the pregnant rabbits were transferred to a breeding cage and prepared for production.

(3) Young rabbit genotype identification

And (3) taking ear marginal tissues of newborn rabbits, extracting genomes by using a blood and tissue cell gene extraction kit (Tiangen), and carrying out PCR detection, wherein PCR primers WAS-2F, WAS-2R, WAS-7F and WAS-7R are shown as SEQ ID NO: 3-6.

WAS gene editing in F0 litter is shown in Table 2.

TABLE 2 WAS Gene editing statistics for F0 baby rabbits

Through PCR amplification and sequencing identification, as shown in FIG. 3, 9 young rabbits undergo gene editing at a target site (only F0-6 is not edited), and samples with set peaks are sequenced through TA cloning, so that the specific editing conditions of the 10 young rabbits are finally determined: the litter size in which both alleles of the WAS gene are frameshifted (it is sufficient that one of exon 2 and exon 7 is biallely edited; for convenience of description, the "WAS biallelic knock-out" appearing hereinafter means WAS gene because WAS gene is located on X chromosome ^-/- Or WAS ^-/ Genotype): f0-1 (WAS) ^-/- )、F0-2(WAS ^-/- )、F0-3(WAS ^-/ )、F0-4(WAS ^-/- )、F0-5(WAS ^-/ ) And F0-9 (WAS) ^-/ )。

Example 4 feeding and Breeding of WAS Gene-edited rabbits

The median survival time of Wiskott-Aldrich syndrome patients is only 10-15 years without receiving treatment, so the WAS gene editing rabbits need extra attention to the disease condition and survival condition of the WAS double allele knockout rabbits except for taking care according to a conventional process.

For better characterization and to enable the animal model to reflect the real situation more accurately, after the F0 generation of gene editing rabbits grow to the right age, F0-4 and F0-2 are combined with wild male rabbits in a cage, as shown in FIG. 4A and FIG. 4B, 8 young rabbits (F0-4 female and WT) (the young rabbits are numbered F1-191117# N, and N is 1, 2,3 … 8) and 12 young rabbits (F0-2 female and WT) (the young rabbits are numbered F1-200115# N, and N is 1, 2,3 … 12) are obtained respectively. Since the WAS gene is located on the X chromosome, the sex of F1 needs to be recorded, and the genotype is WAS ^-/ The F1 rabbit has to pay high attention to the attack and survival situation, and the genotype of the F1 generation is identified by the same method as that of the F0 generation.

The sequencing results are shown in FIGS. 4C and 4D, and the genotypes of F1-191117#3, 4 and 5 are WAS ^-/ All three rabbits had 13bp deletion of exon 2 and 1bp addition of exon 7; the genotypes of F1-200115#3, 8 and 12 are WAS ^-/ The three rabbits were all large-fragment deletions spanning exons 2 and 7In addition, 2641bp of F1-200115#3 and 2629bp of F1-200115#8 and 12 were deleted.

Example 5 phenotypic characterization of WAS double allele knock-out rabbits

(1) Viability and growth Capacity analysis

Paying attention to the health condition of the WAS double allele knockout rabbit in real time, and taking pictures and recording when necessary; regularly recording the weight change and death number of the WAS double allele knockout rabbits from birth of newborn rabbits, and making a growth curve and a survival curve; heterozygous rabbits of the same litter or similar age as the wild-type rabbits as controls;

the results indicate that WAS biallelic knockout rabbits were significantly inferior in viability and growth to wild-type rabbits, as shown in fig. 5A, F0 WAS increasingly worried about health over time from about 3 months of age, with poor mental status, poor respiration, and were more susceptible to infection than littermate wild-type rabbits (WT) and subsequently died almost all of them from severe pneumonia, some of which also showed joint abnormalities and severe asthma (fig. 5B) and back eczema (fig. 6A, fig. 6B); while the health of the WAS biallelic knockout F1 rabbits WAS less optimistic, as shown in fig. 5C, 6C, and 6D, with earlier onset of the condition compared to the F0 generation.

FIG. 7 is a growth curve of F1 generation rabbits, and it can be seen that WAS is observed during the observation period ^-/ The growth ability of the rabbits is obviously inferior to that of WAS ^-/+ Rabbits and WT rabbits.

