CN110777167B

CN110777167B - Method for constructing mouse model with movement dysfunction phenotype GTPCH enzyme deficiency disease

Info

Publication number: CN110777167B
Application number: CN201911076704.6A
Authority: CN
Inventors: 蒋晓玲; 刘丽; 郑晓宁; 刘华圳
Original assignee: Guangzhou Women and Childrens Medical Center
Current assignee: Guangzhou Women and Childrens Medical Center
Priority date: 2019-11-06
Filing date: 2019-11-06
Publication date: 2021-07-06
Anticipated expiration: 2039-11-06
Also published as: CN110777167A

Abstract

The invention relates to a method for constructing a mouse model with a motor function disorder phenotype GTPCH enzyme deficiency disease. The construction comprises the following steps: (1) obtaining a Gch1p.Leu108Arg heterozygote mutant mouse, wherein the 108 th leucine codon of the Gch1 gene of the heterozygote mutant mouse is mutated into an arginine codon; (2) hybridizing the heterozygote mutant mouse with wild type mice of other strains, and screening an F1 generation heterozygote mutant mouse; (3) and selfing the F1 generation heterozygote mutant mice, and screening F2 generation homozygote mutant mice. The construction method can avoid the problem of lethality in the embryo development process of GTPCH enzyme deficiency, and the birth rate of homozygous mutant mice can reach or approach the expected Mendelian ratio. Meanwhile, the mice with different genetic backgrounds are hybridized, so that the survival condition of the F2 mouse after birth can be improved, and the average survival period is prolonged.

Description

Method for constructing mouse model with movement dysfunction phenotype GTPCH enzyme deficiency disease

Technical Field

The invention relates to the field of animal model construction, in particular to a construction method of a mouse model with a motor function disorder phenotype GTPCH enzyme deficiency disease.

Background

The Dopa-reactive Dystonia (DRD) is a group of dopamine synthesis disorder monogenic genetic diseases listed in the first group of rare disease catalogues of the country, and is clinically mainly manifested as Dystonia, motor dysfunction, language dysfunction, depression and the like due to deficiency of neurotransmitters such as dopamine, 5-hydroxytryptamine, norepinephrine and the like in vivo, and the treatment with levodopa can partially improve clinical symptoms and signs, so the disease is called DRD. In the biosynthesis process of dopamine and 5-hydroxytryptamine, a plurality of enzymes and coenzymes are involved, and mutation of genes encoding the enzymes and coenzymes can cause the encoded enzymes to be abnormal, thereby causing DRD. Among them, the GCH1 gene was the first discovered and most reported DRD pathogenic gene.

The GCH1 gene is located in human chromosome 14q22.1-q22.2, has a total length of 60.88kb, contains 6 exons, encodes a GTP cyclohydrolase (GTPCH 1) protein containing 213-250 amino acids, and is highly expressed in tissues and organs such as liver, spleen and the like. GTPCH is the initial and rate-limiting enzyme in the tetrahydrobiopterin (BH 4) pathway, catalyzing conversion of GTP to 7, 8-dihydrobiopterin triphosphate, and BH4 is an indispensable coenzyme for phenylalanine hydroxylase (PAH), Tyrosine Hydroxylase (TH), tryptophan hydroxylase (TPH), etc., in the dopamine and 5-hydroxytryptamine pathways. Therefore, GTPCH deficiency can cause BH4 deficiency, hyperphenylalaninemia, and DRD.

Although levodopa treatment can partially improve the clinical symptoms and signs of DRD (dry nasal drop) children, the improvement degrees are different, and long-term application of dopa medicaments can induce chorea, spasm and other side effects, so that most of children patients cannot completely live and work like normal people even receiving treatment, and a new treatment method needs to be developed urgently. A suitable animal model of the disease is the basis for the development of new treatment regimens and for the development of preclinical treatment studies.

