CN117305304A

CN117305304A - Nucleic acid product of targeted Meikin gene, construction method and application of animal model of meiosis

Info

Publication number: CN117305304A
Application number: CN202311349002.7A
Authority: CN
Inventors: 李维娜
Original assignee: Reproductive and Genetic Hospital of CITIC Xiangya Co Ltd
Current assignee: Reproductive and Genetic Hospital of CITIC Xiangya Co Ltd
Priority date: 2023-10-18
Filing date: 2023-10-18
Publication date: 2023-12-29

Abstract

The application provides a nucleic acid product of a targeted Meikin gene, a construction method of an animal model of meiosis and application of the animal model. The nucleic acid product comprises a first gRNA and a second gRNA; the nucleotide sequence of the first gRNA is shown as SEQ ID NO. 3; the nucleotide sequence of the second gRNA is shown as SEQ ID NO. 4. By adopting the nucleic acid product, a specific mutation site can be knocked into the genome of a target animal, so that an animal model with abnormal meiosis, which is characterized by male sterility and female sterility and cannot be improved after ICSI treatment, is constructed.

Description

Nucleic acid product of targeted Meikin gene, construction method and application of animal model of meiosis

Technical Field

The application relates to the field of biotechnology, in particular to a nucleic acid product of a targeted Meikin gene, a construction method of an animal model of meiosis and application of the animal model.

Background

Infertility is a worldwide problem, and is also a disease that follows cardiovascular disease and neoplasm, yet severely affects social life and public health of humans. About 15% of couples worldwide are affected by infertility, with men's factors accounting for about 50%. At present, the known causes of male infertility comprise reproductive obstruction, inflammation, immunity factors, sexual dysfunction and the like, but 60% -75% of male infertility causes are unknown under the existing diagnosis conditions.

Male infertility is clinically manifested mainly as azoospermia, oligospermia, teratospermia and/or oligospermia. Non-obstructive azoospermia (NOA) is currently one of the most severe of the male infertility, accounting for about 10% of male infertility patients. Currently known NOA genetic factors include abnormal chromosome number, abnormal chromosome structure, and abnormal spermatogenic functional genes. About 10% of NOAs are due to mutations in meiosis related genes, i.e. diploid primary spermatocytes are unable to divide normally into sperm cells. Meiosis is the requisite stage of gametocyte formation in individuals undergoing sexual reproduction, and meiosis abnormalities are closely related to infertility. For example, meiosis related genes such as FANCM, XRCC2, MCM8, MCM9, TEX11, SYCE1, TEX15 and SETX are involved in the meiosis process of spermatocytes, recombination, chromosomal cross-exchange, repair of DNA double strand breaks, etc., which after their loss of function cause meiosis to be blocked, leading to the occurrence of NOA.

A significant fraction of sterile men can obtain their own offspring by artificial assistance such as single sperm microinjection (intracytoplasmic sperm injection, ICSI) in follicular plasma. However, there is no effective technique available at this stage to assist fertility in male sterile patients who are non-obstructive azoospermia, or severely oligospermia and do not have normal sperm. The mechanism of non-obstructive azoospermia and severe oligospermia is well known, which not only helps to promote the development of assisted reproductive technology, but also can pertinently improve the clinical pregnancy assisting process, thereby providing great potential for the treatment of male infertility. However, current research into human sperm meiosis has largely existed with 2 barriers: (1) Without a suitable in vitro study model, knowledge of meiosis relies on studies of genetically modified model organisms, with very little study of human sperm meiosis. (2) The conservation of meiosis-related genes varies with the variety of model organisms, and the pathogenesis of male infertility such as severe oligospermia and non-obstructive oligospermia remains unclear.

Thus, there is a need to construct an effective animal model of meiosis.

Disclosure of Invention

Based on this, the present application provides a nucleic acid product for constructing an animal model of meiosis and uses thereof.

According to a first aspect of the present application, there is provided a nucleic acid product targeting a Meikin gene, the nucleic acid product comprising a first gRNA and a second gRNA;

the nucleotide sequence of the first gRNA is shown as SEQ ID NO. 3; the nucleotide sequence of the second gRNA is shown as SEQ ID NO. 4.

