CN117143869A

CN117143869A - Nucleic acid composition of targeted C12orf40 gene, preparation method and application of non-obstructive azoospermia animal model

Info

Publication number: CN117143869A
Application number: CN202310578804.9A
Authority: CN
Inventors: 涂超峰; 谭跃球; 王韦力; 蒙岚岚; 谭琛; 粟丽兰; 易思兵; 张前军; 张欢; 聂洪川
Original assignee: Reproductive and Genetic Hospital of CITIC Xiangya Co Ltd
Current assignee: Reproductive and Genetic Hospital of CITIC Xiangya Co Ltd
Priority date: 2023-05-22
Filing date: 2023-05-22
Publication date: 2023-12-01

Abstract

The application relates to a nucleic acid composition of a targeted C12orf40 gene, a preparation method and application of a non-obstructive azoospermia animal model. The nucleic acid composition comprises a first sgRNA and a second sgRNA, and the nucleotide sequences of the first sgRNA and the second sgRNA are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2. The nucleic acid composition targeting the C12orf40 gene can be used for efficiently and quickly knocking out and knocking in the fourth exon of the C12orf40 gene by verification, sequencing results prove that the C12orf40 gene is knocked out in a mouse body, and the first sgRNA and the second sgRNA sequences are unique on the target sequence on the C12orf40 gene to be changed. The C12orf40 knockout mice obtained by the method can be used as a non-obstructive azoospermia animal model for researching spermatogenesis disorder and blocking the occurrence of meiosis stage, and the pathogenesis of the disease can be fully researched.

Description

Nucleic acid composition of targeted C12orf40 gene, preparation method and application of non-obstructive azoospermia animal model

Technical Field

The application belongs to the technical field of biology, and particularly relates to a nucleic acid composition targeting a C12orf40 gene, a preparation method of a non-obstructive azoospermia animal model and application thereof.

Background

Studies show that the functional defect of testis-specific high-expression genes is an important cause of male infertility, such as testis-specific high-expression genes of TEX11, SHOC1, MEIOB and the like, and the functional defect can cause the human testis sperm generation and mouse testis sperm generation blocking to be further represented as non-obstructive azoospermia (NOA-obstruction azoospermia), which is a phenotype of the most serious male infertility, and the research and the establishment of an animal model of the non-obstructive azoospermia are of great significance for the detection of disease etiology, pathogenesis and treatment drug development.

Currently, constructing a specific target gene knockout or knock-in mouse based on a gene editing technology is a mainstream method for researching the function of a target gene. Homologous recombination technique (homologo recom)The combination, HR) is the earliest gene editing technology and is a major breakthrough in eukaryotic gene editing. The principle is that exogenous target gene is led into acceptor cell, and through homologous sequence exchange, exogenous DNA segment replaces gene in original site, so as to reach the aim of inactivating specific gene or repairing defective gene. However, for higher eukaryotes, the natural recombination rate of the exogenous DNA and the target DNA is very low, and only 1/10 ⁷ —1/10 ⁶ Therefore, the large-scale application of HR is somewhat limited.

Thus, there is a need for efficient methods of constructing non-obstructive azoospermia animal models.

Disclosure of Invention

Based on the method, a simple and effective mode is designed, the Crispr-Cas system is utilized to quickly knock out the C12orf40 gene, an animal model Crispr-Cas system for constructing the disease can accurately cut DNA to cause double-strand break under the guidance of the first sgRNA and the second sgRNA, and the fourth exon specific fragment DNA of the C12orf40 gene in the genome can be excised, but when the DNA double-strand is repaired, the mismatch phenomenon of base insertion or deletion occurs, so that the frame shift mutation is caused, and the C12orf40 gene is disabled, thereby realizing gene knockout.

The specific scheme of the application is as follows:

in one aspect, the application provides a nucleic acid composition targeting the C12orf40 gene, wherein the nucleic acid composition comprises a first sgRNA and a second sgRNA, and the nucleotide sequences of the first sgRNA and the second sgRNA are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2.

In another aspect the application provides a kit for inactivating gene function of a targeted C12orf40 gene, said kit comprising a nucleic acid composition as described above.

The application also provides a preparation method of the non-obstructive azoospermia animal model, which comprises the following steps: editing a C12orf40 gene of a target animal by using a Crispr-Cas system to inactivate the function of the target animal, and preparing a non-obstructive azoospermia animal model;

wherein the Crispr-Cas system comprises a nucleic acid composition as described above and a Cas9 enzyme.