FIG. 8 is a survival curve of F1 generation rabbits, and it can be seen that WAS is observed during the observation period ^-/ The survival of the rabbits WAS significantly inferior to that of the WAS ^-/+ And WT rabbits; about one month, WAS ^-/ The survival rate of the rabbits is less than 20%.

(2) Phenotypic analysis of protein levels

Spleen and thymus tissues of WAS biallelic gene knockout rabbits were taken, histones were extracted with RIPA lysate (VETEC) according to the instructions provided by the manufacturer, Protein quantification WAS performed with BCA Protein Assay Kit (Biyun day) according to the instructions provided by the manufacturer, and expression of WAS Protein (WASP) WAS detected by western blotting, which WAS performed as follows:

adding 5 Xloading buffer (20: 1 mercaptoethanol before use), boiling protein, performing SDS-PAGE gel electrophoresis, transferring membrane, shaking and sealing with 5% skimmed milk powder (2.5g milk powder +50mL TBST) at room temperature for about 2h, incubating with WASP antibody (B-9) (1:2000) diluted with 5% skimmed milk powder at room temperature for 2h or overnight at 4 deg.C, washing with TBST for 4 times, incubating with secondary antibody (1:2000) diluted with 5% skimmed milk powder at room temperature for 1h, washing for 4 times, and performing chemiluminescence development; heterozygous and wild-type rabbits of the same litter or similar age were used as controls.

As shown in FIG. 9A, the expression of WAS protein in thymus, F0-1 (WAS) ^-/- )、F0-3(WAS ^-/ )、F1-191117#4(WAS ^-/ ) And F1-191117#5 (WAS) ^-/ ) Did not detect WAS protein expression in the thymus, whereas heterozygote F1-191117#1 (WAS) ^+/- ) The expression of WAS protein is detected in the thymus, but the expression amount of WAS protein is obviously reduced compared with the wild type; as shown in FIG. 9B, the expression of WAS protein in spleen, F0-1 (WAS) ^-/- )、F0-3(WAS ^-/ )、F0-9(WAS ^-/ )、F1-191117#4(WAS ^-/ ) And F1-191117#5 (WAS) ^-/ ) WAS not detected in the spleen.

(3) Routine blood test

Extracting the ear artery blood of the WAS gene knockout rabbit into an anticoagulation tube, detecting the blood routine in an animal house or a Foshan dean detection company in Guangzhou biomedicine and health research institute, and analyzing whether the blood biochemical indexes of the WAS double allele knockout rabbit such as blood platelet, lymphocyte, neutrophil, hemoglobin and the like are abnormal; heterozygous and wild-type rabbits of the same litter or similar age were used as controls.

As shown in Table 3, the WAS knockout rabbit lymphocytes are significantly reduced, and the platelets are severely reduced, and the average platelet number is less than half of that of the wild type.

Table 3F 0 blood general data

(4) Peripheral blood T lymphocyte analysis

Extracting the ear edge arterial blood of the WAS gene knockout rabbit in an anticoagulation tube, separating lymphocytes by using erythrocyte lysate, and analyzing the number of T cells by flow cytometry, wherein the steps are as follows:

blocking, incubating a Mouse Anti Rabbit CD8 antibody on ice for 30min, washing with PBS for 2 times, incubating an Anti-Mouse-IgG Fab2 secondary antibody copolymerized with Alexa Fluor 488 on ice for 30min, washing with PBS for 3 times, and performing flow analysis on a computer; heterozygous and wild-type rabbits of the same litter or similar age were used as controls.

As a result, WAS is shown in FIGS. 10A and 10B ^-/ The number of peripheral blood CD8+ T cells was significantly less than WT.

(5) Anatomical and histological phenotypic analysis

Dissecting dead WAS double allele knockout rabbits, observing the change of each visceral organ, photographing related tissues if necessary, and determining which visceral organs to sample according to specific conditions; flushing the sampled tissue with normal saline or PBS for three times, removing residual blood, fixing in 4% neutral formaldehyde, dehydrating, embedding paraffin, slicing, and performing HE staining; heterozygous and wild-type rabbits of the same litter or similar age were used as controls.