According to a second aspect of the present application, there is provided a Meikin gene editing system, said editing system comprising a nucleic acid product as described above;

optionally, the editing system further comprises a Cas9 nuclease and/or a Cas9 mRNA.

According to a third aspect of the present application, there is provided a recombinant cell comprising a nucleic acid product targeted to a Meikin gene as described above or a Meikin gene editing system as described above.

According to a fourth aspect of the present application, there is provided a method of constructing an animal model of meiosis, the method comprising:

transferring the Meikin gene editing system into fertilized eggs of target animals, and constructing an animal model simulating human Meikin.653+1G > A mutation.

In one embodiment, the method of transferring is microinjection.

In one embodiment, the method further comprises transplanting the fertilized egg transformed into the Meikin gene editing system into a pseudopregnant female and producing an F0 generation; and

mating the F0 generation with a wild type to obtain an F1 generation heterozygote, and selfing the F1 generation heterozygote to obtain a homozygous F2 generation.

In one embodiment, the construction method further comprises identifying the genotype of the target animal using one or more of the following primers:

a first primer pair with a nucleotide sequence shown as SEQ ID NO. 5-6;

a second primer pair with a nucleotide sequence shown as SEQ ID NO. 7-8;

a third primer pair with a nucleotide sequence shown as SEQ ID NO. 9-10;

a fourth primer with a nucleotide sequence shown as SEQ ID NO. 11;

a fifth primer pair with a nucleotide sequence shown as SEQ ID NO. 12-13; and

and a sixth primer pair with the nucleotide sequence shown in SEQ ID NO. 14-15.

In one embodiment, the method of identifying comprises one or more of PCR and Sanger sequencing.

In one embodiment, the target animal comprises a mouse or a rat.

According to a fifth aspect of the present application, there is provided the use of an animal model of meiosis constructed by the above-described method for constructing an animal model of meiosis in screening a medicament for treating male infertility.

Compared with the prior art, the method has the following beneficial effects:

by adopting the gRNA, a specific Meikin gene mutation site can be knocked into the genome of a target animal, so that an animal model with abnormal meiosis, which is characterized by male sterility and female sterility and cannot be improved after ICSI treatment, is constructed. The animal model prepared by the gRNA can be used for researching a molecular mechanism between the function of the Meikin gene and meiosis, and identifying or screening medicines for treating male infertility.

Drawings

In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings that are needed in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present application, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a schematic structural diagram of the targeting vector constructed in example 1;

FIG. 2 is a schematic diagram of the cleavage assay of the targeting vector of example 1;

FIG. 3 is a schematic diagram of the structures of wild type alleles and mutant alleles in example 1;

FIG. 4 is a sequencing diagram of mice constructed with gRNA-A1/gRNA-A2 in example 1;

FIG. 5 is an electrophoretically validated diagram of heterozygous mice in example 1;

FIG. 6 is an electrophoretically validated diagram of heterozygous mice in example 1;

FIG. 7 is a diagram showing the sequencing verification of the insertion region of heterozygous mice in example 1;

FIG. 8 is a diagram showing the sequencing verification of the mutation sites of the heterozygous mice in example 1;

FIG. 9 is an electrophoretically validated diagram of homozygous mice in example 1;

FIG. 10 is a diagram of sequencing verification of homozygous mice in example 1;

FIG. 11 is a gel electrophoresis diagram of the minigene assay of example 1;

FIG. 12 is a graph of HE staining of wild type mice and homozygous mice in example 1.

Detailed Description

The detailed description of the embodiments of the present application will be presented in order to make the above objects, features and advantages of the present application more obvious and understandable. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present application. This application is, however, susceptible of embodiment in many other forms than those described herein and similar modifications can be made by those skilled in the art without departing from the spirit of the application, and therefore the application is not to be limited to the specific embodiments disclosed below.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein in the description of the application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Unless specifically indicated otherwise, the various raw materials, reagents, instruments, equipment, and the like used in the present application are commercially available or may be prepared by existing methods.