Two Gch1 gene mutation mouse models are reported internationally, wherein Hph-1 mouse is a GTPCH enzyme deficiency mouse model caused by GCH1 gene mutation mainly used before, and is obtained by random mutagenesis by a sperm mutagen. Although Hph-1 mice showed significant reduction in Gch1 gene mRNA and protein activities and significant reduction in serum BH4 levels, Hph-1 mice showed no significant difference from wild-type mice in a series of myotone-related behavioral tests. Recently, Cambridge scientists in England reported Gch1 knockout mice, however, the mice are embryonic and cannot be used for the disease mechanism and treatment research of DRD caused by GTPCH enzyme deficiency.

Disclosure of Invention

Based on the above, the main purpose of the invention is to provide a method for constructing a mouse model with the motor dysfunction phenotype GTPCH enzyme deficiency. The construction method can avoid the problem of death in the process of embryo development with GTPCH enzyme defects.

The purpose of the invention is mainly realized by the following technical scheme:

a method for constructing a mouse model with a motor function disorder phenotype GTPCH enzyme deficiency disease is characterized by comprising the following steps:

(1) obtaining a Gch1p.Leu108Arg heterozygote mutant mouse, wherein the 108 th leucine codon of the Gch1 gene of the heterozygote mutant mouse is mutated into an arginine codon;

(2) hybridizing the heterozygote mutant mouse with wild type mice of other strains, and screening an F1 generation heterozygote mutant mouse;

(3) and selfing the F1 generation heterozygote mutant mice, and screening F2 generation homozygote mutant mice.

In one embodiment, the Gch1p.leu108arg heterozygote mutant mice are derived from C57BL/6 strain mice.

In one embodiment, the wild-type mouse of the additional strain is a wild-type mouse of the DBA/2 strain.

In one embodiment, the wild-type mouse of the other strain is a wild-type mouse of the 129Sv strain.

In one embodiment, the method for constructing the Gch1 p.Leu117Arg heterozygote mutant mouse comprises the following steps:

1) designing gRNA and point mutation oligonucleotide template ssDNA aiming at mouse Gch1 gene;

2) cas9 mRNA and the sgRNA and point mutation ssDNA were injected into mouse zygotes and passed through a surrogate pregnancy.

In one embodiment, the sequence of the sgRNA is shown in SEQ ID No. 1.

In one embodiment, the sequence of the point mutation oligonucleotide template ssDNA is shown in SEQ ID No. 2.

In one embodiment, the identification of the initial mouse obtained by transplantation and pregnancy adopts PCR sequencing, and primers of the PCR sequencing are shown as SEQ ID No.3 and SEQ ID No. 4.

In one embodiment, the mutant mice are identified by PCR sequencing with primers shown as SEQ ID No.3 and SEQ ID No. 4.

In one embodiment, the mutant mice are identified using PCR-RFLP; the primers of the PCR-RFLP are shown as SEQ ID No.5 and SEQ ID No. 6.

Compared with the prior art, the invention has the following beneficial effects:

the invention relates to a method for constructing a world first GTPCH enzyme-deficient mouse model with dyskinesia, which is characterized in that a point mutation p.Leu117Arg found in a clinical infant is simulated, a corresponding mouse Gch1 gene point mutation p.Leu108Arg heterozygous mouse under the background of a C57BL/6 strain mouse is hybridized with a non-C57 BL/6 strain wild-type mouse, and the obtained F1 generation heterozygous mutant mouse is subjected to selfing to obtain an F2 generation homozygous mutant mouse. In-depth research finds that the construction method can avoid the problem of lethality in the embryo development process of GTPCH enzyme deficiency, and the birth rate of homozygous mutant mice can reach or approach the expected Mendelian ratio. Meanwhile, the mice with different genetic backgrounds are hybridized, so that the survival condition of the F2 mouse after birth can be improved, the average survival time is prolonged, the propagation scale can be reduced by prolonging the survival time, the animal identification and use number can be reduced, the research and development cost of a clinical pre-drug treatment experiment can be greatly reduced, and the research and development efficiency can be obviously improved.

