CN112889754A

CN112889754A - Construction method and application of glycogen accumulation disease Ib type gene point mutation mouse model

Info

Publication number: CN112889754A
Application number: CN202011373958.7A
Authority: CN
Inventors: 邵咏贤; 刘丽; 徐佳南; 梁翠丽
Original assignee: Guangzhou Women and Childrens Medical Center
Current assignee: Guangzhou Women and Childrens Medical Center
Priority date: 2020-11-30
Filing date: 2020-11-30
Publication date: 2021-06-04

Abstract

The invention relates to the technical field of animal model construction, in particular to a construction method and application of a glycogen storage disease Ib type gene point mutation mouse model. A homozygote mouse model with the point mutation of the SLC37A4 gene is obtained by hybridizing a heterozygote mouse with the point mutation of the SLC37A4 gene with a wild mouse of other strains, and is used for truly simulating the clinical symptoms of a patient with the glycogen storage disease Ib caused by the defect of the SLC37A4 gene caused by the point mutation of the SLC37A4 gene. The point mutation mouse model obtained by the construction method can be applied to research on the pathogenesis of the glycogen storage disease Ib and development of medicaments for treating the glycogen storage disease Ib.

Description

Construction method and application of glycogen accumulation disease Ib type gene point mutation mouse model

Technical Field

The invention relates to the technical field of animal model construction, in particular to a construction method and application of a glycogen storage disease Ib type gene point mutation mouse model.

Background

Type I glycogen storage disease (GSD I) is a genetic metabolic defect disease due to a gene mutation causing decreased enzyme potency of glucose-6-phosphatase (G6 Pase), glycogenolysis and gluconeogenic metabolic abnormalities, is the most common type of glycogen storage disease in the liver, and is a monogenetic disease listed in the first group of rare disease catalogues of the country. Clinically, the children with the symptoms of growth and development retardation, hypoglycemia, hepatomegaly, hyperlactacidemia, hyperuricemia, hypertriglyceridemia, metabolic acidosis and the like are mainly shown, and the children with the symptoms are often dead from severe hypoglycemia and metabolic acidosis.

GSDIs are classified into types Ia and Ib according to the causative gene. GSDIa is caused by a defect in the G6PC gene encoding the glucose-6-phosphatase catalytic subunit (G6-phosphatase catalyst, G6 PC); GSDlb is caused by a defect in the SLC37A4 gene encoding the glucose-6-phosphatase transporter (G6 PT). The SLC37A4 gene is located on human chromosome 11q23, has a full length of 4.5kb, contains 9 exons, encodes a glucose-6-phosphatase transporter (G6PT) protein containing 429-451 amino acids, and is expressed systemically. G6PC and G6PT are intracellular omentum proteins, and G6PT is responsible for the transport of glucose-6-phosphate (G6P) from the cell cytoplasm to the lumen of the endoplasmic reticulum, so that G6P is decomposed into glucose and phosphate by G6 PC. G6PC together with the G6PT complex constitute glucose-6-phosphatase (G6 Pase). G6Pase is an important enzyme in gluconeogenesis pathway, and congenital defects of the enzyme can affect gluconeogenesis pathway and glycogen degradation link in children, so that glycogen is accumulated in liver to cause hepatomegaly and liver dysfunction, and a series of metabolic disorders such as hypoglycemia, high lactate blood disease, triglyceride blood, hypercholesterolemia, hyperuricemia and the like are caused. In addition, the G6PT deficient GSDlb patients also have symptoms such as neutropenia and/or neutropenia, and the dysfunction of the immune system causes the recurrent bacterial infection of the children patients, so the mechanism is not completely clear and needs to be researched.

At present, GSDlb has no effective drug therapy and mainly depends on the meal intake of raw corn starch and the restriction of the intake of monosaccharide, lipid and high protein. Symptoms of infection provide supportive treatment by symptomatic treatment and long-term injection of granulocyte colony stimulating factor (G-SCF) to stimulate neutrophil growth. Repeated infection caused by immunodeficiency affects the life quality of the GSDlb infant and is the main cause of death of the GSDlb infant. The research on the mechanism of immunodeficiency generation caused by SLC37A4 gene defect is expected to provide a new targeted treatment scheme for GSDlb patients through precise medical treatment, and improve the survival rate and the survival quality of children patients. A suitable animal model of the disease is the basis for the development of new treatment regimens and for the development of preclinical treatment studies.

Two mouse models with SLC37A4 gene mutations have been reported internationally before. A whole-body SLC37a4 gene conditioned knockout mouse as first reported in 2003, which essentially mimics clinical characteristics, but requires a special feeding regimen of glucose every 12 hours to survive to weaning; according to the report of 2018, SLC37A4 gene knockout mice with small intestine, liver and bone marrow conditions are constructed respectively, the mice have good survival state and can survive for 6 months, but the clinical symptoms are light, and clinical patients are difficult to simulate. The two SLC37A4 gene-deficient mouse models are constructed by knocking out SLC37A4 gene systemically or tissues through gene editing technology, actually, the mode of causing SLC37A4 gene deficiency in GSDI b patients has obvious regionality, and not all SLC37A4 gene deficiencies of GSDI b patients can be simulated through knocking out the mode, for example, SLC37A4 gene deficiency in China is caused by point mutation of the gene, so the SLC37A4 gene-deficient mouse model obtained through gene knocking out cannot be used for precise medical research.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide a construction method of a glycogen storage disease Ib type gene point mutation mouse model, which obtains a homozygote mouse model with SLC37A4 gene point mutation by means of hybridizing a heterozygote mouse with the SLC37A4 gene point mutation with a wild type mouse of other strains, and is used for truly simulating the clinical symptoms of a glycogen storage disease Ib patient caused by the SLC37A4 gene defect caused by the SLC37A4 gene point mutation. The point mutation mouse model obtained by the construction method can be applied to a plurality of fields such as drug development of glycogen storage disease Ib type and the like.