Animal models are of great significance for clinical study of the molecular mechanisms of disease, and mechanisms for studying meiosis by constructing a Meikin gene knock-in animal model have not been disclosed in the conventional art.

Based thereon, the present application provides a nucleic acid product targeting a Meikin gene, comprising a first gRNA and a second gRNA;

Specifically, the nucleotide sequence shown in SEQ ID NO. 3 is: 5'-CTCGCTCCCAAGGGTGATAATGG-3' the nucleotide sequence shown in SEQ ID NO. 4 is: 5'-CCTCCCTACCTATTGTCCAGTGG-3'.

In the application, 2 specific gRNAs are designed aiming at the upstream and downstream sequences of the mutation site of the Meikin gene c.653+1G > A, the target sequence can be accurately knocked out by combining with the Crispr/Cas9 system, and a targeting vector is connected to a fracture, so that the Meikin gene knock-in mouse with a sterile phenotype is prepared. In the conventional technology, it is not clear to researchers which mutation site is more critical for the functional expression of the Meikin gene, and a suitable knock-in site cannot be selected, whereas a mouse obtained by randomly selecting a gene site knock-in may not have a phenotypic change.

Some embodiments of the present application also provide a Meikin gene editing system comprising the above nucleic acid product.

In some of these examples, the Meikin gene editing system further comprises a Cas9 nuclease and/or a Cas9 mRNA.

Some embodiments of the present application also provide a recombinant cell comprising the above nucleic acid product or the above gene editing system.

In some examples, the Meikin c.653+1g > a mutation is included in the recombinant cell genome after editing by the gene editing system described above.

In some embodiments of the present application, a method of constructing an animal model of meiosis is also provided.

The Crispr/Cas9 system is an adaptive immune system found in bacteria and archaea. By using artificially synthesized gRNA sequences which are complementary to genome DNA, the Cas9 nuclease can realize site-directed cleavage of the genome, thereby generating double-strand breaks of DNA, then a DNA repair mechanism of cells is activated, random type insertion is generated at the double-strand breaks, thereby causing frame shift mutation of genes and gene function deletion, and further being capable of being used for researching the functions of Meikin genes.

In some embodiments, the method for constructing an animal model of meiosis comprises steps S10 to S50.

Step S10: the first and second grnas are designed for the Meikin gene of the target animal.

In some examples, the gRNA is designed for the target animal Meikin c.653+1g > a mutation and its upstream and downstream sequences, creating an animal model of meiosis.

In some examples, the nucleotide sequence of the first gRNA is shown in SEQ ID NO. 3 and the nucleotide sequence of the second gRNA is shown in SEQ ID NO. 4.

By adopting the gRNA with the specific nucleotide sequence and combining with the Crispr/Cas9 system, specific mutation sites of the Meikin gene can be knocked out and knocked in, and an animal model for simulating meiosis abnormality of human Meikin c.653+1G > A mutation is constructed.

Step S20: the first gRNA, the second gRNA, the Cas9 nuclease, and the targeting vector are transferred into fertilized eggs of the target animal.

In one embodiment, the nucleotide sequence of the targeting vector is shown as SEQ ID NO. 18.

In one embodiment, the method of transferring the fertilized egg into the target animal is microinjection.

Step S30: fertilized eggs are transplanted into pseudopregnant females to produce F0 generation.

Step S40: mating the F0 generation with a wild type to obtain an F1 generation heterozygote, and selfing the F1 generation heterozygote to obtain an F2 generation homozygote.

In one embodiment, the target animal comprises a mouse or a rat. Alternatively, the target animal is a mouse. Further alternatively, the target animal is a C57BL/6J mouse.

In some embodiments, the above construction method further includes step S50.