In one embodiment, the subject treated by the Crispr-Cas system is a fertilized egg of the target animal.

In one embodiment, the Crispr-Cas system is transferred into the fertilized egg in the form of the nucleic acid composition and Cas9 mRNA.

In one embodiment, the method of transferring the Crispr-Cas system into the fertilized egg is microinjection.

In one embodiment, the method of making further comprises transplanting the fertilized egg transferred into the Crispr-Cas system into a pseudopregnant female and producing an F0 generation;

mating the F0 generation with a wild type to obtain an F1 generation heterozygote, and selfing the F1 generation heterozygote to obtain a homozygous F2 generation.

In one embodiment, the target animal is a mouse or a rat.

In one embodiment, the target animal is a mouse, and the method further comprises the step of genotyping the mouse: and (3) taking genome DNA extracted from the toe of the mouse as a template, taking SEQ ID NO.3 and SEQ ID NO.4 as primers, and identifying the genotype of the C12orf40 of the mouse by an electrophoresis method after PCR amplification.

Based on the technical scheme, the application has the following beneficial effects:

the nucleic acid composition of the targeted C12orf40 gene designed by the application can be used for efficiently and quickly knocking out and knocking in the fourth exon of the C12orf40 gene through verification, and the sequencing result proves that the C12orf40 gene is knocked out in the mouse body. Wherein the first sgRNA and the second sgRNA sequences are unique on the target sequence on the C12orf40 gene to be altered.

The C12orf40 knockout mice obtained by the method are used as non-obstructive azoospermia animal models for researching spermatogenesis disorder and blocking the occurrence of meiosis, and the pathogenesis of the disease can be fully researched by utilizing the mouse models, and the treatment mode aiming at the disease can be further developed.

The application also provides a method for screening or identifying a drug for treating non-obstructive azoospermia, which uses the nucleic acid composition, the kit or the non-obstructive azoospermia animal model prepared by the method for preparing a non-obstructive azoospermia animal model.

Drawings

FIG. 1 is a graph showing the results of constructing a C12orf40 knockout mouse using the Crispr-Cas system in example 1;

FIG. 2 is a graph showing the phenotypic effects of male sterility with non-obstructive azoospermia in C12orf40 knockout male mice in example 1.

Detailed Description

In order that the application may be understood more fully, a more particular description of the application will be rendered by reference to specific embodiments thereof which are illustrated in the appended claims. This application may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. These embodiments are provided so that this disclosure will be thorough and complete. It should be understood that the experimental methods in the following examples, in which specific conditions are not noted, are generally performed under conventional conditions or under conditions suggested by the manufacturer. The various reagents commonly used in the examples are all commercially available products.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in the description of the application herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. The term "and/or" as used herein includes any and all combinations of one or more of the associated listed items.

Gene knockout (knockout) refers to a technique of site-directed integration of a foreign gene into a certain site on the genome of a target cell by homologous recombination to achieve site-directed modification of a gene on a chromosome. The method can change the genetic gene of the organism aiming at a sequence with a known sequence but unknown function, and lead the function of a specific gene to lose effect, thereby shielding part of functions, further influencing the organism and further estimating the biological function of the gene. Gene knockout is classified into two types, complete gene knockout (Conditional Knockout, CKD, also called incomplete gene knockout), which means complete elimination of target gene activity in cells or animal individuals by homologous recombination, and conditional gene knockout, which means realization of gene knockout in specific time and space by a positional recombination system. The Crispr-Cas system is a third generation genome site-directed editing technology that occurs subsequent to "zinc finger endonuclease (ZFN)", "transcription activator-like effector nucleases (TALENs)".

The principle of application of the Crispr-Cas system to gene knockout is that the tracrRNA-crRNA, when fused to a single-stranded guide RNA (i.e., sgRNA), is used to guide Cas9 action. For the target gene, the target gene sequence is identified through artificially designed sgRNA (small guide RNA), and Cas9 protease is guided to effectively cut DNA double chains to form double-chain breaks of the DNA. In general, cells repair broken DNA by using a highly efficient Non-homologous end joining method (Non-homologous End Joining, NHEJ), but mismatch phenomena such as base insertion or deletion usually occur during repair, resulting in frame shift mutation, and disabling the target gene, thereby achieving gene knockout.