The invention is realized by the following steps:

the invention provides a construction method of a glycogen storage disease Ib type gene point mutation mouse model, which comprises the steps of hybridizing a heterozygote mouse with SLC37A4 gene point mutation with wild type mice of other strains, screening a heterozygote mutation mouse in an F1 generation, and obtaining an SLC37A4 gene point mutation homozygote mutation mouse in an F2 generation through self-crossing screening of an F1 generation.

In an alternative embodiment, the SLC37a4 gene point mutation is a point mutation in the amino acid sequence of the protein p.gly149glu encoded by the SLC37a4 gene.

Typically, but not limited to, as a result of the point mutation of the SLC37A4 gene, the SLC37A4 gene encodes the protein p.Gly149Glu, the 149 th glycine point of which is mutated into glutamic acid, compared with the wild type mouse, so that the homozygous mouse with the SLC37A4p.Gly149Glu gene is obtained, and the amino acid sequence of the protein after the point mutation is shown as SEQ ID No. 1. In addition, other genotypes causing defects of the SLC37A4 gene can be constructed, including homozygous mice with mutation of arginine at position 28 to cysteine, glycine at position 115 to arginine, or proline at position 191 to leucine.

The SLC37A4 gene point mutation comprises that the 446 th nucleotide of the SLC37A4 gene is mutated from G to A, the nucleotide sequence of the SLC37A4 gene after point mutation is shown in SEQ ID No.2, or the 446 th nucleotide of the SLC37A4 gene is mutated from G to A, and simultaneously, the 447 th nucleotide is mutated from A to G.

The construction method of the glycogen storage disease Ib type gene point mutation mouse model comprises the step of obtaining a heterozygous mouse with SLC37A4 gene point mutation by a gene editing method.

The gene editing method for obtaining the SLC37A4 gene point mutation heterozygous mouse comprises the step of obtaining the SLC37A4 gene point mutation heterozygous mouse by adopting a CRISPR-Cas9 method.

Preferably, the CRISPR-Cas9 method comprises the steps of injecting a vector carrying DNA sequences encoding Cas9 mRNA and sgRNA and an SLC37A4 gene point mutation donor oligo sequence into mouse fertilized eggs, then transplanting for pregnancy, and screening the produced mice to obtain hybrid mice with SLC37A4 gene point mutation.

Preferably, the Cas9 mRNA sequence comprises the sequence shown in SEQ ID No. 3.

Preferably, the donor oligo sequence comprises the sequence shown in SEQ ID No. 4; the sequence as a DNA sequence for repairing connection comprises the point mutation base of the 446 th nucleotide of the SLC37A4 gene from G to A and the base sequence of the vicinity thereof, and has high matching degree with the SLC37A4 gene sequence.

Preferably, the screening is performed by means of gene sequencing.

Preferably, the upstream primer and the downstream primer used for gene sequencing respectively comprise sequences shown as SEQ ID No.5 and SEQ ID No. 6.

Preferably, the vector comprises pRP [ CRISPR ] -hCas 9-U6.

The sgRNA sequence usually adopts a bidirectional guide sequence, and the invention selects a unidirectional guide sequence comprising a sequence shown by a reverse sequence SEQ ID No.7, because the invention also expects to obtain mouse offspring with long survival time while obtaining a point mutation genotype, the bidirectional guide sequence has the advantages of accurate targeting and difficult off-target, but the bidirectional guide mode easily generates gene knockout mice, has short survival time and is not beneficial to developing medium and long-term living experiments, and the invention only selects the unidirectional guide sequence to introduce the point mutation gene and then carries out screening by sequencing, thereby obtaining the mouse offspring carrying the target point mutation.

Preferably, the hybrid mouse strain with the SLC37A4 gene point mutation comprises a C57BL/6 strain, the gene of the mouse and the human of the strain has extremely high similarity, and the strain is stable and easy to propagate. In addition, the homology of the mouse SLC37A4 gene and the human SLC37A4 gene reaches more than 90 percent, and the strain is suitable for being used as a disease model research.

The wild type mouse strain for mating with the hybrid mouse with the SLC37A4 gene point mutation comprises C57BL/6 and DBA/2.

Preferably, the wild type mouse strain is a DBA/2 strain, after the wild type mouse strain of the DBA/2 strain is hybridized with a heterozygote mouse with the SLC37A4 gene point mutation of the C57BL/6 strain, the survival cycle of the homozygous mouse with gene defect in the F2 generation can be prolonged, the offspring can have longer life when being used as a model mouse without special feeding, and the requirement of more researches can be met.

The SLC37A4 gene point mutation homozygote mouse obtained by the construction method is applied to development of medicines or pathological researches of glycogen storage disease Ib type caused by SLC37A4 gene defects.