Step S50: the genotype of the target animal is identified using one or more of the following primer pairs: a first primer pair with a nucleotide sequence shown as SEQ ID NO. 5-6; a second primer pair with a nucleotide sequence shown as SEQ ID NO. 7-8; a third primer pair with a nucleotide sequence shown as SEQ ID NO. 9-10; a fourth primer with a nucleotide sequence shown as SEQ ID NO. 11; a fifth primer pair with a nucleotide sequence shown as SEQ ID NO. 12-13; and a sixth primer pair with a nucleotide sequence shown as SEQ ID NO. 14-15.

In one embodiment, the first primer pair and the second primer pair are used to identify F1 heterozygote mice.

In one embodiment, the third primer pair is used to identify the knock-in region of an F1 heterozygote mouse.

In one embodiment, the fourth primer is used to identify the mutation site of the F1 heterozygote mouse.

In one embodiment, the fifth primer pair and the sixth primer pair are used to identify F2 homozygous mutant mice.

The applicant found through studies that one patient carrying the Meikin c.653+1g > a mutation clinically exhibited non-obstructive azoospermia. Further gene knock-in was performed on mice by the Crispr/Cas9 system, and the results indicate that mice knocked in Meikin c.653+1g > a mutation exhibited truncated protein expression and abnormal function. In addition, the sperm concentration and the sperm proportion of normal forms of homozygous mice with the Meikin gene knockin were identified to be significantly lower than those of wild type mice and heterozygote mice, and the mice were characterized by male sterility and female sterility, and could not be improved by ICSI treatment.

The method for constructing the animal model with abnormal meiosis has at least the following advantages:

(1) The prepared Meikin gene knock-in mice have no difference in appearance from common mice, but are male sterile and female sterile, and cannot be improved by ICSI treatment.

(2) 2 gRNAs are designed aiming at Meikin.653+1G > A mutation sites, and gene knock-in is carried out on a target animal by combining with a Crispr/Cas9 system, so that the protein expression of Meikin genes in the target animal can be truncated, and an animal model with a sterile phenotype can be successfully prepared; has important significance for the research of meiosis abnormality.

Some embodiments of the present application also provide an application of the meiosis animal model constructed by the method for constructing the meiosis animal model in screening medicines for treating infertility.

The present application will be further described with reference to specific examples and comparative examples, which should not be construed as limiting the scope of the present application.

Example 1:

the applicant found clinically that a male patient carrying a mutation of Meikin gene c.653+1g > a, which exhibited severe oligospermia and severe teratospermia, had semen routine test results shown in table 1 and papanicolaou staining results shown in table 2. In addition, the patient clinically shows that the wife cannot be pregnant naturally, 11 high-quality embryos are formed by two intracytoplasmic sperm injection (ICSI), the wife is not pregnant after receiving two embryo transplantation, and the rest embryos are not formed by continuous culture. And the embryo which receives the semen supply has good development and can smoothly finish the transplantation.

The above results indicate that: the Meikin gene c.653+1g > a mutation may be closely related to the presence of meiosis abnormalities.

TABLE 1

TABLE 2

Construction of a mouse model for knock-in of the Meikin Gene

The mouse Meikin gene (NCBI reference sequence: NM-029105.2) is located on chromosome 11 of the mouse genome, and 14 exons have been identified, with the ATG start codon located at exon 1 and the TAA stop codon located at exon 14 (Transcript: 201-ENSMUST 00000094193).

A mouse genome fragment containing Homology Arms (HAs) is amplified from Bacterial Artificial Chromosomes (BACs) by using high-fidelity Taq DNA polymerase, and is assembled with recombination sites and selection markers in sequence to form a targeting vector, the structure of the targeting vector is shown in figure 1, and the nucleotide sequence of the targeting vector is shown in SEQ ID NO. 18.