Drawings

FIG. 1 is a flow chart of the construction of a mouse model of the dyskinesia phenotype GTPCH enzyme deficiency disease of example 1;

FIG. 2 is a graph comparing the sequencing results of example 1 on naive mice and wild type mice;

FIG. 3 is a PCR-RFLP-based genotyping map of mutant mice of example 1;

FIG. 4 is a graph showing the result of identifying F1 generation heterozygote mutant mice obtained in example 1;

FIG. 5 is a graph showing a comparison among wild-type mice, homozygote mutant mice and heterozygote mutant mice obtained in example 1;

FIG. 6 is a diagram showing phenotypic analysis of homozygote mutant mice obtained in example 1;

FIG. 7 is a graph comparing survival times of F2 homozygote mutant mice obtained in example 1, example 2 and comparative example 1;

FIG. 8 is a figure comparing the body types of 14-day-old homozygote mutant mice obtained in example 2 with those of littermate wild-type mice.

Detailed Description

In order that the invention may be more fully understood, reference will now be made to the following description. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. The various chemicals used in the examples are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

The GCH1 gene knockout mutation mouse model is important for developing a new DRD treatment scheme and developing preclinical treatment research, however, the Gch1 gene knockout mouse constructed at present is embryonic lethal and cannot be used for DRD disease mechanism and treatment research caused by GTPCH enzyme deficiency at all. Therefore, the inventor carries out a great deal of exploration and attempts, and constructs a Gch1p.Leu108Arg missense mutation mouse model based on the C57BL/6 strain, hybridizes the missense mutation mouse model with DBA/2 or 129Sv, and obtains a homozygous mutation mouse by selfing the obtained F1 heterozygote progeny, thereby avoiding the lethal problem in the process of GTPCH enzyme-deficient embryo development and establishing the first GTPCH enzyme-deficient mouse model with dyskinesia in the world. In particular, compared with C57BL/6 pure background Gch1p.Leu108Arg missense mutation mice, the homozygous mutation mice have significantly improved birth rate and can approach to the expected Mendelian proportion, the method can reduce at least half of the breeding scale, reduce the animal identification and use number, greatly reduce the development cost of the preclinical drug treatment experiment, significantly improve the development efficiency, and simultaneously increase the time window for preclinical treatment research from 10 days to 15 days on average.

In one embodiment, the method for constructing the mouse model with the motor dysfunction phenotype GTPCH enzyme deficiency disease comprises the following steps:

Preferably, the Gch1p.leu108arg heterozygote mutant mice are derived from C57BL/6 strain mice.

Preferably, the wild type mouse of the other strain is a wild type mouse of the DBA/2 strain.

Preferably, the wild type mouse of the other strain is a wild type mouse of the 129Sv strain.

Preferably, the method for constructing the Gch1 p.Leu117Arg heterozygote mutant mouse comprises the following steps:

1) designing sgRNA and point mutation oligonucleotide template ssDNA aiming at mouse Gch1 gene;

Preferably, the sequence of the sgRNA is shown in SEQ ID No. 1.

Preferably, the sequence of the point mutation oligonucleotide template ssDNA is shown in SEQ ID No. 2.

Preferably, PCR sequencing is adopted for identifying the initial mouse obtained by transplantation and surrogate pregnancy, and primers for the PCR sequencing are shown as SEQ ID No.3 and SEQ ID No. 4.

Preferably, the mutant mice are identified by PCR sequencing, and primers for the PCR sequencing are shown as SEQ ID No.3 and SEQ ID No. 4.

Preferably, the identification of the mutant mice adopts PCR-RFLP; the primers of the PCR-RFLP are shown as SEQ ID No.5 and SEQ ID No. 6.