The invention has the following beneficial effects:

the invention also provides a construction method of the glycogen storage disease Ib type gene point mutation mouse model, which is characterized in that heterozygote mice with SLC37A4 gene point mutation are hybridized with wild type mice of other strains, so that the birth rate of mutant mice of offspring can reach or approach to the expected Mendelian ratio. Meanwhile, two mice with different genetic backgrounds are adopted for hybridization, the survival condition of the F2 mouse after birth is improved, the average survival time under the condition of no special glucose feeding is prolonged, the propagation scale can be reduced by prolonging the survival time, the animal identification and use quantity can be reduced, the research and development cost of clinical pre-drug treatment experiments is greatly reduced, and the research and development efficiency is obviously improved.

The point mutation homozygote mouse model obtained by the invention can be applied to a plurality of fields such as pathological research of glycogen accumulation disease Ib type and drug development.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

Fig. 1 is the CRISPR/Cas9 vector carrying Cas9 mRNA sequence used in example 1;

FIG. 2 is a comparison of SLC37A4 gene sequences before and after editing a target gene using a CRISPR/Cas9 vector in example 1;

FIG. 3 shows the sequencing and identification results of the founder mouse gene in example 1, wherein A is the sequencing result of the wild C57BL/6 mouse, and B is the sequencing result of the founder mouse;

FIG. 4 is a diagram showing the sequencing result of the heterozygote gene of the F1 mouse;

FIG. 5 shows the results of gene sequencing of wild type mouse a, heterozygote mouse b and homozygote mouse c in F2 mouse;

FIG. 6 is a graph comparing the survival rates of F2 homozygote mutant mice obtained in example 1 and comparative example 1 at different times;

FIG. 7 shows biochemical characteristics of F2 wild-type mouse (WT), heterozygote mouse (HET), and homozygote mouse (HOMO) obtained in example 1;

FIG. 8 shows the liver glucose quantification and liver tissue section staining of F2 wild type mouse (WT), heterozygous mouse (HET), and homozygous mouse (HOMO) obtained in example 1;

FIG. 9 shows spleen cell neutrophil counts of F2 wild type mice (WT), heterozygote mice (HET), and homozygote mice (HOMO) obtained in example 1.

Detailed Description

In order that the invention may be more fully understood, reference will now be made to the following description. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. The various chemicals used in the examples are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

The SLC37A4 gene knockout mutation mouse model is important for developing new treatment schemes for type Ib glycogen storage disease and developing preclinical treatment researches, however, SLC37A4 gene point mutation knock-in mice are lacking at present. For this reason, the inventors conducted extensive research and attempts to construct the world first glycogen accumulation disease lb point mutation mouse model by constructing a slc37a4p.gly149glu missense mutation mouse model based on the C57BL/6 strain, crossing it with DBA/2, and selfing the resulting F1 heterozygote progeny to obtain homozygous mutant mice. Particularly, compared with a C57BL/6 pure background SLC37A4p.Gly149Glu missense mutant mouse, the complete version of the method of the invention improves the postnatal survival condition of the homozygous mutant mouse, prolongs the average survival period without special glucose feeding, is greatly convenient for the development of a research scheme, greatly reduces the research and development cost of a preclinical drug treatment experiment, obviously improves the research and development efficiency, and simultaneously increases the time window for the development of preclinical treatment research from average 0 day to average 10 days.

Example 1

The embodiment provides a method for constructing a glycogen storage disease Ib point mutation mouse model, which specifically comprises the following steps:

1. establishment of SLC37A4p.Gly149Glu point mutation heterozygote mice based on B6 strain (C57BL/6) mice by CRISPR/Cas9 technology

1.1 CRISPR/Cas9 targeting System

The similarity of the encoding protein of the mouse SLC37A4 gene and the encoding protein of the human SLC37A4 gene is more than 90 percent, and the 149 th amino acid glycine is highly conserved in the encoding protein of the mouse source and the encoding protein of the human source. Based on this, a reverse guide sequence (SEQ ID No.7) of the DNA for synthesizing the guide sgRNA and an oligonucleotide donor oligo sequence (SEQ ID No.4) for homologous recombination repair are designed, and the reverse guide sequence (SEQ ID No.7) of the DNA for encoding the guide sgRNA is connected into a vector, so as to obtain a targeting system pRP [ CRISPR ] -hCas9-U6, wherein the targeting system comprises a DNA sequence (SEQ ID No.3) for encoding Cas9 mRNA (shown in figure 1).

1.2 construction of SLC37A4p.Gly149Glu Point-mutated mice

(1) Obtaining fertilized eggs

1) Donor C57BL/6 females were sacrificed by cervical dislocation according to Standard protocols for euthanasia of laboratory animals.

2) The entire fallopian tube was excised and placed in a dish containing M2 medium.

3) The expanded ampulla is found out under a dissecting mirror and torn by forceps to obtain the fertilized egg.

4) Adding hyaluronidase to remove granular cells, transferring clean fertilized eggs to KSOM culture solution at 37 deg.C, culturing in 5% CO2, and performing microinjection.

(2) Prokaryotic injection

Cas9 mRNA and sgRNA obtained by in vitro transcription were mixed with oligonucleotide donor oligo and injected into C57BL/6 fertilized eggs. The method comprises the following specific steps:

1) a strip of M2 medium was drawn across the middle of the dish lid and covered with paraffin oil.

2) The fixing needle is fixed on the micromanipulator, the needle point of the fixing needle is in the middle of the visual field, and the front end of the fixing needle is filled with M2 culture medium.

3) The micro sample loading tube sucks a mixed sample of premixed Cas9 mRNA, sgRNA and oligonucleotide donor oligo and fills the mixed sample to the tip of the injection needle.

4) The injection needle was fixed to the micromanipulator with the needle tip centered in the field of view.