The mouse C12orf40 gene, located on chromosome 3, has a full length of 62637bp, contains 13 exons, and encodes 652 amino acids in total. Proteinatlas (www.proteinatlas.org /) and Human Testis Atlas Browser (https:// humanstisatlas. Shiny apps. Io/humanstisatlas 1 /) web site predictions show that the C12orf40 gene is specifically highly expressed in testis tissue and in spermatocytes, suggesting that the function of the C12orf40 gene may be closely related to spermatogenesis, and that its functional deficiency may lead to arrest of human and mouse testis spermatogenesis and thus appear as non-obstructive azoospermia. Thus, the functional inactivation of the C12orf40 gene can be used to block the production of non-obstructive azoospermia animal models that occur in the meiosis stage.

Based on this, an embodiment of the present application provides a nucleic acid composition targeting the C12orf40 gene, comprising a first sgRNA and a second sgRNA, the nucleotide sequences of which are shown in SEQ ID No.1 and SEQ ID No.2, respectively.

Specifically, the nucleotide sequence shown as SEQ ID NO.1 is: 5'-CTGGTCATATTCACATGAGTTGG-3'; the nucleotide sequence shown in SEQ ID NO.2 is: 5'-TAGAGGGACTTTCAAATCTCTGG-3'.

In one embodiment of the application, a kit for inactivating gene functions of a targeted C12orf40 gene is provided, which comprises the nucleic acid composition described above.

The nucleic acid composition and the kit for targeting the C12orf40 gene, which are designed above, can be used for efficiently and quickly knocking out and knocking in the fourth exon of the C12orf40 gene through verification, and the sequencing result proves that the C12orf40 gene is knocked out in the mouse body. Wherein the first sgRNA and the second sgRNA sequences are unique on the target sequence on the C12orf40 gene to be altered.

In one embodiment of the application, a method for preparing a non-obstructive azoospermia animal model is provided, comprising the following steps: the C12orf40 gene of the target animal was edited using the Crispr-Cas system to inactivate its function and prepare a non-obstructive azoospermia animal model.

Optionally, the preparation method comprises steps S10 to S40.

Step S10: editing a C12orf40 gene of a target animal by using a Crispr-Cas system to inactivate the function, and transferring the Crispr-Cas system into fertilized eggs to obtain fertilized eggs transferred into the Crispr-Cas system.

In some of these embodiments, the Crispr-Cas system described above comprises the nucleic acid composition described above and a Cas9 enzyme.

In some of these embodiments, the subject treated by the Crispr-Cas system is a fertilized egg of the target animal.

In some of these embodiments, the Crispr-Cas system is transferred into a fertilized egg in the form of a nucleic acid composition and Cas9 mRNA.

In some of these embodiments, the method of transferring the Crispr-Cas system into a fertilized egg is microinjection.

Step S20: the fertilized egg transferred into the Crispr-Cas system in step S10 is transplanted into a pseudopregnant female animal and an F0 generation is produced.

Step S30: mating the F0 generation in the step S20 with a wild type to obtain an F1 generation heterozygote.

Step S40: and (3) selfing the F1 generation heterozygote in the step S30 to obtain a homozygous F2 generation.

In some embodiments, the target animal is a mouse or a rat.

In some embodiments, the target animal is a C57BL6 mouse.

In some embodiments, the target animal is a mouse, and the steps of obtaining the F0 generation, the F1 generation, and the F2 generation in step S20, step S30, and step S40 respectively include a step of genotyping the mouse, and the step of genotyping the mouse includes a step a, a step b, a step c, a step d, and a step e.

Step a: genomic DNA of the toes of the mice was extracted.

Step b: and (3) taking genome DNA extracted from the toe of the mouse as a template, and taking SEQ ID NO.3 and SEQ ID NO.4 as primers for PCR amplification to obtain an amplification product.

Specifically, the nucleotide sequence shown as SEQ ID NO.3 is: 5'-TTAGAGCCCTTTAATTGAAGCAGG-3'; the nucleotide sequence shown in SEQ ID NO.4 is: 5'-GAATGACATCAACAAGCAGTGGAG-3'.

