CN117587016A - Nucleic acid composition of targeted Actrt3 gene, construction method and application of animal model of teratospermia - Google Patents

Abstract

The application relates to a nucleic acid composition of a targeted Actrt3 gene, a construction method of a teratospermia animal model and application thereof. The nucleic acid composition comprises a first sgRNA and a second sgRNA, and the nucleotide sequences of the first sgRNA and the second sgRNA are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2. The nucleic acid composition targeting the Actrt3 gene can be used for efficiently and quickly knocking out the Actrt3 gene through verification, and sequencing results prove that the Actrt3 gene is knocked out in a mouse body, and the first sgRNA and the second sgRNA sequences are unique on target sequences on the Actrt3 gene to be changed.

Description

Nucleic acid composition of targeted Actrt3 gene, construction method and application of animal model of teratospermia

Technical Field

The application belongs to the technical field of biology, and particularly relates to a nucleic acid composition of a targeted Actrt3 gene, a construction method of a teratospermia animal model and application of the method.

Background

Infertility has become a major health concern worldwide, with about 50% of male factors, while genetic defects are important causative agents that cause male sperm abnormalities and cause infertility, accounting for about 15% of sterile men. Normal and orderly spermatogenesis produces mature sperm of normal morphology, structure and function, which is a very essential prerequisite. It was found that more than 2000 genes associated with spermatogenesis, and that abnormalities in these genes may lead to abnormal spermatogenesis, leading to male infertility. However, only 400 genes among them have been demonstrated to cause male sterility in animal models. In order to know spermatogenesis in more detail and provide new diagnosis and treatment ideas for male infertility, related pathogenic genes still need to be further mined and functionally explored.

Actrt3 belongs to a member of the family of microfilament-related proteins (Actin Related Protein T, actrt 3). The coding gene is located on chromosome 3 of the mouse, 1 transcript exists in the mouse, the total length of the transcript is 1110bp, the transcript comprises 2 exons, and the coded protein comprises 369 amino acid residues. At present, related research on Actrt3 is still very limited, brings great challenges to the accurate control of patients of this type, and researches and establishment of animal models of teratospermia have important significance for exploring the etiology, pathogenesis and therapeutic drug development of diseases.

Thus, there is a need for an effective method of constructing an animal model of teratospermia.

Disclosure of Invention

Based on the method, a simple and effective mode is designed, the Crispr-Cas system is utilized to quickly knock out the Actrt3 gene, an animal model Crispr-Cas system for constructing the disease can accurately cut DNA to cause double-strand break under the guidance of the first sgRNA and the second sgRNA, 2780bp basic groups on the Actrt3 gene can be specifically knocked out, the Actrt3 gene is disabled, and thus gene knockout is realized.

The specific scheme of the application is as follows:

in one aspect of the present application, a nucleic acid composition targeting the Actrt3 gene is provided, the nucleic acid composition comprising a first sgRNA and a second sgRNA, the nucleotide sequences of which are shown in SEQ ID No.1 and SEQ ID No.2, respectively.

Another aspect of the present application provides a kit for gene functional inactivation of a targeted Actrt3 gene, the kit comprising a nucleic acid composition as described above.

The application also provides a construction method of the animal model of the teratospermia, which comprises the following steps: editing Actrt3 genes of target animals by using a Crispr-Cas system to inactivate functions of the target animals, and constructing a teratospermia animal model;

wherein the Crispr-Cas system comprises a nucleic acid composition as described above and a Cas9 nuclease.

In one embodiment, the subject treated by the Crispr-Cas system is a fertilized egg of the target animal.

In one embodiment, the Crispr-Cas system is transferred into the fertilized egg by in vitro transcription of the nucleic acid composition and Cas9 nuclease described above into mRNA.

In one embodiment, the method of transferring the Crispr-Cas system into the fertilized egg is microinjection.

In one embodiment, the construction method further comprises the steps of:

transplanting the fertilized egg transferred into the Crispr-Cas system into a pseudopregnant female animal and producing an F0 generation;

mating the F0 generation with a wild type to obtain an F1 generation heterozygote, selfing the F1 generation heterozygote, and screening out a homozygous F2 generation serving as a teratospermia animal model.

In one embodiment, the target animal is a mouse or a rat.

In one embodiment, the target animal is a mouse, and the method of constructing further comprises the step of genotyping the mouse:

and (3) taking genome DNA extracted from the mice as a template, respectively adopting a first amplification primer pair with a forward primer sequence shown as SEQ ID NO. 3 and a reverse primer sequence shown as SEQ ID NO. 4 and a second amplification primer pair with a forward primer sequence shown as SEQ ID NO. 3 and a reverse primer sequence shown as SEQ ID NO. 5 for PCR amplification, and then identifying the Actrt3 genotype of the mice by an electrophoresis method.