SEQ ID NO:18：

ctaaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattgtaatacgactcactatagggcgaattgggtacggcgcgccatgcttattcaggctgcgcaactgttgatagctgctgctatccttggctgtcattccacagtgctggcatctccaaaatgtgagtctctgctgcaactgggctgcagcgtcaccaggagcctctcctgggttctcatcagggactctgattctgccatgtttaagattaaatagtaaccgggcagtggtggggcacgcctttaatcccagcacttgggaagcagaggcaggcagatttctgagttcgaggtcagcctggtctacagagtgagttccaggacagccagggctatacagagaagccttgtctcgaaaaacaaaacaaaacaaaacaaaacaaaacaaaacaacaaaaaaaaagattaaatagtaaaacaaattaaaaaaaactaaatcatctgggaagagagagaaacatgattcaggaaagccaaaggattgccacaatattccagaagaatacgattttgtagtattttgtcaccactatgtctacatttaatatgtctgaagatagatctcagcggtagaatgtttgtctagcatgtatgaggccctaggttcaatccacagtctccagatgtcttagttagggttttactgctgtgaacagacaccgtgaccaaggcaactcttataaggacaacatttaattggggctgggttacagatttagaggttcagtccattatcatcaaggcaggaacatgatggcgtccaggcaggcctggtgcaggagctaagagttctacatcttcatctgaaggctgctagcagaatactgccttctaggcagctagggtgagggtcttaagcccacactcacagtgccacacctactccaacagggccacaacttctaatagtgccactccctgggctgaacatatacaaaccatcacaccaaacataaaaagaatatctgatgatataattttatgtggacagtgagaaaggtacagacagggatgcaacaaggatagcaccattcttccatagctgaggtcaatagaaggcttaaaaccgatatcaggtaatagcagtgtgactgttgctcactgacgtgcggcttaattaacagagaggagtacagcaaatggagagagccagttacgtgtgtcctgcagctcagtgatgtctgtagagcaaaaatctcgatggaaggtgaggaaggacagaggattggactgggctttagcctgatgccattgtgacttgttcttgggttcttaccttcaataccacattacatctggaatggataggggcagggagtaacctgtcacgggtaggcttttcaaagttatatatcatttttaaagtgtgtgtgtgtttactataatgtgtttttctttttagattgggagcatcccaagttggaagatt

The targeting vector was digested and verified with EcoRV, aflII+DrdI and AhdI+SacI, respectively, and the results are shown in FIG. 2. Wherein M is a marker;1 is EcoRV, the band sizes are 5.2kb, 3.5kb, 2.6kb and 0.6kb in this order; 2 is AflII+DrdI, the band sizes are 4.8kb, 2.3kb, 1.9kb, 1.5kb and 1.3kb in sequence; 3 is an AhdI+SacI cleavage product, and the sizes of the bands are 5.8kb, 1.9kb, 1.6kb, 1.3kb, 0.8kb and 0.4kb in this order. The result of the enzyme digestion verification shows that the targeting vector is connected correctly.

The 2 sets of gRNAs (gRNA-A 1/gRNA-A2 and gRNA-B1/gRNA-B2) as shown in Table 3 were designed and synthesized against the upstream and downstream sequences of the mutation site of the mouse Meikin gene c.653+1G > A. Cas9 nuclease, 2 gRNAs and targeting vector are co-injected into fertilized eggs of C57BL/6J mice, and the fertilized eggs are transplanted into uterus of pseudopregnant female mice.

TABLE 3 Table 3

And (3) identifying positive mice through PCR and sequencing, backcrossing the F0 generation mice constructed by the gRNA-B1/gRNA-B2 with wild mice to obtain heterozygote mice with single genotype, and carrying out hybridization breeding among the heterozygote mice to obtain homozygous mice, so that the Meikin gene knock-in mice are successfully constructed. The structure of the mutant allele of the Meikin knock-in mice is shown in fig. 3.

The sequence of the mice constructed by gRNA-A1/gRNA-A2 is shown in figure 4, and the sequence of the mice is consistent with that of wild mice, and the verification result is negative. It was revealed that the use of gRNA-A1/gRNA-A2 was not able to construct mice into which the Meikin gene was knocked, and that it was not able to be used for the study of meiosis abnormality.

2. Mouse genotyping

Specific primers shown in Table 4 were designed for heterozygote mice, knock-in sequences, c.653+1G > A mutation sites, and homozygous mice, and PCR amplification and Sanger sequencing were performed using gDNA of the mouse tissue samples as templates.