Example 1

The embodiment provides a method for constructing a GTPCH enzyme-deficient mouse model with a movement function barrier phenotype, and the construction steps are shown in fig. 1, and specifically include the following steps:

1. Gch1p.Leu108Arg point mutation heterozygote mice established by CRISPR/Cas9 technology based on classical B6 strain (C57BL/6) mice

1.1CRISPR/Cas9 targeting System

Human GCH1p.Leu 117 is positioned at the entrance of a binding pocket of a GTPCH enzyme catalysis substrate GTP, and after mutation into arginine, steric hindrance is caused, and the binding of the substrate GTP and the enzyme is influenced. Mouse p.leu108 is highly conserved with human p.leu117. Based on this, a synthesis guide sgRNA (SEQ ID No.1) and an oligonucleotide donor (ssDNA) for homologous recombination repair were designed.

sgRNA(SEQ ID No.1)：CATCAAATATAGCATCATTCAGG

ssDNA(SEQ ID No.2)：

AAAATATTTACTATCCTTCAGTATTTAACCAATTTTGTGTTTTCCCGGTT CCAGATGTACGGAATGATGCTATATTTGATGAAGATCATACGAGATGGTGAT TGTGAAGGACATAGATAT。

One of the silent mutations (GTC to GTA) and p.leu108arg mutation (CTG to CGG) together introduced an oligonucleotide donor to prevent sgRNA binding to the oligonucleotide donor.

1.2 construction of Gch1p.Leu108Arg Point-mutant mice

(1) Obtaining fertilized eggs

1) Donor females were sacrificed by cervical dislocation according to standard protocols for euthanasia of laboratory animals.

2) The entire fallopian tube was excised, placed in a dish containing M2 medium, and hyaluronidase was added.

3) The expanded ampulla is found out under a dissecting mirror and torn by forceps to obtain the fertilized egg.

4) Transferring the fertilized eggs with the removed granular cells to KSOM culture solution at 37 ℃ and 5% CO₂And culturing for microinjection.

(2) Prokaryotic injection

Cas9 mRNA was co-microinjected into C57BL/6 zygotes with the sgrnas and oligonucleotide donors described above. The method comprises the following specific steps:

1) a strip of M2 medium was drawn across the middle of the dish lid and covered with paraffin oil.

2) The fixing needle is fixed on the micromanipulator, the needle point of the fixing needle is in the middle of the visual field, and the front end of the fixing needle is filled with M2 culture medium.

3) A DNA and RNA sample containing the sgRNA, the oligonucleotide donor, and Cas9 mRNA mixed as described above was aspirated with a micro-loading tube to fill the tip of the injection needle.

4) The injection needle was fixed to the micromanipulator with the needle tip centered in the field of view.

5) A group of two pronuclei well-formed fertilized eggs were picked, arranged in a straight line in M2 medium in a dish for injection, and placed on a stage.

6) And adjusting the fixing needle to the position of the fertilized egg, and adjusting a microscope to determine the prokaryotic position.

7) The direction of the injection needle is adjusted to ensure that the needle point of the injection needle is positioned on the same horizontal plane with the pronucleus, the injection needle is continuously pushed to penetrate through the zona pellucida and enter the pronucleus, and when the tip of the injection needle enters the pronucleus, proper air pressure is given to ensure that the injection liquid slowly flows into the pronucleus.

8) And after all the fertilized eggs are injected, immediately transferring the fertilized eggs to a KSOM culture medium for culture, and then transferring a new batch of fertilized eggs to an injection chamber for injection until all the fertilized eggs are injected.

(3) Replacement of pregnancy by transplanting fertilized egg

1) The pregnant female mouse in the anaesthetized state is horizontally laid on an object stage.

2) The iodophor disinfects the back of a pregnant mouse, a small opening is cut on the skin at the position of the last rib along the midline of the back by an ophthalmologic scissors, one side of the opening is clamped by a pair of tweezers, the ophthalmologic scissors are inserted between the skin and the muscle layer on the right side, the scissors are stretched to tear the mucous membrane, and a white fat pad or an orange ovary is found.