FIGS. 11A and 11B show HE staining of WT kidney, and FIGS. 11C and 11D show WAS ^-/ As shown in fig. 11A and fig. 11C, the WAS double allele knock-out rabbit kidneys showed significant inflammatory cell infiltration (fig. 11C, indicated by black solid arrows); as can be seen in FIGS. 11B and 11D, the WAS double allele knock-out rabbit kidney had a clear tubule pattern (FIG. 11D indicated by the black dashed arrow).

FIGS. 12A and 12B are WT and WAS ^-/ As a result of lung HE staining, it WAS found that the WAS biallelic knockout rabbit had severe lung infection, collapsed alveoli, inflammatory exudation in alveolar cavities, abundant neutrophils and foam cells (indicated by black dashed arrows in FIG. 12B), and localized lung abscess formation (indicated by black solid arrows in FIG. 12B).

In conclusion, the invention successfully generates the first Wiskott-Aldrich syndrome rabbit model by editing the WAS gene of the rabbit zygote by using a CRISPR/Cas9 gene editing system. These Wiskott-Aldrich syndrome rabbits completely deleted the WAS protein, mimicking WisTypical symptoms of patients with kott-Aldrich syndrome include severe thrombocytopenia and peripheral CD8 ⁺ T cell depletion, severe infection and greatly reduced survival; in addition, we observed eczema, renal abnormalities and joint abnormalities. Compared with a related mouse model, the WAS protein-deficient rabbit constructed by the invention can more accurately simulate the disease symptoms of Wiskott-Aldrich syndrome patients, and has important significance in the research of Wiskott-Aldrich syndrome pathogenesis and clinical treatment.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

SEQUENCE LISTING

<110> Guangzhou biomedical and health research institute of Chinese academy of sciences

gRNA of <120> WAS gene and application thereof

<130> 20200703

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<400> 1

acttcatccg cctttacggc 20

<210> 2

<211> 19

<212> DNA

<213> Artificial sequence

<400> 2

acaaactggc ccactgtcc 19

<210> 3

<211> 19

<212> DNA

<213> Artificial sequence

<400> 3

cctcctcacc ttccttcgg 19

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence

<400> 4

ttctagggtt cagggatttg ct 22

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence

<400> 5

atggttatta atggtttatg ggatc 25

<210> 6

<211> 25

<212> DNA

<213> Artificial sequence

<400> 6

catggtatgt gacttatttg cctct 25

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<400> 7

acgaccagac cagacccact 20

<210> 8

<211> 23

<212> DNA

<213> Artificial sequence

<400> 8

tacattgaac cacttggacc cct 23

<210> 9

<211> 22

<212> DNA

<213> Artificial sequence

<400> 9

tcataagcca ccccccttca tc 22

Claims

1. A gRNA with a WAS gene knocked out, wherein a target sequence of the gRNA is positioned in exon 2 and exon 7 of the WAS gene;

the gRNA is a nucleic acid sequence shown as SEQ ID NO. 1 and SEQ ID NO. 2.

A gRNA expression vector, comprising the gRNA of claim 1.

3. A vector composition comprising the gRNA expression vector of claim 2;

the vector composition also includes a Cas9 expression vector.

4. A CRISPR/Cas9 gene editing system, comprising the gRNA of claim 1;

the gene editing system also includes Cas9 mRNA.

5. The CRISPR/Cas9 gene editing system according to claim 4, characterized in that the gRNA: 2, and the nucleic acid sequence shown as SEQ ID NO: the mass ratio of Cas9mRNA was 1.5:1.5: 20.

6. A WAS gene editing method, comprising:

transfecting the CRISPR/Cas9 gene editing system of claim 4 or 5 into a rabbit zygote, and carrying out rabbit WAS gene editing.

7. Use of a gRNA of claim 1, a gRNA expression vector of claim 2, a vector composition of claim 3, or a CRISPR/Cas9 gene editing system of claim 4 or 5 in the construction of a Wiskott-Aldrich syndrome model organism;

the model organism is a rabbit.