In some of these embodiments, in step b, the amplification procedure of the PCR is set to: pre-denaturation at 95 ℃ for 5min; denaturation at 94 ℃ for 30-45 s, annealing at 56-60 ℃ for 30-60 s, extension at 72 ℃ for 45-60 s, and co-circulation for 30-35 times; finally, the PCR amplification product is extended for 3 to 7 minutes at 72 ℃, and is stored at 4 ℃. It will be appreciated that in some other specific examples, the PCR procedure may be rationally adjusted.

In one specific example, the amplification procedure for PCR is set to: pre-denaturation at 95℃for 5min, denaturation at 94℃for 45s, annealing at 59℃for 30s, extension at 72℃for 45s, total of 34 cycles, extension at 72℃for 5min, and storage of PCR amplified product at 4 ℃.

Step c: agarose gel electrophoresis was performed on the PCR amplified products.

In one embodiment, in the step c, 3-5 mu L of PCR amplification product and DL5000DNA Marker are respectively taken and put into a gel hole, and electrophoresis is carried out for 10-20 min at 220V, and imaging and photographing are carried out.

In one embodiment, in step c, the band size of the PCR amplification product is determined by agarose gel electrophoresis.

Step d: sequencing the amplified product.

In one embodiment, in step d, the sequencing method is Sanger sequencing.

In one embodiment, in step d, the sequencing analysis is performed using the same primer pair as the PCR amplification primer pair.

Step e: the C12orf40 genotype of the mice was identified.

In one embodiment, in step e, the sequence obtained by sequencing step d is identical to the fourth exon DNA sequence of the wild-type C12orf40 gene as set forth in SEQ ID NO:5, and analyzing whether the mice are C12orf40 knockout mice.

Specifically, the nucleotide sequence shown as SEQ ID NO.5 is: 5'-AAACCATGAAAAGACCAACTCATGTGAATATGACCAGAGATTTGAAAGTCCCTCTAAGGAAGCATGATTTAGAACTTCCAATGTCACCTCACTGTGTGCCTTCTAAACTGTGCATTGATGATATGGAGGACAG-3'.

In one embodiment, in step e, the ctctctcttig sequence is knocked out at position c.221_225 of exon C12orf40 of the mouse while inserting the TA sequence.

The preparation method of the non-obstructive azoospermia animal model has at least the following advantages:

(1) A non-obstructive azoospermia animal model with dysspermatogenesis and arrest of the occurrence in the meiosis stage was prepared by inactivating the C12orf40 gene function by targeting the first and second sgRNA sequences of the C12orf40 gene.

(2) The preparation method can realize C12orf40 gene knockout in specific time and space through conditional gene knockout.

In addition, an embodiment of the present application also provides a method for screening or identifying a drug for treating non-obstructive azoospermia, using the nucleic acid composition as described above, the kit as described above, or the non-obstructive azoospermia animal model prepared by the method for preparing a non-obstructive azoospermia animal model as described above.

The above method for screening or identifying a drug for treating non-obstructive azoospermia using the above nucleic acid composition, the above kit or the above method for producing a non-obstructive azoospermia animal model is more accurate for screening or identifying a drug involved in non-obstructive azoospermia acting in meiosis phase, because the above non-obstructive azoospermia animal model is directed against spermatogenesis disorder and blocks non-obstructive azoospermia animal models occurring in meiosis phase.

The following is a detailed description of specific embodiments. The following examples are not specifically described but do not include other components than the unavoidable impurities. Reagents and apparatus used in the examples, unless otherwise specified, are all routine choices in the art. The experimental methods without specific conditions noted in the examples were carried out according to conventional conditions, such as those described in the literature, books, or recommended by the manufacturer.

Example 1

All mice were housed under specific pathogen free (SPF grade) conditions from the national institutes of health laboratory animal care and use guidelines of the national institutes of health, laboratory animal welfare ethics committee of the university of south China.

1. Sequence design of nucleic acid compositions targeting the C12orf40 Gene

The first and second sgrnas were designed and synthesized for the (ensmest 00000190436: c.221_225 delctctctctctg-insTA) site of exon 4 of the mouse C12orf40 gene:

first sgRNA (SEQ ID No. 1): 5'-CTGGTCATATTCACATGAGTTGG-3';

second sgRNA (SEQ ID No. 2): 5'-TAGAGGGACTTTCAAATCTCTGG-3'.

Construction of C12orf40 Gene knockout mice

2.1 construction of plasmids containing the first and second sgrnas described above.