The application also provides a method for screening or identifying a medicament for treating the teratospermia, which is prepared by using the nucleic acid composition, the kit or the construction method of the teratospermia animal model.

Based on the technical scheme, the application has the following beneficial effects:

the nucleic acid composition for targeting the Actrt3 gene designed by the application can be used for efficiently and quickly knocking out the Actrt3 gene through verification, and sequencing results prove that the Actrt3 gene is knocked out in a mouse body. Wherein the first sgRNA and the second sgRNA sequences are unique on the target sequence on the Actrt3 gene to be altered.

The Actrt3 gene knockout mice obtained by the method can be used as a teratospermia animal model for researching spermatogenesis disorder, and can realize a complete male sterility phenotype. The pathogenesis of the disease can be fully studied by using the mouse model, and the therapeutic mode aiming at the disease can be further developed.

Drawings

FIG. 1 is a graph showing the results of construction of Actrt3 knockout mice using the Crispr-Cas system in example 1;

FIG. 2 is an electrophoretogram of homozygous and wild type mouse Actrt3 gene amplification products in example 1;

FIG. 3 is a diagram showing the sequencing peaks of the amplification product of the homozygous mouse Actrt3 gene in example 1;

FIG. 4 is a graph showing immunoblotting results of homozygous and wild type mouse Actrt3 proteins in example 1;

FIG. 5 is a statistical chart of the number of pups obtained after 3 months of cage mixing of wild type male mice and homozygous male mice with female mice of the same age, respectively, in example 1.

Detailed Description

In order to facilitate an understanding of the present application, a more complete description of the present application will be provided below with reference to the examples, preferred examples of which are given below. This application may, however, be embodied in many different forms and is not limited to the embodiments described herein. These embodiments are provided so that this disclosure will be thorough and complete. It should be understood that the experimental methods in the following examples, in which specific conditions are not noted, are generally performed under conventional conditions or under conditions suggested by the manufacturer. The various reagents commonly used in the examples are all commercially available products.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in the description of the present application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. The term "and/or" as used herein includes any and all combinations of one or more of the associated listed items.

The principle of application of the Crispr-Cas system to gene knockout is that the tracrRNA-crRNA, when fused to a single-stranded guide RNA (i.e., sgRNA), is used to guide Cas9 action. The Cas9mRNA can transiently express Cas9 protease, and the Cas9 protease is characterized by being capable of autonomously binding and cutting a target gene, recognizing a target gene sequence by artificially designed sgrnas (small guide RNAs), and guiding the Cas9 protease to effectively cut a DNA double strand to form a double strand break of the DNA. In general, cells repair broken DNA by using a highly efficient Non-homologous end joining method (Non-homologous End Joining, NHEJ), but mismatch phenomena such as base insertion or deletion usually occur during repair, resulting in frame shift mutation, and disabling the target gene, thereby achieving gene knockout.

One embodiment of the application provides a nucleic acid composition for targeting Actrt3 gene, wherein the nucleic acid composition comprises a first sgRNA and a second sgRNA, and the nucleotide sequences of the first sgRNA and the second sgRNA are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2.

Specifically, the nucleotide sequence shown in SEQ ID NO.1 is: 5'-AGTAGTGTTCCAGGGCGAGTGGG-3'; the nucleotide sequence shown in SEQ ID NO.2 is: 5'-CAGCTCAGAAATCGCTGAACCGG-3'.

In one embodiment, a kit for gene functional inactivation of a targeted Actrt3 gene is provided, comprising the nucleic acid composition described above.

The nucleic acid composition and the kit for targeting the Actrt3 gene, which are designed above, can be used for efficiently and rapidly knocking out the Actrt3 gene through verification, and sequencing results prove that the Actrt3 gene is knocked out in a mouse body. Wherein the first sgRNA and the second sgRNA sequences are unique on the target sequence on the Actrt3 gene to be altered.

In one embodiment of the present application, a method for constructing an animal model for teratospermia is provided, comprising the steps of: editing Actrt3 gene of a target animal by using a Crispr-Cas system to inactivate the function of the target animal, and constructing a teratospermia animal model.

Optionally, the construction method comprises step S10 to step S40.

Step S10: editing Actrt3 genes of target animals by using a Crispr-Cas system to inactivate functions, and transferring the Crispr-Cas system into fertilized eggs to obtain fertilized eggs transferred into the Crispr-Cas system.