3) The body wall is clamped by No.5 ophthalmic forceps, a small opening is cut above the ovary, and the blunt separation is carried out by the forceps or the scissors. The fat pad was pulled out of the ovary, oviduct and uterus by grasping the fat pad with forceps, and the ovary, oviduct and uterus were exposed by grasping the fat pad with a fat clip.

4) And (4) sucking the fertilized eggs (with the M2 culture medium as little as possible) after the prokaryotic injection by using a transplanting tube.

5) The salpingemphraxis is found under a microscope, the ovarian cyst membrane is torn off by two No.5 tweezers above the salpingemphraxis, and the ovarian cyst membrane is exposed at the umbrella part.

6) The left hand clamps the umbrella mouth with a No.5 ophthalmic forceps, the right hand inserts the transplantation tube with the fertilized egg into the umbrella mouth of the fallopian tube, and then blows the embryo and the air bubble into the ampulla of the fallopian tube (if the air bubble is seen in the fallopian tube, the transplantation is successful).

7) The fat clips were loosened, the fat pads were grasped with blunt forceps, and the ovaries, fallopian tubes, and uterus were carefully returned to the body cavity.

8) After the implantation was completed, the skin was sutured with wound clips. The surrogate pregnant mouse is put in a clean mouse cage and is kept warm by an infrared warmer until the mouse is awakened.

(4) Genotyping of mutant mice

The first mouse carrying the expected mutation was identified by tail-like DNA PCR sequencing. The tail-like DNA was obtained by extraction with the conventional phenol chloroform method. The identification of the initial mouse can be realized by a PCR sequencing identification mode.

The primers for PCR amplification and sequencing are shown as SEQ ID No.3 and SEQ ID No. 4:

mGch1-seq-F(SEQ ID No.3)：5’-CATGCACAGCCGCTCACTTTATC-3’

mGch1-seq-R(SEQ ID No.4)：5’-GTTAGGCAATAAGGAGAACTTACCC-3’

the sequencing results are shown in FIG. 2, which shows the sequencing sequence of one initial mouse, the upper diagram is the wild mouse control, and the lower diagram is the initial mouse DNA sequence. The CTG > CGG mutation (i.e., p.l108r mutation) indicated in red and the silent mutation indicated in blue were seen.

Progeny mutant mice (including F1 generation heterozygote mutant mice and F2 generation homozygote mutant mice) can also be identified by PCR-RFLP method, primers are shown as the following sequences SEQ ID No.5 and SEQ ID No.6, and the reaction system is shown in Table 1.

mGch1-KI-F(SEQ ID No.5)：GGAAGTGTGATTGTGGGAAGA

mGch1-KI-R(SEQ ID No.6)：CAAATGGAACAAGGTGATGCT。

TABLE 1 digestion reaction system for PCR product of Gch1 gene

The results of PCR-RFLP-based heterozygote mutant mouse identification are shown in FIG. 3. According to FIG. 3, a 366bp long PCR product from the mutation site was recognized by the restriction enzyme CviQI and cleaved to 269bp and 97 bp.

F1 generation heterozygote mutant mice

Crossing Gch1 missense mutant heterozygote mice in the background of C57BL/6 strain constructed in step 1 with wild-type mice of DBA/2 strain: b6.Gch1^KI/+×D2.Gch1^+/+→B6D2.Gch1^KI/+、B6D2.Gch1^+/+And screening the heterozygote B6D2.Gch1 with double genetic backgrounds of F1 generation and Gch1 missense mutation^KI/+A mouse. The identification method of F1 generation heterozygote mutant mice can adopt the PCR sequencing as described above, and can also adopt the PCR-RFLP as described above. Screening results identification see figure 4.