TABLE 4 Table 4

(1) Identification of heterozygous mice

The two pairs of primers F1/R1 and F2/R2 are adopted to carry out long-fragment PCR amplification on heterozygote mice according to the system shown in the table 5, agarose gel electrophoresis patterns of amplified products are respectively shown in fig. 5 and 6, and fragments with the size of 5.8kb can be amplified by both pairs of primers.

The PCR amplification reaction procedure was as follows: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 60℃for 30s, extension at 65℃for 50s (50 s/kb, adjusted according to the size of the product fragment), and cycling for 33 times; the temperature is kept at 65 ℃ for 10min.

TABLE 5

Further, sanger sequencing was performed on PCR amplified products of heterozygous mice using F3/R3 primers, and the results are shown in FIG. 7. The PCR amplified products of heterozygous mice were subjected to Sanger sequencing using the R4 primer, and the results are shown in FIG. 8.

(2) Identification of homozygous mice

a. PCR and sequencing identification

The F5/R5 primer pair is adopted to carry out short-fragment PCR amplification on the homozygous mice according to the system shown in the table 6, and the genotype of the mice is primarily judged according to the size and the number of the bands of the PCR products (wild type: 327bp, heterozygote: 327bp and 360bp, homozygous: 360 bp). The PCR amplification reaction procedure was as follows: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 58℃for 35s, extension at 72℃for 35s, and cycling for 35 times; the temperature is kept at 72 ℃ for 5min.

The short fragment PCR amplification was performed on homozygous mice using the F6/R6 primer pair according to the system shown in Table 6, and the electrophoresis results are shown in FIG. 9. The PCR amplification reaction procedure was as follows: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 58℃for 35s, extension at 72℃for 35s, and cycling for 35 times; the temperature is kept at 72 ℃ for 5min.

Further, the PCR amplified products were sequenced, and the results are shown in FIG. 10: the sequence of the homozygous mouse is mutated at the target position. Specifically, the sequencing sequence of the wild-type mice is shown as SEQ ID NO. 16, and the sequencing sequence of the homozygous mice is shown as SEQ ID NO. 17.

SEQ ID NO:16

atcttcggggacacgtttgaattatctctatgtctaatggatcgatgtttttgtcccctttgataggttcctcttcaaaaaactatgagaaacgccatagaaaaatgtaagaactaaagcatttgctgttgtgcttttcaaaacccataattgcaagagttctgtaatagtgatgactgccatcccggaagctcagatgaacttcattcagtgtttgctgagcacttactctttgccaggagtgttctaattgct

SEQ ID NO. 17 (underlined is a base with mutation)

atcttcggggacacgtttgaattatctctatgtctaatggatcgatgtttttgtcccctttgataggttcctcttcaaaaaactatgagaaacgccatagaaaaatataagaactaaagcatttgctgttgtgcttttcaaaacccataattgcaagagttctgtaatagtgatgactgccatcccggaagctcagatgaacttcattcagtgtttgctgagcacttactctttgccaggagtgttctaattgct

TABLE 6

b. Minegene validation

Nested PCR amplification was performed using mouse genomic DNA as a template, and the amplified minigene fragment was inserted into a pcMINI vector (Shi-Shi Biopharm Co. Ltd., wuhan, china) by restriction enzyme BanHI EcoRI. The inserted minigene fragment comprises the complete Exon7 and the front and back partial intron sequences thereof, which are 253bp in total. The recombinant vector was designated pcMINI-Meikin-wt/mut.

The primers Meikin-638-F and Meikin-638-R were designed 1 pair, and PCR was performed using genomic DNA as a template to obtain wild-type and mutant fragments of pcMINI.

The Meikin-638-F nucleotide sequence is shown in SEQ ID NO: 19:

5’-TGGAAGAACACATGCAGTGGAAG-3’。

the Meikin-638-R nucleotide sequence is shown in SEQ ID NO: 20:

5’-GAAGGGCAAGTTTTCTCAGCAAG-3’。

the empty pcMINI and the PCR amplified fragment are digested with BamHI and EcoRI; purifying and recovering the digested fragments and the vector.