In some of these embodiments, the Crispr-Cas system described above comprises the nucleic acid composition described above and a Cas9 nuclease.

In some of these embodiments, the subject treated by the Crispr-Cas system is a fertilized egg of the target animal.

In some of these embodiments, the Crispr-Cas system is transferred into a fertilized egg by in vitro transcription of the nucleic acid composition and Cas9 nuclease into mRNA.

In some of these embodiments, the method of transferring the Crispr-Cas system into a fertilized egg is microinjection.

Step S20: the fertilized egg transferred into the Crispr-Cas system in step S10 is transplanted into a pseudopregnant female animal and an F0 generation is produced.

Step S30: mating the F0 generation in the step S20 with a wild type to obtain an F1 generation heterozygote.

Step S40: and (3) selfing the F1 generation heterozygote in the step (S30), and screening out the homozygous F2 generation serving as a teratospermia animal model.

In some embodiments, the target animal is a mouse or a rat.

In some embodiments, the target animal is a mouse, and the steps of obtaining the F0 generation, the F1 generation, and the F2 generation in step S20, step S30, and step S40 respectively include a step of genotyping the mouse, and the step of genotyping the mouse includes a step a, a step b, a step c, a step d, and a step e.

Step a: genomic DNA of the toe and/or tail of the mice was extracted.

Step b: and taking genome DNA extracted from the toe and/or tail of the mouse as a template, and respectively adopting a first amplification primer pair with a forward primer sequence shown as SEQ ID NO. 3 and a reverse primer sequence shown as SEQ ID NO. 4 and a second amplification primer pair with a forward primer sequence shown as SEQ ID NO. 3 and a reverse primer sequence shown as SEQ ID NO. 5 to carry out PCR amplification to obtain an amplification product.

Specifically, the first amplification primer pair has the sequences: the forward primer Actrt3-F1 (SEQ ID NO: 3): 5'-AGGACAGGAAAGATGTAACGTTGT-3'; the reverse primer Actrt3-R1 (SEQ ID NO: 4): 5'-ATATGTGATTAGGCACCACAGACG-3'; a second amplification primer pair having the sequence: the forward primer Actrt3-F1 (SEQ ID NO: 3): 5'-AGGACAGGAAAGATGTAACGTTGT-3'; reverse primer Actrt3-R2 (SEQ ID NO: 5): 5'-CAGTACCTGATGGATAGGAAGCTC-3'.

It can be understood that the designed first amplification primer pair mainly aims at the deletion variant fragment, since the first amplification primer pair is positioned at two sides of the mutation part, the normal Actrt3 gene fragment has no deletion region matched with the first amplification primer pair, and the mutation part itself has no primer sequence, thus the amplification cannot occur, and in the Actrt3 gene fragment with the deletion variant, the distance between the primers is shortened due to the deletion of a specific section, thereby improving the efficiency of PCR amplification and being capable of amplifying the fragment with a specific length; the designed second amplification primer pair mainly aims at a normal Actrt3 gene fragment, and as the second amplification primer pair is positioned at two sides of the first sgRNA cutting site, the DNA sequence of the mutant part does not have a region matched with the reverse primer, and amplification cannot occur. Thus, it is possible to determine whether or not there is a deletion variation in the sample by observing the length of the amplified product.

In some of these embodiments, the method of identifying comprises one or more of PCR and Sanger sequencing.

In some of these embodiments, in step b, the amplification procedure of the PCR is set to: pre-denaturation at 95 ℃ for 5min; denaturation at 94 ℃ for 30-45 s, annealing at 56-72 ℃ for 30-60 s, extension at 72 ℃ for 30-60 s, and total circulation for 30-35 times; finally, the PCR amplification product is extended for 5 minutes to 10 minutes at the temperature of 72 ℃, and is stored at the temperature of 4 ℃. It will be appreciated that in some other specific examples, the PCR procedure may be rationally adjusted.

In one specific example, the amplification procedure for PCR is set to: pre-denaturation at 95℃for 5min, denaturation at 94℃for 30s, annealing at 60℃for 30s, extension at 72℃for 40s for 35 cycles, extension at 72℃for 5min, and storage of PCR amplified products at 4 ℃.

Step c: agarose gel electrophoresis was performed on the PCR amplified products.

In one embodiment, in the step c, 3-5 mu L of PCR amplification product and DL1000 DNA Marker are respectively taken and put into a glue hole, 220V electrophoresis is carried out for 10-20 min, and imaging and photographing are carried out.