5) A group of two pronuclei well-formed fertilized eggs were picked, arranged in a straight line in M2 medium in a dish for injection, and placed on a stage.

6) And adjusting the fixing needle to the position of the fertilized egg, and adjusting a microscope to determine the prokaryotic position.

7) The direction of the injection needle is adjusted to ensure that the needle point of the injection needle is positioned on the same horizontal plane with the pronucleus, the injection needle is continuously pushed to penetrate through the zona pellucida and enter the pronucleus, and when the tip of the injection needle enters the pronucleus, proper air pressure is given to ensure that the injection liquid slowly flows into the pronucleus.

8) After all fertilized eggs are injected, the fertilized eggs are immediately transferred to a KSOM culture medium for culture, then a new batch of fertilized eggs are transferred to an injection chamber for injection until all the fertilized eggs are completely injected, the targeting system finishes editing the SLC37A4 gene in the fertilized eggs, and the SLC37A4 gene sequence pairs before and after editing are shown in figure 2.

(3) Replacement of pregnancy by transplanting fertilized egg

1) The pregnant female ICR mouse in the anaesthetized state was laid on the stage.

2) The iodophor disinfects the back of a pregnant mouse, a small opening is cut on the skin at the position of the last rib along the midline of the back by an ophthalmologic scissors, one side of the opening is clamped by a pair of tweezers, the ophthalmologic scissors are inserted between the skin and the muscle layer on the right side, the scissors are stretched to tear the mucous membrane, and a white fat pad or an orange ovary is found.

3) The body wall is clamped by No.5 ophthalmic forceps, a small opening is cut above the ovary, and the blunt separation is carried out by the forceps or the scissors. The fat pad was pulled out of the ovary, oviduct and uterus by grasping the fat pad with forceps, and the ovary, oviduct and uterus were exposed by grasping the fat pad with a fat clip.

4) And (4) sucking the fertilized eggs (with the M2 culture medium as little as possible) after the prokaryotic injection by using a transplanting tube.

5) The salpingemphraxis is found under a microscope, the ovarian cyst membrane is torn off by two No.5 tweezers above the salpingemphraxis, and the ovarian cyst membrane is exposed at the umbrella part.

6) The left hand clamps the umbrella mouth with a No.5 ophthalmic forceps, the right hand inserts the transplantation tube with the fertilized egg into the umbrella mouth of the fallopian tube, and then blows the embryo and the air bubble into the ampulla of the fallopian tube (if the air bubble is seen in the fallopian tube, the transplantation is successful).

7) The fat clips were loosened, the fat pads were grasped with blunt forceps, and the ovaries, fallopian tubes, and uterus were carefully returned to the body cavity.

8) After the implantation was completed, the skin was sutured with wound clips. The surrogate pregnant mouse is put in a clean mouse cage and is kept warm by an infrared warmer until the mouse is awakened.

(4) Genotyping of mutant mice

The first mouse carrying the expected mutation was identified by tail-like DNA PCR sequencing. The tail-like DNA was obtained by extraction with the conventional phenol chloroform method. The identification of the initial mouse can be realized by a PCR sequencing identification mode.

The primers for PCR amplification and sequencing are shown as SEQ ID No.5 and SEQ ID No. 6:

upstream primer (SEQ ID No. 5): GGCACTTGGGAGCACCTCTTCTTAC

Downstream primer (SEQ ID No. 6): ACCATTCCTTCGCCTACATCCAGT

Sequencing results see FIG. 3, which shows the sequencing results for wild C57BL/6 mice in A and the initial mice in B. It can be seen that the 446 bit nucleotide of the SLC37A4 gene in the wild C57BL/6 mouse is G, the amino acid coded by the codon GGA is glycine, the 446 bit nucleotide of the SLC37A4 gene in the first-built mouse is A, and the amino acid edited by the codon GAA is glutamic acid, namely the screened first-built mouse realizes the point mutation of p.Gly149Glu.

Progeny mutant mice (including F1 generation heterozygote mutant mice and F2 generation homozygote mutant mice described below) were also identified by PCR using primers of SEQ ID No.5 and SEQ ID No.6, and the reaction system is shown in Table 1. The PCR product is 637bp, and the genotype is verified by one-generation sequencing.

TABLE 1 SLC37A4 point mutation mouse gene identification reaction system

F1 generation heterozygote mutant mice

Crossing the SLC37A4 missense mutant heterozygote mouse in the background of the C57BL/6 strain constructed in step 1 with the wild-type mouse of the DBA/2 strain: c57BL/6.SLC37A4^KI/+×DBA/2.SLC37A4^+/+→B6D2.SLC37A4^KI/+、B6D2.SLC37A4^+/+Screening out the double genetic background F1 generation SLC37A4 missense mutation heterozygote B6D2.SLC37A4^KI/+A mouse. The identification method of heterozygote mutant mice of the F1 generation can employ PCR sequencing as described above. The identification result of heterozygote mutant mice is shown in figure 4, and the 446 th nucleotides of two alleles of SLC37A4 gene in F1 generation heterozygote mutant B6D2 mice are respectively G and A.