F2 generation homozygous mutant mouse

Selfing the F1 Gch1 missense mutation heterozygous male mice and female mice obtained in the step 2: B6D2.Gch1^KI/+×B6D2.Gch1^KI/+→B6D2.Gch1^KI/KI、B6D2.Gch1^KI/+、B6D2.Gch1^+/+Screening F2 generation homozygous mutant mouse (B6D2.Gch 1) for experimental research^KI/KI) And their littermate controls. The identification method of F2 generation homozygous mutant mouse canPCR sequencing as described above may also be used, as may PCR-RFLP as described above. See table 2, fig. 5, fig. 6 for results.

The actual birth and survival statistics of the homozygous progeny in this example are shown in table 2 below:

TABLE 2

In the table, N is the number of observations; p0, day of birth; p7, one week after birth; p14 at day 14 after birth; p21 at day 21 after birth.

As can be seen from Table 2, by adopting the construction method of the embodiment, the birth rate of the GCH1 homozygote mutant mouse is close to 25% of the Mendelian law, and is equivalent to that of a wild-type mouse, so that the embryo lethal problem is almost completely avoided. Gch1^KI/KIMice were born with no significant difference from littermate controls, but exhibited delayed growth from day 2. Figure 5 provides data identifying the hepatic GTPCH enzymatic activity, the levels of brain and liver synthesis products BH4, and phenylalanine, the neurotransmitters dopamine, norepinephrine and serotonin, which BH4 is involved in metabolism in the disease model mouse. Figure 6 provides the results of an identification experiment for the disease model dystonia phenotype, in which: FIG. 6A shows GCH1^KI/KIMice exhibited dystonia-specific hindlimb crossing when tail-suspended, and FIG. 6B shows GCH1^KI/KIThe mice took longer to turn right in the righting reflex experiment, and fig. 6C to 6E are hind limb suspension tests, in which GCH1 can be seen^KI/KIThe phenomenon that the mouse tail cannot stand and has lower muscle tension, such as long time of hanging compared with wild type littermate and the like.

Example 2

This example provides a method for constructing a GTPCH enzyme-deficient mouse model with a movement function impairment phenotype, which comprises the following steps, referring to example 1, and compared with example 1, the method is characterized in that in the step of "2. F1 generation heterozygote mutant mice", 129Sv strain wild type mice are used instead of DBA/2 strain wild type mice. See table 3, fig. 7, fig. 8 for results.

TABLE 3

As can be seen from Table 3, the construction method of this example was adopted to almost completely circumvent the problem of embryonic lethality in GCH1 homozygote mutant mice. As can be seen from FIG. 7, homozygote mutant mice were also improved by crossing 129Sv strain wild-type mice with Gch1 missense mutant heterozygote mice in the background of C57BL/6 strain followed by crossing with F1 heterozygote and selfing to obtain homozygote mutant mice (Gch 1)^KI/KIMice) birth rate and survival time. Although the birth rate of the homozygote mutant mice is slightly lower than that of the homozygote mutant mice in the embodiment 1, the survival time is slightly improved. FIG. 8 shows a double-background homozygote mutant mouse (Gch 1) obtained in this example at 14 days of age^KI/KIMouse) (left) and their littermate controls (right). Homozygote mutant mouse obtained in this example (Gch 1)^KI/KIMice) had no significant difference from littermate controls at birth, but exhibited delayed growth from day 2.

Comparative example 1

The comparative example provides a construction method of a GTPCH enzyme deficiency mouse model, and the construction method comprises the following steps:

1. gch1p.leu108arg point mutation heterozygote mice were established based on the C57BL/6 strain mice by CRISPR/Cas9 technology. The procedure is as in example 1.