In one embodiment, in step c, the band size of the PCR amplification product is determined by agarose gel electrophoresis.

Step d: sequencing the amplified product.

In one embodiment, in step d, the sequencing method is Sanger sequencing.

In one embodiment, in step d, the sequencing analysis is performed using the same primer pair as the PCR amplification primer pair.

Step e: the Actrt3 genotype of the mice was identified.

In one embodiment, in step e, the sequence obtained by sequencing step d and the corresponding DNA sequence of the wild-type Actrt3 gene are set forth in SEQ ID NO:6, and analyzing whether the mice are Actrt3 knockout mice.

Specifically, the nucleotide sequence shown in SEQ ID NO. 6 is: 5'-AGGACAGGAAAGATGTAACGTTGTTTACTTTACTATACAGAACATAAACTCGTTTCACACCCCAGCACTCCCTGAAATTGATCCTTACAGAAGCCAGGCAGAGCCTTCCTGTAGCGATATTTCCAAGGCCGGTGTTAAGGGTCTTCCTCCAGCTTCCCACTCGCCCTGGAACACTACTGTTAACCACAGTGCAAGGACTTAAGAGAATTTTTTTTTAATAGACATTCAGCGTGTTTGAGAAAGGTTCTTGCAAATTGTTAGATTTCTATGTTTTGCAAGGGTAGCCCGGTTTTCTGGTATTAATGCTGAGAGCTTCCAGGAGCAGCGGTGATGCTCAACCCATGGAAAGCGGTCGCAGGAGGCACCTCACTCATGTCATGCGGGCCAGCAGATGGCCGGGTCCTCTGTGACGCGACATTACCAACACCTGTCACCGCACAGCCTGGGAAGAGCGGTCTGGAGGCGCAGATGCAGCAGCACCAGCGGCATGAGCGGCTACCAGCCACCAGTGGTGATCGACAACGGCTCGGGAATGATCAAGGCGGGCCTGGCTGGGACCCGGGAGCCCCAGTTTGTCTACCCGAATATTCTGGGCCGGTCCAAGGGCCATACGGCGGACAGCAGGCAGGAGCTGTGTGTGGGTGATCAAGCGCAGGAGCGCAGGAGCTTCCTATCCATCAGGTACTG-3'.

In one embodiment, in step e, a 2780bp DNA fragment on the knockout mouse Actrt3 gene is excised.

The construction method of the animal model for the teratospermia has at least the following advantages:

(1) An animal model of teratospermia for spermatogenesis disorder is constructed by inactivating Actrt3 gene function by targeting the first and second sgRNA sequences of Actrt3 gene.

(2) The construction method can realize the Actrt3 gene knockout in specific time and space through conditional gene knockout.

In addition, an embodiment of the present application also provides a method for screening or identifying a drug for treating teratospermia, using the above nucleic acid composition, the above kit or the above teratospermia animal model prepared by the above construction method.

The method for screening or identifying the medicament for treating the teratospermia utilizes the nucleic acid composition, the kit or the teratospermia animal model prepared by the construction method of the teratospermia animal model to screen or identify the medicament for treating the teratospermia, and the screening or identifying the medicament related to the teratospermia is more accurate for the teratospermia by aiming at the teratospermia animal model of spermatogenesis disorder.

The following is a detailed description of specific embodiments. The following examples are not specifically described but do not include other components than the unavoidable impurities. Reagents and apparatus used in the examples, unless otherwise specified, are all routine choices in the art. The experimental methods without specific conditions noted in the examples were carried out according to conventional conditions, such as those described in the literature, books, or recommended by the manufacturer.

Example 1

All mice were housed under specific pathogen free (SPF grade) conditions from the national institutes of health laboratory animal care and use guidelines of the national institutes of health, laboratory animal welfare ethics committee of the university of south China.

1. Sequence design of nucleic acid compositions targeting Actrt3 genes

The first and second sgrnas were designed and synthesized against the mouse Actrt3 gene:

first sgRNA (SEQ ID NO: 1): 5'-AGTAGTGTTCCAGGGCGAGTGGG-3';

second sgRNA (SEQ ID NO: 2): 5'-CAGCTCAGAAATCGCTGAACCGG-3'.