F2 generation homozygous mutant mouse

Selfing the F1 generation SLC37A4 missense mutation heterozygous male mice and female mice obtained in the step 2: B6D2.SLC37A4^KI/+×B6D2.SLC37A4^KI/+→B6D2.SLC37A4^KI/KI、B6D2.SLC37A4^KI/+、B6D2.SLC37A4^+/+Screening F2 generation homozygous mutant mouse (B6D2. SLC37A4)^KI/KI) And their littermate controls. The identification of F2 generation homozygous mutant mice can be performed by PCR sequencing as described above. The identification results of a wild mouse a, a heterozygote mouse b and a homozygote mouse c are shown in figure 5, wherein 446-bit nucleotides of two alleles of an SLC37A4 gene in an F2-generation wild mouse can be shown to be G, and amino acid coded by a codon GGA is glycine; 446 nucleotides of two alleles of the SLC37A4 gene in a heterozygote mouse are A and G respectively; the 446 nucleotide of both alleles of the SLC37A4 gene in homozygous mice is A and the amino acid encoded by codon GAA is glutamic acid.

The actual birth and survival statistics of the homozygous progeny in this example are shown in table 2 below:

TABLE 2 actual birth and survival of homozygous mutant mice in F2 mouse generations

In the table, N is the number of observations; p0, day of birth; p1, day of birth; p7, one week after birth; p14 at day 14 after birth.

As can be seen from FIG. 6, the homozygote mice in the F2 generation mice of this example survived for a maximum of 18 days, providing a sufficient drug action window for the development of postnatal drug therapy studies.

FIG. 7 provides a comparison of body length (Height), body Weight (Weight), liver Weight/body Weight Ratio (Ratio of lever Weight), hemogram and biochemical indicators for the disease model F2 generation, wild-type, heterozygous and homozygous mice, wherein the indicators for A-O are body length (Height), body Weight (Weight), liver Weight/body Weight Ratio (Ratio of lever Weight), White Blood Cells (WBC), Red Blood Cells (RBC), Platelets (PLT), Lymphocytes (LYMPH), Neutrophils (NEUT), neutrophil percentage (NEUT%), blood Glucose (Glucose), alanine Aminotransferase (ALT), aspartate Aminotransferase (AST), Lactate (LAC), r-glutamyltransferase (r-GT) and Triglyceride (TG), respectively. As can be seen from the data, the homozygote mice have obvious growth and development retardation, hypoglycemia, hepatomegaly, liver enzyme increase, lactic acid and triglyceride increase and neutrophilic granulocyte decrease compared with wild type/heterozygote mice, and the clinical symptoms of the homozygote mice are consistent with those of children suffering from glycogen storage disease Ib. FIG. 8 provides the liver glycogen quantification (A) and liver HE staining, PAS glycogen staining, oil red O staining and electron microscope identification results (B) of wild type, heterozygote and homozygote mice of the disease model F2 generation, and the data show that the liver of the homozygote mice has obvious glycogen accumulation and oil drop increase compared with the liver of the wild type/heterozygote mice, and the electron microscope examination result shows that the endoplasmic reticulum and other organelles in the liver cells of the homozygote mice have obvious changes. FIG. 9 provides a comparison of the number of splenic neutrophils in wild type, heterozygous and homozygous mice for the disease model F2, and it can be seen that the number of splenic neutrophils in homozygous mice is significantly less than in wild type/heterozygous mice.

Comparative example 1

The comparative example provides a method for constructing a glycogen storage disease Ib point mutation mouse model, which comprises the following steps:

1. SLC37A4p.Gly149Glu point mutation heterozygote mice were established based on C57BL/6 strain mice by CRISPR/Cas9 technology. The procedure is as in example 1.

2. Directly selfing the point mutation heterozygote mice obtained in the step 1: c57BL/6.SLC37A4^KI/+×C57BL/6.SLC37A4^KI/+Obtaining mutant mouse C of point mutation homozygote of glycogen accumulation disease Ib57BL/6.SLC37A4^KI/KI. The statistics of birth and survival of the homozygous progeny in comparative example 1 are given in table 3 below:

TABLE 3 statistical Table of birth and survival of homozygous progeny of comparative example 1

As can be seen from Table 3, the average longest survival time of the homozygous mutant mice born in comparative example 1 is shorter than that of example 1, which is only 1 day, and thus the homozygous mutant mice are difficult to be used in preclinical treatment studies.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

SEQUENCE LISTING

<110> Guangzhou city women's medical center (Guangzhou city women's health care hospital, Guangzhou city children hospital, Guangzhou city women's infant hospital, Guangzhou city women's health care family planning service center)

<120> construction method and application of glycogen accumulation disease Ib type gene point mutation mouse model