2.2 preparation of RNP complexes: in vitro transcribed into RNA and mixed with Cas9mRNA transcribed by T7 RNA polymerase (NEB, cat# M0646M) and the first and second sgRNAs.

2.3 preparation of fertilized eggs

1) Preparation of fertilized eggs: screening C57BL/6 female mice of 3-4 weeks, and respectively injecting pregnant horse serum (PMSG) and chorionic gonadotrophin (hcg) at a time interval of 46-48 hours;

2) Mating female mice with adult male-fertile mice after HCG injection to fertilize the female mice;

3) After euthanizing the female mice the next day, fertilized eggs were collected from the oviduct and placed in a constant temperature of 37℃at 5% CO ₂ The incubator is reserved for standby;

2.4 electrotransfer fertilized eggs: opening an electroporation instrument, connecting an anode and a cathode, and setting electroporation parameters for later use; placing the prepared fertilized eggs into acid liquid for weakening the transparent belt for 10S-20S; simultaneously, the prepared mRNA solution is added into an electrode dish;

1) Washing the weakened fertilized eggs for 3 times, and transferring the fertilized eggs to an electrode dish for electric transfer;

2) Transferring fertilized eggs after electrotransfer to an M16 culture medium, placing the fertilized eggs into a CO2 incubator with constant temperature of 37 ℃ and 5%, culturing for 0.5-1 h, and transplanting; or culturing to 2 cells, and transplanting the cells on the next day.

2.5 preparation of recipient mice and embryo transfer

1) Pseudopregnant female mice were prepared: mating a fertile female mouse with a sterile male mouse after ligation of a seminiferous duct, and stimulating the female mouse to generate a series of gestation changes to obtain a pseudopregnant female mouse which is used as a receptor mouse after fertilized egg transgenosis;

2) Transplanting fertilized eggs injected with exogenous genes into oviducts of recipient female mice on the day of thrombus;

3) Placing the recipient female mice in a clean cage box after transplantation, preserving heat, and placing the mice back into the cage for feeding after the mice are awake;

4) After the oviduct transplantation is successful, the female mice generally farrowed 19-20 days after the operation;

5) After the mice are born for 1 week, the mice can be subjected to paw shearing numbering and PCR-Sanger sequencing identification; after the mice are born for 3 weeks, the mice can be independently fed in separate cages;

2.6 genotyping of birth offspring F0, F1, F2

Collecting 1-2 week old young mouse tissue (toe); lysing the tissue and extracting genomic DNA; PCR amplification and Sanger sequencing are carried out by specific primers aiming at target genes, and offspring of exogenous gene integration are screened out; the integrated mice are called initial mice (founder), can be subjected to passage and line establishment, and meanwhile, the protein expression level needs to be identified;

2.6.1 extraction and purification of the toe gDNA of the knockout mouse

1) Marking: in view of the ease of falling off of the ear tag method, a different toe mark method (2W-3W newborn mice) is adopted, a right toe (big toe-small toe is shown as 1-5) and a left toe (big toe-small toe is shown as 6-10) are usually adopted, and if the number of the farrowing of the same cage is greater than 10, the excess parts cut two toes. Placing the sheared toes of the mice into a 1.5mL EP tube;

2) Adding 200 μL AL and 20 μL proteinase K, shaking for 30s, mixing, centrifuging for 3s instantly, and water-bathing at 56 ℃ for 30min;

3) Adding 200 mu L of absolute ethyl alcohol, reversing, uniformly mixing, vibrating for 30s, and performing instantaneous centrifugation for 3s;

4) Pouring the liquid into a column with a centrifuge tube, 13000 Xg for 1min, and discarding the filtrate and the centrifuge tube;

5) Placing the column into a new centrifuge tube, adding 500 mu LAW1, 13000 Xg, 1min, and discarding the filtrate and the centrifuge tube;

6) Placing the column into a new centrifuge tube, adding 500 mu LAW2, 13000 Xg, 1min, and discarding the filtrate;

7) Discarding the filtrate, centrifuging for 3min, discarding the filtrate and centrifuging tube;

8) The filtrate and centrifuge tube were discarded, the column was placed in a fresh EP tube, 80. Mu.L of AE was added, and the column was left to stand at room temperature for 5min,13000 Xg, 1min,4℃or-70℃for long term storage.