2. Construction of Actrt3 Gene knockout mice

2.1 A plasmid containing the first sgRNA and the second sgRNA described above was constructed.

2.2 The plasmid DNA is linearized and purified and transcribed with Cas9 nuclease in vitro into mRNA.

2.3 Preparation of fertilized eggs

1) Preparation of fertilized eggs: screening C57BL/6J female mice of 3 weeks to 4 weeks, and respectively injecting pregnant horse serum (PMSG) and chorionic gonadotrophin (hcg) at intervals of 46-48 hours;

2) Mating female mice with adult male-fertile mice after HCG injection to fertilize the female mice;

3) After euthanizing the female mice the next day, fertilized eggs were collected from the oviduct and placed in a constant temperature of 37℃at 5% CO ₂ Incubator internal preparationUsing;

2.4 electrotransfer fertilized eggs: opening an electroporation instrument, connecting an anode and a cathode, and setting electroporation parameters for later use; placing the prepared fertilized eggs into acid liquid for weakening the transparent belt, wherein 10S-20S is carried out; simultaneously, the prepared mRNA solution is added into an electrode dish;

1) Washing the weakened fertilized eggs for 3 times, and transferring the fertilized eggs to an electrode dish for electric transfer;

2) Transferring fertilized ovum after electrotransformation into M16 culture medium, and placing into CO with constant temperature of 37deg.C and 5% ₂ Culturing in an incubator for 0.5-1 h, and transplanting; or culturing to 2 cells, and transplanting the cells on the next day.

2.5 Recipient mouse preparation and embryo transfer

1) Pseudopregnant female mice were prepared: mating a fertile female mouse with a sterile male mouse after ligation of a seminiferous duct, and stimulating the female mouse to generate a series of gestation changes to obtain a pseudopregnant female mouse which is used as a receptor mouse after fertilized egg transgenosis;

2) Transplanting fertilized eggs injected with exogenous genes into oviducts of recipient female mice on the day of thrombus;

3) Placing the recipient female mice in a clean cage box after transplantation, preserving heat, and placing the mice back into the cage for feeding after the mice are awake;

4) After the oviduct transplantation is successful, the female mice generally born 19-20 d after the operation;

5) After the mice are born for 1 week, the mice can be subjected to paw shearing numbering and PCR-Sanger sequencing identification; mice were housed individually 3 weeks after birth.

2.6 Genotyping of birth offspring F0, F1, F2

Collecting 1-2 week old young mouse tissue (toe); lysing the tissue and extracting genomic DNA; PCR amplification and Sanger sequencing are carried out by specific primers aiming at target genes, and offspring of exogenous gene integration are screened out; the mice with integration are called initial mice (founder) and can be passaged and established.

2.6.1 extraction and purification of gDNA from knockout mice

The gDNA was extracted using the gDNA extraction kit (TIANamp Genomic DNA Kit, DP 304-03) from Tiangen. The method comprises the following steps:

1) Adding 200 mu L buffer GA into the toe or tail of a mouse, and shearing the tissues by using alcohol sterilized scissors;

2) Adding 20 mu L of protease K solution, and mixing the mixture upside down;

3) Inserting the EP pipe into the buoy, placing the buoy into a 56 ℃ water bath box for water bath for 1h, and reversing and uniformly mixing for 1 time;

4) Adding 200 mu L buffer solution GB, fully reversing and uniformly mixing, and standing at 70 ℃ for 10 min;

5) Adding 200 mu L of absolute ethyl alcohol, mixing the absolute ethyl alcohol upside down, and then vigorously vibrating on a vibrator for 15 sec;

6) Centrifuging the mixed solution in an adsorption column which is placed in a collecting pipe and marked, at 12000 rcf/min for 30 sec, discarding the collecting pipe, and placing the adsorption column in a brand new collecting pipe;

7) Adding 500 mu L of buffer GD into the adsorption column, mixing the mixture upside down, centrifuging the mixture for 30 sec at 12000 rcf/min, discarding the collection tube, and placing the adsorption column into a brand new collection tube;

8) Adding 600 mu L of rinsing liquid PW into the adsorption column, mixing the materials upside down, centrifuging the mixture for 30 sec at 12000 rcf/min, discarding the collection pipe, and placing the adsorption column into a brand new collection pipe; repeating step (8);

9) Separating the adsorption column at 12000 rcf/min for 2 min, discarding the collecting pipe, placing the adsorption column into a brand new 1.5mL EP pipe, and air drying for 5min;

10 Suspending and dripping 250 mu L TE to the middle part of the adsorption film, standing at room temperature for 5min, centrifuging at 12000 rcf/min for 1min, discarding the adsorption column, covering the EP tube, and marking.