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 429

<212> PRT

<213> Artificial sequence

<400> 1

Met Ala Ala Gln Gly Tyr Gly Tyr Tyr Arg Thr Val Ile Phe Ala Ala

1 5 10 15

Met Phe Gly Gly Tyr Ser Leu Tyr Tyr Phe Asn Arg Lys Thr Phe Ser

20 25 30

Phe Val Met Pro Ser Leu Val Asp Glu Ile Ala Leu Asp Lys Asp Asp

35 40 45

Leu Gly Leu Ile Thr Ser Ser Gln Ser Ala Ala Tyr Ala Ile Ser Lys

50 55 60

Phe Val Ser Gly Val Leu Ser Asp Gln Met Ser Ala Arg Trp Leu Phe

65 70 75 80

Ser Ser Gly Leu Leu Leu Val Gly Leu Val Asn Val Val Phe Ser Trp

85 90 95

Ser Ser Thr Val Ser Ala Phe Ala Ala Leu Trp Phe Leu Asn Gly Leu

100 105 110

Ala Gln Gly Leu Gly Trp Pro Pro Cys Gly Lys Ile Leu Arg Lys Trp

115 120 125

Phe Glu Pro Ser Gln Phe Gly Thr Trp Trp Ala Val Leu Ser Thr Ser

130 135 140

Met Asn Leu Ala Glu Ser Leu Gly Pro Ile Leu Ala Thr Ile Leu Ala

145 150 155 160

Gln Ser Tyr Ser Trp Arg Ser Thr Leu Ala Leu Ser Gly Ala Leu Cys

165 170 175

Val Val Val Ser Phe Phe Cys Leu Leu Leu Ile His Asn Glu Pro Ala

180 185 190

Asp Val Gly Leu Arg Asn Leu Asp Pro Ala Pro Ser Lys Gly Lys Lys

195 200 205

Gly Ser Ser Lys Glu Glu Ser Thr Leu Gln Asp Leu Leu Leu Ser Pro

210 215 220

Tyr Leu Trp Val Leu Ser Thr Gly Tyr Leu Val Val Phe Gly Val Lys

225 230 235 240

Thr Cys Cys Thr Asp Trp Gly Gln Phe Phe Leu Ile Gln Glu Arg Gly

245 250 255

Gln Ser Ala Leu Val Gly Ser Ser Tyr Ile Ser Ala Leu Glu Val Gly

260 265 270

Gly Leu Val Gly Ser Ile Ala Ala Gly Tyr Leu Ser Asp Arg Ala Met

275 280 285

Ala Lys Ala Gly Leu Ser Leu Tyr Gly Asn Pro Arg His Gly Leu Leu

290 295 300

Leu Leu Met Met Ala Gly Met Ala Ala Ser Met Phe Leu Phe Arg Val

305 310 315 320

Thr Val Thr Ser Asp Ser Pro Lys Ile Trp Ile Leu Val Leu Gly Ala

325 330 335

Val Phe Gly Phe Ser Ser Tyr Gly Pro Ile Ala Leu Phe Gly Val Ile

340 345 350

Ala Asn Glu Ser Ala Pro Pro Asn Leu Cys Gly Thr Ser His Ala Ile

355 360 365

Val Gly Leu Met Ala Asn Val Gly Gly Phe Leu Ala Gly Leu Pro Phe

370 375 380

Ser Thr Ile Ala Lys His Tyr Ser Trp Ser Thr Ala Phe Trp Val Ala

385 390 395 400

Glu Val Val Cys Gly Ala Ser Thr Val Val Phe Phe Leu Leu Arg Asn

405 410 415

Ile Arg Thr Lys Met Gly Arg Val Ser Lys Lys Gly Glu

420 425

<210> 2

<211> 1290

<212> DNA

<213> Artificial sequence

<400> 2

atggcagccc aaggctacgg ctactatcgc actgtcatat ttgcggccat gtttggaggc 60

tacagcctgt actatttcaa ccgcaaaacc ttctcctttg tcatgccctc cttggtggat 120

gagatcgctc tggacaagga cgatttgggg ctcatcacaa gcagccagtc ggcagcctac 180

gccatcagca agtttgtgag cggggttctg tcagatcaga tgagcgcccg ctggctcttc 240

tcctctgggc tgctcctggt tggtctggtc aacgtagtct tctcatggag ctccacagtg 300

tcagcctttg ctgctctttg gtttcttaat ggtctggcac aggggctggg ctggcccccc 360

tgtgggaaga tcctgaggaa gtggtttgag ccatcccagt ttggcacttg gtgggctgtg 420

ttgtcaacca gcatgaacct ggctgaaagt ttgggaccta tcttggcaac gatcctcgcc 480

cagagctaca gctggcgcag cacactggcc ctgtctgggg cactgtgtgt ggttgtctcc 540

ttcttctgtc tgctgcttat ccacaatgaa cctgctgatg ttggactccg aaatctggac 600

cctgccccct ccaagggcaa aaagggctca tcaaaggagg agagcaccct acaggatctg 660

ctgctgtccc cctatctctg ggtgctgtcc actggctacc tcgtggtctt cggagtaaag 720

acttgctgta cagactgggg ccagttcttc cttatccagg agcgagggca gtccgccctt 780

gtgggtagct cctacatcag tgccctcgag gtcggaggcc ttgtaggaag cattgcagct 840

ggttacctgt cagacagggc catggcgaag gcagggctgt ctctgtatgg gaaccctcgt 900

cacggcctat tgctactcat gatggctggg atggcagcat ccatgttcct cttccgagta 960

acggtgacca gtgactcacc caagatctgg atcctggttt taggagccgt gtttggtttc 1020

tcttcttatg gtcccattgc cttgtttgga gtcatagcca atgagagtgc acctcccaac 1080

ttgtgtggaa cctctcatgc tattgtggga cttatggcca atgtgggtgg atttctggct 1140

ggcttaccct tcagcaccat tgccaagcac tatagctgga gcacagcctt ctgggtggca 1200

gaagtggttt gtggagccag cacagttgtc ttcttcttgc ttcgaaatat ccgcaccaag 1260

atgggccgag tatccaagaa gggagagtga 1290

<210> 3

<211> 4289

<212> DNA

<213> Artificial sequence

<400> 3

atggactata aggaccacga cggagactac aaggatcatg atattgatta caaagacgat 60

gacgataaga tggccccaaa gaagaagcgg aaggtcggta tccacggagt cccagcagcc 120

gacaagaagt acagcatcgg cctggacatc ggcaccaact ctgtgggctg ggccgtgatc 180

accgacgagt acaaggtgcc cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac 240