2.6.2 Genotyping by PCR and Sanger sequencing

Offspring mice bred by hybridization were genotyped based on toe genomic DNA by PCR and Sanger sequencing using the primer sequences: c12orf40-F (SEQ ID NO. 3): 5'-TTAGAGCCCTTTAATTGAAGCAGG-3'; the C12orf40-R (SEQ ID NO. 4) 5'-GAATGACATCAACAAGCAGTGGAG-3', PCR amplification system (30. Mu.L) was as follows:

TABLE 1

Green Master Mix，2×	15μL
		RNase-free water	13μL
DNA template	1 μL (about 50 ng)
		Upper and lower primers	Each 0.5. Mu.L (10. Mu. Mol/L)
Total	30μL

The PCR amplification reaction conditions were as follows: after 5min of pre-denaturation at 95 ℃, denaturation at 94 ℃ for 45s, annealing at 59 ℃ for 30s, extension at 72 ℃ for 45s, total 34 cycles, extension at 72 ℃ for 5min, and storage of PCR amplification products at 4 ℃. And (3) carrying out agarose gel electrophoresis on the PCR amplified product, determining that the amplified target band is correct, and then sending the rest PCR amplified product to the department of Praeparata Biotechnology, inc. (Beijing, china) for Sanger sequencing verification.

2.6.3 testis and epididymal tissue fixation, dehydration, embedding and sectioning

1) Fixing the Bouin's fixing solution overnight; respectively using PBS to combine with deionized water, and washing away the fixing solution;

2) Alcohol with gradient: 50% ethanol 1h, 70% ethanol 1h, 80% ethanol 1h, 95% ethanol 1h, 100% ethanol 30min×2 times;

3) Xylene or turpentine is transparent for 30min×2 times;

4) Melting wax: the embedding machine is started in advance, and the wax block is preheated to be transparent liquid;

5) Immersing the transparent tissue into the preheated wax for 3-6 hours;

6) Placing the tissue on a specific position of a mould, dripping wax, solidifying at room temperature, and preserving at 4 ℃;

7) Preparation work before slicing: the paraffin blocks are put in advance for 1h at the temperature of minus 20 ℃ for freezing, a tablet machine is started, a proper amount of deionized water is added, and the water temperature is regulated to 45 ℃;

8) Opening the slicing machine, setting the slicing thickness to be 4 mu m, and carrying out continuous slicing; the slices are placed in water at 45 ℃ and quickly attached to labeled glass slides, and then baked for 30-45 min at 37 ℃.

2.6.4 HE staining of testis and epididymal tissues

1) Baking slices: baking paraffin sections in a 65 ℃ oven for 2 hours;

2) Dewaxing: dewaxing the dimethylbenzene I for 30min, dewaxing the dimethylbenzene II for 15 min, and washing the dimethylbenzene II with gradient alcohol to water: 10min, 100% ethanol 5min, 95% ethanol 5min, 80% ethanol 5min, 75% ethanol 3min, 50% ethanol 3min, and distilled water washing 3min;

3) Hematoxylin is dyed for 8min, and the hematoxylin is slowly washed for 8min by running water;

4) Hydrochloric acid ethanol is differentiated for about 20s (under the condition of lifting and releasing number), and the water is slowly washed for 8min;

5) Dyeing eosin for 4min;

6) And (3) dehydration and transparency: sequentially passing gradient alcohol: 30s for 50% ethanol, 30s for 75% ethanol, 30s for 80% ethanol, 30s for 95% ethanol, 5min for 100% ethanol, 5min for xylene (or turpentine) and 5min for xylene (or turpentine);

7) And (5) sealing the sheet with neutral resin, and observing and photographing under a mirror.

2.7 passage and construction of transgenic mice

1) Mating and passaging the mice with exogenous genes with non-transgenic mice; each first-established mouse needs to be independently passaged;

2) Identifying F1 mice which are born and can transfer F0 by normal germ line, wherein 50% of the offspring have integrated target genes;

3) The obtained F1 positive mice can be used for experiments and continuous passage;

4) If homozygotes are required to be obtained, positive F1 with the same source is possibly subjected to sibling mating, and 25% of the probability of the born F2 generation mice are homozygotes;

5) Mice with expressed target genes are screened, stable passages are established, and the passage condition and the pedigree are recorded.