2. Directly selfing the point mutation heterozygote mice obtained in the step 1: b6.Gch1^KI/+×B6.Gch1^KI/+Obtaining GTPCH enzyme defect homozygote mutant mouse B6.Gch1^KI/KI. The statistics of birth and survival of the homozygous progeny in comparative example 1 are given in table 4 below:

TABLE 4

As can be seen from Table 4, the problem of embryo death observed in Gch1 gene knock-out mice can be partially avoided by constructing GTPCH enzyme function-deficient mice by simulating the missense mutation of GCH1 of a patient, but the birth proportion of homozygous mice is low, and the embryo death rate is close to 50%. And as shown in fig. 7, the average longest survival time of homozygous mutant mice born in comparative example 1 is shorter than that of example 1, which is only 10 days, and the time window for preclinical treatment research is smaller. According to the comparison between the birth and survival conditions of the example 1 and the comparative example 1 in fig. 7, the method provided by the embodiment of the invention can effectively avoid the embryonic death problem by hybridizing mice of different genetic background strains, obviously improve the birth condition, and provide a sufficient drug action window for the development of postnatal drug therapy research.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Guangzhou city children medical center

<120> construction method of mouse model with motor dysfunction phenotype GTPCH enzyme deficiency disease

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

catcaaatat agcatcattc agg 23

<210> 2

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aaaatattta ctatccttca gtatttaacc aattttgtgt tttcccggtt ccagatgtac 60

ggaatgatgc tatatttgat gaagatcata cgagatggtg attgtgaagg acatagatat 120

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

catgcacagc cgctcacttt atc 23

<210> 4

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gttaggcaat aaggagaact taccc 25

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggaagtgtga ttgtgggaag a 21

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caaatggaac aaggtgatgc t 21

Claims

1. A method for constructing a mouse model with a motor function disorder phenotype GTPCH enzyme deficiency disease is characterized by comprising the following steps:

(1) obtaining a Gch1p.Leu108Arg heterozygote mutant mouse, wherein the 108 th leucine of the Gch1 gene coding protein of the heterozygote mutant mouse is mutated into arginine;

2. The method for constructing a mouse model with a dyskinetic phenotype GTPCH enzyme deficiency disease according to claim 1, wherein the Gch1p.Leu108Arg heterozygote mutant mouse is derived from a C57BL/6 strain mouse.

3. The method of constructing a mouse model of a GTPCH enzyme deficiency with dyskinetic phenotype according to claim 2, wherein the wild type mouse of the other strain is a wild type mouse of DBA/2 strain.

4. The method of constructing a mouse model of a GTPCH enzyme deficiency with dyskinetic phenotype according to claim 2, wherein said wild type mouse of other strain is wild type mouse of 129Sv strain.

5. The method for constructing a mouse model with a motor dysfunction phenotype GTPCH enzyme deficiency disease as claimed in any one of claims 1 to 4, wherein the method for constructing the Gch1p.Leu108Arg heterozygote mutant mouse comprises the following steps:

6. The method for constructing a mouse model with a motor dysfunction phenotype GTPCH enzyme deficiency disease according to claim 5, wherein the sequence of sgRNA is shown as SEQ ID No. 1.

7. The method for constructing a mouse model with a motor dysfunction phenotype GTPCH enzyme deficiency as claimed in claim 5, wherein the sequence of the point mutation oligonucleotide template ssDNA is shown in SEQ ID No. 2.

8. The method for constructing a mouse model with a motor dysfunction phenotype GTPCH enzyme deficiency as claimed in claim 6 or 7, wherein the identification of the first-established mouse obtained by transplantation surrogate pregnancy adopts PCR sequencing, and primers of the PCR sequencing are shown as SEQ ID No.3 and SEQ ID No. 4.

9. The method for constructing a mouse model with a motor dysfunction phenotype GTPCH enzyme deficiency as claimed in any one of claims 1 to 4, wherein the mutant mouse is identified by PCR sequencing, and primers of the PCR sequencing are shown as SEQ ID No.3 and SEQ ID No. 4.

10. The method for constructing a mouse model with a motor dysfunction phenotype GTPCH enzyme deficiency as claimed in any one of claims 1 to 4, wherein the identification of the mutant mouse is performed by PCR-RFLP; the primers of the PCR-RFLP are shown as SEQ ID No.5 and SEQ ID No. 6.