agcatcaaga agaacctgat cggagccctg ctgttcgaca gcggcgaaac agccgaggcc 300

acccggctga agagaaccgc cagaagaaga tacaccagac ggaagaaccg gatctgctat 360

ctgcaagaga tcttcagcaa cgagatggcc aaggtggacg acagcttctt ccacagactg 420

gaagagtcct tcctggtgga agaggataag aagcacgagc ggcaccccat cttcggcaac 480

atcgtggacg aggtggccta ccacgagaag taccccacca tctaccacct gagaaagaaa 540

ctggtggaca gcaccgacaa ggccgacctg cggctgatct atctggccct ggcccacatg 600

atcaagttcc ggggccactt cctgatcgag ggcgacctga accccgacaa cagcgacgtg 660

gacaagctgt tcatccagct ggtgcagacc tacaaccagc tgttcgagga aaaccccatc 720

aacgccagcg gcgtggacgc caaggccatc ctgtctgcca gactgagcaa gagcagacgg 780

ctggaaaatc tgatcgccca gctgcccggc gagaagaaga atggcctgtt cggaaacctg 840

attgccctga gcctgggcct gacccccaac ttcaagagca acttcgacct ggccgaggat 900

gccaaactgc agctgagcaa ggacacctac gacgacgacc tggacaacct gctggcccag 960

atcggcgacc agtacgccga cctgtttctg gccgccaaga acctgtccga cgccatcctg 1020

ctgagcgaca tcctgagagt gaacaccgag atcaccaagg cccccctgag cgcctctatg 1080

atcaagagat acgacgagca ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag 1140

cagctgcctg agaagtacaa agagattttc ttcgaccaga gcaagaacgg ctacgccggc 1200

tacattgacg gcggagccag ccaggaagag ttctacaagt tcatcaagcc catcctggaa 1260

aagatggacg gcaccgagga actgctcgtg aagctgaaca gagaggacct gctgcggaag 1320

cagcggacct tcgacaacgg cagcatcccc caccagatcc acctgggaga gctgcacgcc 1380

attctgcggc ggcaggaaga tttttaccca ttcctgaagg acaaccggga aaagatcgag 1440

aagatcctga ccttccgcat cccctactac gtgggccctc tggccagggg aaacagcaga 1500

ttcgcctgga tgaccagaaa gagcgaggaa accatcaccc cctggaactt cgaggaagtg 1560

gtggacaagg gcgcttccgc ccagagcttc atcgagcgga tgaccaactt cgataagaac 1620

ctgcccaacg agaaggtgct gcccaagcac agcctgctgt acgagtactt caccgtgtat 1680

aacgagctga ccaaagtgaa atacgtgacc gagggaatga gaaagcccgc cttcctgagc 1740

ggcgagcaga aaaaggccat cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg 1800

aagcagctga aagaggacta cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc 1860

ggcgtggaag atcggttcaa cgcctccctg ggcacatacc acgatctgct gaaaattatc 1920

aaggacaagg acttcctgga caatgaggaa aacgaggaca ttctggaaga tatcgtgctg 1980

accctgacac tgtttgagga cagagagatg atcgaggaac ggctgaaaac ctatgcccac 2040

ctgttcgacg acaaagtgat gaagcagctg aagcggcgga gatacaccgg ctggggcagg 2100

ctgagccgga agctgatcaa cggcatccgg gacaagcagt ccggcaagac aatcctggat 2160

ttcctgaagt ccgacggctt cgccaacaga aacttcatgc agctgatcca cgacgacagc 2220

ctgaccttta aagaggacat ccagaaagcc caggtgtccg gccagggcga tagcctgcac 2280

gagcacattg ccaatctggc cggcagcccc gccattaaga agggcatcct gcagacagtg 2340

aaggtggtgg acgagctcgt gaaagtgatg ggccggcaca agcccgagaa catcgtgatc 2400

gaaatggcca gagagaacca gaccacccag aagggacaga agaacagccg cgagagaatg 2460

aagcggatcg aagagggcat caaagagctg ggcagccaga tcctgaaaga acaccccgtg 2520

gaaaacaccc agctgcagaa cgagaagctg tacctgtact acctgcagaa tgggcgggat 2580

atgtacgtgg accaggaact ggacatcaac cggctgtccg actacgatgt ggaccatatc 2640

gtgcctcaga gctttctgaa ggacgactcc atcgacaaca aggtgctgac cagaagcgac 2700

aagaaccggg gcaagagcga caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac 2760

tactggcggc agctgctgaa cgccaagctg attacccaga gaaagttcga caatctgacc 2820

aaggccgaga gaggcggcct gagcgaactg gataaggccg gcttcatcaa gagacagctg 2880

gtggaaaccc ggcagatcac aaagcacgtg gcacagatcc tggactcccg gatgaacact 2940

aagtacgacg agaatgacaa gctgatccgg gaagtgaaag tgatcaccct gaagtccaag 3000

ctggtgtccg atttccggaa ggatttccag ttttacaaag tgcgcgagat caacaactac 3060

caccacgccc acgacgccta cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac 3120

cctaagctgg aaagcgagtt cgtgtacggc gactacaagg tgtacgacgt gcggaagatg 3180

atcgccaaga gcgagcagga aatcggcaag gctaccgcca agtacttctt ctacagcaac 3240

atcatgaact ttttcaagac cgagattacc ctggccaacg gcgagatccg gaagcggcct 3300

ctgatcgaga caaacggcga aaccggggag atcgtgtggg ataagggccg ggattttgcc 3360

accgtgcgga aagtgctgag catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag 3420