2.6.2 Genotyping by PCR and Sanger sequencing

The offspring mice bred by hybridization were genotyped based on toe genomic DNA by PCR and Sanger sequencing using primers comprising: a first amplification primer pair having the sequence: the forward primer Actrt3-F1 (SEQ ID NO: 3): 5'-AGGACAGGAAAGATGTAACGTTGT-3'; the reverse primer Actrt3-R1 (SEQ ID NO: 4): 5'-ATATGTGATTAGGCACCACAGACG-3'; a second amplification primer pair having the sequence: the forward primer Actrt3-F1 (SEQ ID NO: 3): 5'-AGGACAGGAAAGATGTAACGTTGT-3'; reverse primer Actrt3-R2 (SEQ ID NO: 5): 5'-CAGTACCTGATGGATAGGAAGCTC-3'; the Tm value of the amplification primer pair is 60 ℃;

the PCR amplification system (20. Mu.L) was as follows:

TABLE 1

The PCR amplification procedure was: pre-denaturation at 95 ℃ for 5min; denaturation at 94℃for 30s; annealing at 60 ℃ for 30s; extending at 72 ℃ for 40s, wherein the total time is 35 cycles; extension at 72℃for 5min and finally the procedure was ended at 4 ℃.

And (3) carrying out agarose gel electrophoresis on the PCR amplified product, determining that the amplified target band is correct, and then sending the rest PCR amplified product to the department of Praeparata Biotechnology, inc. (Beijing, china) for Sanger sequencing verification.

2.6.3 immunoblotting to detect Actrt3 protein expression level

Protein immunoblotting experiments of wild and knockout mouse testis tissues were performed with Actrt3 antibody, and it was found that one band was detected at the 41kD size in wild mouse testis, but no band was found in knockout mouse.

The WB immunoblotting was performed as follows:

1. testis tissue protein extraction

1) Sample acquisition: taking the testis tissue of the Actl9 gene knockout mouse, removing the tunica albuginea, putting the testis tissue into a 2mL grinding tube for shearing, and adding 5-6 steel balls with the diameter of 3 mm;

2) Lysing the cells: add 700. Mu.L of lysate (RAPI: PMSF=100:1);

3) Tissue grinding: -15 ℃ low temperature grinding for 20 seconds;

4) Protein denaturation: 400. Mu.L of the middle layer cell lysate was placed in a 1.5mL centrifuge tube, 100. Mu.L of 5 Xprotein loading buffer was added, and the mixture was heated in a metal bath at 98℃for 10min.

2. Preparing a rubber plate: 4-20% of 15-hole prefabricated glue which is purchased from ACE, and after the electrophoresis frame is placed in an electrophoresis tank, adding a proper amount of electrophoresis buffer solution into the tank;

3. spotting: dispensing 10 mu L of prepared testis tissue protein into each hole and 3.5 mu L of pre-dyeing marker into each glue hole respectively;

4. protein electrophoresis: performing 160V constant-pressure electrophoresis for 35min, and stopping when the indicator approaches the lower edge of the gel plate;

5. transferring:

1) After electrophoresis is completed, taking out gel from the glass plate, and soaking the gel in the film transfer liquid;

2) Cutting out the gel of the part where the target protein is located according to the position where the protein marker strip is located, removing the redundant part, and placing the gel on filter paper attached to the membrane transfer plate;

3) Cutting a PVDF film with the gel size equivalent to that of the part where the target protein is located, soaking the PVDF film in a methanol solution for about 1min, and covering the PVDF film on the target protein gel;

4) And (3) installing and finishing film transferring equipment: the black surface of the film transferring frame faces downwards, a film transferring device is assembled from bottom to top according to the sequence of sponge-three layers Bao Lvzhi-glue blocks-PVDF film-filter paper-sponge, and a proper amount of film transferring buffer solution is added;

5) The whole device is soaked in ice-water mixture, and a constant current rotating film of 250mA (0.25A) is used for 30min,

6. closing: after the membrane transfer is completed, soaking the PVDF membrane in a protein sealing liquid (2 g of skimmed milk powder+40 ml of TBST), and sealing the PVDF membrane on a horizontal shaking table for about 1h at room temperature;

7. elution & incubation primary antibody: washing the membrane with TBST 3 times at room temperature on a shaking table for 10min each time; clamping PVDF membrane, adding Actl9 primary antibody diluent, and incubating overnight at 4 ℃;

8. eluting & incubating the secondary antibody: washing the membrane for 3 times by TBST for 10min each time, then clamping the PVDF membrane out, adding secondary antibody diluent, and incubating for about 1h in a room temperature environment;

9. eluting: TBST washes the membrane for 3 times, each time for 10 min;

ecl method exposure.