Connecting the two sets of vectors and fragments after enzyme digestion; the ligation product was transformed into competent cells DH 5. Alpha. And incubated overnight at 37 ℃; selecting monoclonal cells to identify positive clones; positive clones were sequenced and the correctly sequenced monoclonal cells were shaken to extract the plasmid.

The recombinant vector was transfected into cell line 293T, respectively, for 36 hours according to the instructions of the liposome transfection reagent, and the samples were collected and examined.

Day0: the day before transfection (20-24 h), cells after pancreatin digestion were mixed at 0.5X10 per well ⁵ ~2×10 ⁵ Plating the quantity of the individual cells (without antibiotics) to ensure that the density of the individual cells is 90% -95% during transfection;

day1: configuration of DNA-Hieff TransTM Liposome nucleic acid transfection reagent Complex: for each well of cells, 50 μl of serum-free medium was used to dilute 0.5 μg of DNA, and mixed well; for each well of cells, diluting 0.6. Mu.L to 2.5. Mu.L of Hieff Trans (TM) liposome nucleic acid transfection reagent with 50. Mu.L of serum-free medium; incubate at room temperature for 5min.

And fully and uniformly mixing the diluted DNA and the diluted liposome nucleic acid transfection reagent, placing the mixture in a room temperature with the ambient temperature of 15-25 ℃ for incubation for 20min, and forming a DNA-liposome complex after the incubation is completed. Mixing 100. Mu.L of DNA-Hieff Trans (TM) complex, adding into a cell culture plate, gently shaking the culture plate, and mixing thoroughly; CO at 5% concentration at 37 ℃C ₂ Culturing for 1-2 d in an incubator, and observing the growth state of cells until transgenic expression analysis is carried out, wherein a culture medium is not required to be replaced in the process. The collected cell samples were subjected to total RNA extraction (Trizol method). The transcriptional splicing of the target gene was then detected by RT-PCR, electrophoresis and Sanger sequencing.

The results of the mingene validation are shown in fig. 11: the mRNA product of the homozygous mouse comprises a band 1 with the size of 200-300 bp, a band 2 with the size of 300-400 bp and a band 3 with the size of about 700 bp. Compared with a wild-type mouse, the protein corresponding to the band 1 is terminated in advance at 200aa, and exon7 is not expressed; band 2 is 92bp more than that of wild-type mice, its corresponding protein terminates prematurely at 213aa, exon7 is partially expressed; band 3 is 437bp more than the band of the wild-type mouse, its corresponding protein terminates prematurely at 213aa, and no splicing occurs at the introns between exon7 and exon 8.

The above results indicate that the c.653+1G > A mutation of the Meikin gene affects the cleavage of the gene, resulting in truncated protein expression.

3. Mouse fertility identification

Mating wild female mice with heterozygote mice, fertility manifesting as normal; the homozygote male mice were mated with 4 wild female mice simultaneously, and were unable to naturally gestate within 3 months, and exhibited complete male sterility.

HE staining identification

(1) Dehydration, embedding and slicing of testis tissue: testis tissue was fixed in 4% paraformaldehyde for 2 days; the testis tissue pieces were taken out of the fixative solution, rinsed with PBS for 1h, and then tissue dehydration was started (70% ethanol for 30min, 80% ethanol for 30min,90% ethanol for 30min,95% ethanol for 30min, absolute ethanol for 30min, xylene for 30min, and xylene for 30min, respectively). Testis tissue was completely soaked in wax solution at 60 ℃ overnight. Opening an embedding instrument, setting corresponding parameters, taking out tissue blocks in the paraffin liquid after 2 hours, putting the tissue blocks into a paraffin cylinder of an embedding machine, cleaning an iron groove used for embedding, putting the tissue blocks into the right center of the iron groove by forceps, taking out the iron groove, taking a small amount of the paraffin liquid to fill up a groove, inversely clamping an embedding box on the iron groove, putting the embedding box on a low-temperature workbench for cooling and solidifying, and taking down the embedded paraffin blocks after the embedding box is completely solidified; before slicing, firstly flattening the surface of the wax block, cutting into continuous slices with the thickness of 5 mu m, placing into cold water for spreading, separating the continuous wax belt by a blade, then placing into a water bath kettle with the temperature of 40 ℃, taking out the target wax belt by an anti-drop glass slide, placing into a slice copying machine for overnight, and preserving the tissue slices at the temperature of 4 ℃.