acaggcggct tcagcaaaga gtctatcctg cccaagagga acagcgataa gctgatcgcc 3480

agaaagaagg actgggaccc taagaagtac ggcggcttcg acagccccac cgtggcctat 3540

tctgtgctgg tggtggccaa agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa 3600

gagctgctgg ggatcaccat catggaaaga agcagcttcg agaagaatcc catcgacttt 3660

ctggaagcca agggctacaa agaagtgaaa aaggacctga tcatcaagct gcctaagtac 3720

tccctgttcg agctggaaaa cggccggaag agaatgctgg cctctgccgg cgaactgcag 3780

aagggaaacg aactggccct gccctccaaa tatgtgaact tcctgtacct ggccagccac 3840

tatgagaagc tgaagggctc ccccgaggat aatgagcaga aacagctgtt tgtggaacag 3900

cacaagcact acctggacga gatcatcgag cagatcagcg agttctccaa gagagtgatc 3960

ctggccgacg ctaatctgga caaagtgctg tccgcctaca acaagcaccg ggataagccc 4020

atcagagagc aggccgagaa tatcatccac ctgtttaccc tgaccaatct gggagcccct 4080

gccgccttca agtactttga caccaccatc gaccggaaga ggtacaccag caccaaagag 4140

gtgctggacg ccaccctgat ccaccagagc atcaccggcc tgtacgagac acggatcgac 4200

ctgtctcagc tgggaggcga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 4260

aagaaaaagt aagaattcct agagctcgc 4289

<210> 4

<211> 123

<212> DNA

<213> Artificial sequence

<400> 4

tttgagccat cccagtttgg cacttggtgg gctgtgttgt caaccagcat gaacctggct 60

gaaagtttgg gacctatctt ggcaacgatc ctcgcccaga gctacagctg gcgcagcaca 120

ctg 123

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence

<400> 5

ggcacttggg agcacctctt cttac 25

<210> 6

<211> 24

<212> DNA

<213> Artificial sequence

<400> 6

accattcctt cgcctacatc cagt 24

<210> 7

<211> 23

<212> DNA

<213> Artificial sequence

<400> 7

taggtcccaa acttccagcc agg 23

Claims

1. A construction method of a glycogen storage disease Ib type gene point mutation mouse model is characterized by comprising the steps of hybridizing a heterozygote mouse with SLC37A4 gene point mutation with wild type mice of other strains, screening a heterozygote mutation mouse in an F1 generation, and obtaining an SLC37A4 gene point mutation homozygote mutation mouse in an F2 generation through self-crossing screening of the F1 generation.

2. The method for constructing a recombinant human serum albumin protein as claimed in claim 1, wherein the SLC37A4 gene is point-mutated to generate a point mutation in the amino acid sequence of the protein p.Gly149Glu encoded by SLC37A4 gene;

preferably, the point mutation of the amino acid sequence of the protein p.Gly149Glu comprises the mutation of glycine at the 149 th position into glutamic acid, the mutation of arginine at the 28 th position into cysteine, the mutation of glycine at the 115 th position into arginine or the mutation of proline at the 191 th position into leucine.

3. The constructing method of claim 1, wherein the SLC37A4 gene point mutation comprises that the 446 th nucleotide of the SLC37A4 gene is mutated from G to A, the nucleotide sequence of the SLC37A4 gene after the point mutation is shown in SEQ ID No.2, or the point mutation comprises that the 446 th nucleotide of the SLC37A4 gene is mutated from G to A, and simultaneously the 447 th nucleotide is mutated from A to G.

4. The method of constructing a mouse according to any one of claims 1 to 3, wherein the mouse heterozygous for the SLC37A4 gene point mutation is obtained by a gene editing method.

5. The construction method of claim 4, wherein the gene editing method comprises the step of obtaining a hybrid mouse with SLC37A4 gene point mutation by using a CRISPR-Cas9 method.

6. The construction method of claim 5, wherein the CRISPR-Cas9 method comprises the steps of injecting a vector carrying DNA sequences encoding Cas9 mRNA and sgRNA and a sequence of SLC37A4 gene point mutation donor oligo into mouse fertilized eggs, transplanting for pregnancy, and screening the produced mice to obtain hybrid mice with SLC37A4 gene point mutation;

preferably, the Cas9 mRNA sequence comprises the sequence shown in SEQ ID No. 3;

preferably, the donor oligo sequence comprises the sequence shown in SEQ ID No. 4;

preferably, the screening is performed by a method of gene sequencing;

preferably, the upstream primer and the downstream primer used for gene sequencing respectively comprise sequences shown as SEQ ID No.5 and SEQ ID No. 6;

preferably, the vector comprises pRP [ CRISPR ] -hCas 9-U6.

7. The method for constructing the sgRNA of claim 6, wherein the sgRNA sequence is a reverse leader sequence and comprises a sequence shown as SEQ ID No. 7.

8. The method of claim 4, wherein the heterozygous mouse strain with the SLC37A4 point mutation comprises the C57BL/6 strain.

9. The method of claim 8, wherein the wild-type mouse strain of the other strain comprises C57BL/6 or DBA/2; preferably the DBA/2 strain.

10. Use of a mouse model constructed according to the method of any one of claims 1 to 9 in the development of a drug for glycogen storage disease type lb caused by a defect in the SLC37a4 gene.