1) Preparing a proper amount of ECL liquid (uniformly mixing the A liquid and the B liquid in a ratio of 1:1), and dripping the ECL liquid onto a PVDF film placed on an exposure plate;

2) The exposure plate is placed in a gel imaging system to image the exposure plate, and a photo is taken for later use.

11. The obtained WB strip images were analyzed using Image-J software.

2.6.4 fertility identification

To determine whether Actrt3 gene mutations affected fertility in mice, wild adult male mice and Actrt3 knockout adult male mice were subjected to cage experiments (more than three months) with wild adult female mice, respectively, and the number of offspring produced by different genotype male and female combinations was recorded to assess fertility.

3. Analysis of results

(1) Sequencing result analysis and sequence comparison

The present application successfully constructs a knockout comprising the Actrt3 gene in mice (C57 BL/6) using the Crispr-Cas system, as shown in fig. 1.

The genotype was determined by agarose gel electrophoresis and Sanger sequencing of the PCR products. Sequencing results analysis and alignment analysis software was "Chromas", alignment software was used at the wire mesh station: https:// blast.ncbi.nlm.nih.gov/blast.cgi. The "peak pattern" of the sequencing results of homozygous mice is shown in FIG. 3 below, where the homozygous mice lack 2780 bases.

1) The genotyping result judgment criteria are shown in table 2 below:

TABLE 2

2) Analysis of results of genotypes of mice

(1) Wild type: PCR procedures in the above step 2.6.2 were performed using Actrt3-F1, actrt3-R1 and Actrt3-F1, actrt3-R2 primers, respectively, according to the system of Table 1, and a 687bp band was obtained for the PCR products of the Actrt3-F1 and Actrt3-R2 primers, the agarose gel electrophoresis pattern of which is shown in FIG. 2, lane WT represents the electrophoresis pattern of the wild-type mouse PCR amplification product, and Sanger sequencing was performed on the PCR products using the Actrt3-F and Actrt3-R2 primers, and the results were shown as SEQ ID NO. 6.

Specifically, the nucleotide sequence shown in SEQ ID NO. 6 is: 5'-AGGACAGGAAAGATGTAACGTTGTTTACTTTACTATACAGAACATAAACTCGTTTCACACCCCAGCACTCCCTGAAATTGATCCTTACAGAAGCCAGGCAGAGCCTTCCTGTAGCGATATTTCCAAGGCCGGTGTTAAGGGTCTTCCTCCAGCTTCCCACTCGCCCTGGAACACTACTGTTAACCACAGTGCAAGGACTTAAGAGAATTTTTTTTTAATAGACATTCAGCGTGTTTGAGAAAGGTTCTTGCAAATTGTTAGATTTCTATGTTTTGCAAGGGTAGCCCGGTTTTCTGGTATTAATGCTGAGAGCTTCCAGGAGCAGCGGTGATGCTCAACCCATGGAAAGCGGTCGCAGGAGGCACCTCACTCATGTCATGCGGGCCAGCAGATGGCCGGGTCCTCTGTGACGCGACATTACCAACACCTGTCACCGCACAGCCTGGGAAGAGCGGTCTGGAGGCGCAGATGCAGCAGCACCAGCGGCATGAGCGGCTACCAGCCACCAGTGGTGATCGACAACGGCTCGGGAATGATCAAGGCGGGCCTGGCTGGGACCCGGGAGCCCCAGTTTGTCTACCCGAATATTCTGGGCCGGTCCAAGGGCCATACGGCGGACAGCAGGCAGGAGCTGTGTGTGGGTGATCAAGCGCAGGAGCGCAGGAGCTTCCTATCCATCAGGTACTG-3'.

(2) Homozygous type: the PCR procedure in step 2.6.2 was carried out in the system of Table 1 using Actrt3-F1, actrt3-R1 and Actrt3-F1, actrt3-R2 primers, respectively, to give 394 as PCR products of Actrt3-F and Actrt3-R1 primersbp bands whose agarose gel electrophoresis pattern is shown in FIG. 2, wherein lane Homo represents the electrophoresis pattern of the homozygous mouse PCR amplification product, lane M: marker (5000 bp); the "peak pattern" of the sequencing results of homozygous mice is shown in FIG. 3, and Sanger sequencing was performed on the PCR products using Actrt3-F and Actrt3-R1 primers, and the results are shown in SEQ ID NO. 7.