(2) HE staining: the xylene is dewaxed, and then the slice is fully rehydrated by gradient alcohol and water, and the specific flow is as follows: xylene I for 10min, xylene II for 10min, absolute ethanol I for 5min, absolute ethanol II for 5min,90% ethanol for 5min,80% ethanol for 5min, and tap water for 5min. Dropping a proper amount of hematoxylin on the slices subjected to dewaxing and rehydration to cover the tissue surface, dying the nuclei for 5min, and flushing out residual dye liquor by tap water; rapidly differentiating with 1% hydrochloric acid alcohol, and washing with tap water; dripping a proper amount of eosin dye solution on the surface of the tissue, dyeing for 30s, and flushing with tap water; transparent to tissue dehydration, the specific flow is as follows: sequentially adding 80% ethanol, 90% ethanol, 95% ethanol, absolute ethanol I and absolute ethanol II into the tissue for 5min, and then adding xylene I and xylene II for 10min to complete tissue dehydration and transparency; and (3) dropwise adding a drop of neutral resin sealing piece, observing under a microscope, photographing, and preserving at room temperature.

HE staining results are shown in fig. 12: with wild type mice (Meikin) ^+/+ ) In contrast, homozygous knock-in (Meikin ^KI/KI ) The number of sperm in the seminiferous tubules and epididymis was significantly smaller in mice.

In conclusion, the application successfully constructs the mice animal model knocked in by the Meikin gene, and lays a good foundation for research on Meikin gene functions and meiosis.

The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The above examples merely represent a few embodiments of the present application, which are described in more detail and are not to be construed as limiting the scope of the invention. It should be noted that it would be apparent to those skilled in the art that various modifications and improvements could be made without departing from the spirit of the present application, which would be within the scope of the present application. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Claims

1. A nucleic acid product that targets a Meikin gene, wherein the nucleic acid product comprises a first gRNA and a second gRNA;

2. A Meikin gene editing system, wherein said editing system comprises the nucleic acid product of claim 1;

3. A recombinant cell comprising the nucleic acid product of claim 1 that targets a Meikin gene or the Meikin gene editing system of claim 2.

4. A method of constructing an animal model for meiosis, the method comprising:

transferring the Meikin gene editing system of claim 2 into fertilized eggs of target animals to construct an animal model simulating human Meikin c.653+1G > A mutation.

5. The method for constructing an animal model of meiosis according to claim 4, wherein the method of transferring is microinjection.

6. The method for constructing an animal model of meiosis according to any of claims 4 to 5, further comprising transplanting fertilized eggs transferred into said Meikin gene editing system into pseudopregnant females and producing F0 generation; and

7. The method of claim 6, further comprising identifying the genotype of the subject animal using one or more of the following primers:

a first primer pair with a nucleotide sequence shown as SEQ ID NO. 5-6;

a second primer pair with a nucleotide sequence shown as SEQ ID NO. 7-8;

a third primer pair with a nucleotide sequence shown as SEQ ID NO. 9-10;

a fourth primer with a nucleotide sequence shown as SEQ ID NO. 11;

a fifth primer pair with a nucleotide sequence shown as SEQ ID NO. 12-13; and

and a sixth primer pair with the nucleotide sequence shown in SEQ ID NO. 14-15.

8. The method of claim 7, wherein the method of identifying comprises one or more of PCR and Sanger sequencing.

9. The method for constructing an animal model of meiosis according to any of claims 4 to 5 and 7 to 8, wherein the target animal comprises a mouse or a rat.

10. Use of an animal model of meiosis constructed by the method for constructing an animal model of meiosis according to any of claims 4 to 9 for screening a medicament for treating male infertility.