3. Analysis of results

3.1 successful construction of C12orf40 knockout mice Using Crispr-Cas System

The present application successfully constructs a knock-in comprising a C12orf40 gene (ENSMUST 00000190436: c.221-225 delCTCATG-insTA) mutation in mice (C57 BL/6) using the Crispr-Cas system, as shown in FIG. 1A. DNA is extracted from the toes of the C12orf40 knockout mice, sanger sequencing identification is carried out, and the result proves that the mutation site accords with the expectation, and the B in the figure 1 is a C12orf40 wild male mouse sequencing peak diagram, a C12orf40 heterozygous male mouse sequencing peak diagram and a C12orf40 homozygous male mouse sequencing peak diagram from top to bottom in sequence. Western Blot (Western Blot) detection shows that the C12orf40 protein is expressed and deleted in testis tissue of the knockout mouse, and the frame shift mutation is shown as a functional deletion mutation in the figure 1C. In summary, the application successfully constructs the C12orf40 gene knockout mouse animal model for the first time, and lays a good foundation for further researching the function of the C12orf 40.

3.2 The C12orf40 knockout mice exhibited male sterility

Taking 6 adult C12orf40 knockout male mice and female mice respectively, carrying out cage combination with adult wild female mice or male mice born in the same litter, recording the number of birth and accumulated offspring of each litter of the female mice in the next 6 months, and carrying out statistical detection, wherein the knockout male mice and female mice are found to be completely sterile, as shown in figure 2A. Taking 6 identified adult C12orf40 knockout mice, wild mouse testes and epididymis, photographing and weighing, and carrying out statistical detection, wherein compared with a control, the weight of the C12orf40 knockout male mouse is not abnormal, and the body development of the mice is not affected, but the C12orf40 knockout male mouse testes are obviously reduced, as shown in B-D in fig. 2. Further, testis and epididymis were separately prepared into paraffin sections and HE stained, and as a result, it was found that C12orf40 knockout mice, as shown in E in fig. 2, had seminiferous cells in the seminiferous tubules of testis, but had no haploid round sperm and long sperm, suggesting that meiosis was blocked, and C12orf40 gene knockout mice, as shown in F in fig. 2, had no long sperm in epididymis, and exhibited a non-obstructive azoospermia phenotype.

The technical features of the above embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The foregoing examples illustrate only a few embodiments of the application and are described in detail herein without thereby limiting the scope of the application. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the application, which are all within the scope of the application. Accordingly, the scope of protection of the present application is to be determined by the appended claims.

Claims

1. A nucleic acid composition targeting the C12orf40 gene, wherein the nucleic acid composition comprises a first sgRNA and a second sgRNA, and the nucleotide sequences of the first sgRNA and the second sgRNA are shown as SEQ ID No.1 and SEQ ID No.2, respectively.

2. A kit for inactivating gene function of a targeted C12orf40 gene, comprising the nucleic acid composition of claim 1.

3. A method for preparing a non-obstructive azoospermia animal model, comprising the steps of: editing a C12orf40 gene of a target animal by using a Crispr-Cas system to inactivate the function of the target animal, and preparing a non-obstructive azoospermia animal model;

wherein the Crispr-Cas system comprises the nucleic acid composition of claim 1 and a Cas9 enzyme.

4. The method of claim 3, wherein the subject treated by the Crispr-Cas system is a fertilized egg of the target animal.

5. The method of preparation of claim 4, wherein the Crispr-Cas system is transferred into the fertilized egg in the form of the nucleic acid composition and Cas9 mRNA.

6. The method of claim 4 or 5, wherein the method of transferring the Crispr-Cas system into the fertilized egg is microinjection.

7. The method of claim 6, further comprising transplanting the fertilized egg transferred into the Crispr-Cas system into a pseudopregnant female and producing an F0 generation;

8. The method of claim 7, wherein the target animal is a mouse or a rat.

9. The method of claim 8, wherein the target animal is a mouse, the method further comprising the step of genotyping the mouse: and (3) taking genome DNA extracted from the toe of the mouse as a template, taking SEQ ID NO.3 and SEQ ID NO.4 as primers, and identifying the genotype of the C12orf40 of the mouse by an electrophoresis method after PCR amplification.

10. A method of screening or identifying a medicament for treating non-obstructive azoospermia, wherein the medicament for treating non-obstructive azoospermia is screened or identified using the nucleic acid composition of claim 1, the kit of claim 2or the non-obstructive azoospermia animal model produced by the method of producing a non-obstructive azoospermia animal model of any one of claims 3 to 9.