Specifically, the nucleotide sequence shown in SEQ ID NO. 7 is: 5'-AGGACAGGAAAGATGTAACGTTGTTTACTTTACTATACAGAACATAAACTCGTTTCACACCCCAGCACTCCCTGAAATTGATCCTTACAGAAGCCAGGCAGAGCCTTCCTGTAGCGATATTTCCAAGGCCGGTGTTAAGGGTCTTCCTCCAGCTTCCCCGGTCCTTCTGCTGGGGAATGGTTTTTATTGTGAATGTGATAGGGAAAAGAATCCAGACGCATCTGGAAGAGTTCGAAGCAGAGAGAGAAGTAGACTGGGCATGGGCGAGGTAGTCTGCAAGACAGTGTGAGAGAGCGGGGATGGGGGGGTGGGGGTGGGGTGGGGAAATCTTGCAGATTCTGTCACGCCCAAAAGAACCTGGACAGATGGCCGTCTGTGGTGCCTAATCACATAT-3'.

(3) Heterozygous: the PCR procedure in step 2.6.2 above was performed with Actrt3-F1, actrt3-R1 and Actrt3-F1, actrt3-R2 primers, respectively, according to the system of Table 1, and the results are shown in FIG. 2, wherein lane Heter shows the electrophoresis pattern of the PCR amplification products of heterozygous mice.

(2) Immunoblotting to detect Actrt3 protein expression level

Protein immunoblotting experiments of wild and knockout mouse testis tissues were performed with Actrt3 antibody, and it was found that one band was detected at the 41kD size in wild mouse testis, but no band was found in knockout mouse.

(3) Fertility identification

As shown in fig. 5, normal male mice were found to be fertile for pups with wild female mice, but knockout male mice were paired with wild female mice for 3 months, and pups were not found to be born, indicating that Actrt3 knockout mice developed a complete male sterile phenotype.

In conclusion, the invention successfully constructs the Actrt3 gene knockout mouse animal model for the first time, and lays a good foundation for further researching the function of Actrt 3.

The technical features of the above embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The above examples only represent a few embodiments of the present application, which are described in more detail and are not to be construed as limiting the scope of the present application. It should be noted that it would be apparent to those skilled in the art that various modifications and improvements could be made without departing from the spirit of the present application, which would be within the scope of the present application. Accordingly, the scope of protection of the present application is to be determined by the claims appended hereto.

Claims (10)

1. A nucleic acid composition for targeting Actrt3 gene is characterized in that the nucleic acid composition comprises a first sgRNA and a second sgRNA, and the nucleotide sequences of the first sgRNA and the second sgRNA are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2.

2. A kit for gene functional inactivation of a targeted Actrt3 gene, comprising the nucleic acid composition of claim 1.

3. The construction method of the animal model of the teratospermia is characterized by comprising the following steps: editing Actrt3 genes of target animals by using a Crispr-Cas system to inactivate functions of the target animals, and constructing a teratospermia animal model;

wherein the Crispr-Cas system comprises the nucleic acid composition of claim 1 and a Cas9 nuclease.

4. The method of claim 3, wherein the subject treated by the Crispr-Cas system is a fertilized egg of the target animal.

5. The method of construction of claim 4, wherein the Crispr-Cas system is transferred into the fertilized egg by in vitro transcription of the nucleic acid composition of claim 1 and Cas9 nuclease into mRNA.

6. The method of construction according to claim 4 or 5, wherein the method of transferring the Crispr-Cas system into the fertilized egg is microinjection.

7. The construction method according to claim 6, characterized in that the construction method further comprises the steps of:

transplanting the fertilized egg transferred into the Crispr-Cas system into a pseudopregnant female animal and producing an F0 generation;

mating the F0 generation with a wild type to obtain an F1 generation heterozygote, selfing the F1 generation heterozygote, and screening out a homozygous F2 generation serving as a teratospermia animal model.

8. The method of claim 7, wherein the target animal is a mouse or a rat.

9. The method of claim 8, wherein the target animal is a mouse, and wherein the method further comprises the step of genotyping the mouse:

and (3) taking genome DNA extracted from the mice as a template, respectively adopting a first amplification primer pair with a forward primer sequence shown as SEQ ID NO. 3 and a reverse primer sequence shown as SEQ ID NO. 4, and carrying out PCR amplification on a second amplification primer pair with a forward primer sequence shown as SEQ ID NO. 3 and a reverse primer sequence shown as SEQ ID NO. 5, and then identifying the Actrt3 genotype of the mice by an electrophoresis method.

10. A method for screening or identifying a medicament for treating a teratospermia, which is characterized by screening or identifying a medicament for treating a teratospermia by using the nucleic acid composition of claim 1, the kit of claim 2 or the teratospermia animal model prepared by the method for constructing a teratospermia animal model of any one of claims 3 to 9.