CN109022485A - A kind of construction method, kit and the application of optic atrophy animal model - Google Patents
A kind of construction method, kit and the application of optic atrophy animal model Download PDFInfo
- Publication number
- CN109022485A CN109022485A CN201810938043.2A CN201810938043A CN109022485A CN 109022485 A CN109022485 A CN 109022485A CN 201810938043 A CN201810938043 A CN 201810938043A CN 109022485 A CN109022485 A CN 109022485A
- Authority
- CN
- China
- Prior art keywords
- optic atrophy
- animal
- animal model
- construction method
- opa3
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/027—New breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/10—Vectors comprising a non-peptidic targeting moiety
Abstract
The invention discloses construction method, kit and the applications of a kind of optic atrophy animal model.It is related to field of biotechnology.The construction method makes the 93rd generation missense mutation of the OPA3 albumen of coding by making the base in the 277th site of 2 exon of animal OPA3 gene sport A by G, sports S by amino acid residue G；It obtains the animal containing the mutation and shows typical optic atrophy genius morbi, can be used as optic atrophy animal model；The animal model has filled up the shortcoming at present without source of people autosomal dominant optic atrophy animal model, enriches the classification of existing optic atrophy animal model, may advantageously facilitate the research and development of ophthalmology disease.
Description
Technical field
The present invention relates to field of biotechnology, in particular to a kind of optic atrophy animal model construction method,
Kit and application.
Background technique
Mankind's OPA3 gene is located at 19q13.32, and the OPA3 albumen of coding is one of Mitofusin.The gene
There are multiple mutational sites, such as IVS1-1G-C, 18-BP DEL and 313C-G (Q105E).First two mutation leads to clinical disease
For two Aciduria of type III 3- methylpentene, tetanic, incoordination, the disease of the central nervous system diseases such as cognitive disorder are shown as
Shape is autosomal recessive hereditary diseases；The third mutation leads to optic atrophy companion or not with cataract and slight nervous system
Symptom is autosomal dominant inherited disease.
Although have now been found that because mutation causes the Disease-causing gene of hereditary optic atrophy to have tens of kinds, it is existing
OPA1 (Q285STOP) mouse and OPA3 (L122P) mouse that animal model is also only obtained by ENU mutagenesis.Although in phenotype
The symptom of hereditary optic atrophy can be simulated, but is recessive hereditary disease mostly, lacks the optic atrophy of dominant inheritance
Animal model.
In consideration of it, the present invention is specifically proposed.
Summary of the invention
The purpose of the present invention is to provide a kind of construction methods of optic atrophy animal model, can by the construction method
To obtain the optic atrophy animal model of autosomal dominant inheritance, and typical optic atrophy feature is shown, to grind
Study carefully ophthalmology disease such as optic atrophy and provide another selection, has filled up and withered at present without source of people autosomal dominant optic nerve
The shortcoming of contracting animal model enriches the classification of existing optic atrophy animal model.
Another object of the present invention is to provide a kind of for constructing the kit of optic atrophy animal model, using this
Kit can be convenient, simply and rapidly construct the optic atrophy animal model of autosomal dominant inheritance.
A further object of the present invention is to provide obtain optic atrophy animal model in ophthalmology disease by above-mentioned construction method
Application in disease research.
The present invention is implemented as follows:
On the one hand, the present invention provides a kind of construction methods of optic atrophy animal model comprising: it will be used to make
The composition that the 277th site G of 2 exon of object OPA3 gene sports A is injected into fertilised non-human eggs, survives after taking injection
In zygote transplation to pseudopregnant females body, the animal of output is as F0 for animal.
It is (prominent that studies have shown that of the invention makes the base in the 277th site of 2 exon of animal OPA3 gene by G sport A
Become c.277G > A), the 93rd generation missense mutation of the OPA3 albumen for causing it to encode sports S by amino acid residue G
(G93S), so that the animal shows the optic atrophy feature of autosomal dominant inheritance, and homozygous optic nerve
Performance of the shrinkage characteristics compared with heterozygous becomes apparent from.
By means of the invention it is also possible to optic atrophy animal model is constructed, 2 exon of OPA3 gene
The base in 277 sites sports A by G, and the 93rd of the OPA3 albumen of coding sports S by amino acid residue G, the optic nerve
Atrophy animal model is autosomal dominant inheritance, shows typical optic atrophy feature.This is research ophthalmology disease
Such as optic atrophy provides another selection, has filled up at present without source of people autosomal dominant optic atrophy animal model
Shortcoming, enrich the classification of existing optic atrophy animal model.
Further, in some embodiments of the present invention, above-mentioned construction method further include: by identified correct body
The 277th site G of 2 exon of cell OPA3 gene sport the F0 of A for animal with wild type opposite sex animal mating to obtain
F1 generation both heterozygote.
Further, in some embodiments of the present invention, above-mentioned construction method further include:
The 277th site G of 2 exon of identified correct body cell OPA3 gene is sported to the F1 generation heterozygote of A
Animal selfing, obtains F2 for animal, as optic atrophy animal model.
Further, in some embodiments of the present invention, above-mentioned animal is non-human mammal.
Further, in some embodiments of the present invention, above-mentioned non-human mammal be mouse, rat, dog, monkey or
Ape.
It should be noted that specific animal category, those skilled in the art are in reality on the basis of disclosed by the invention
Building process in select according to demand, which kind of animal no matter selected, as long as keeping 2 extras of the OPA3 gene of target animal aobvious
The 277th site G of son sports A and obtains the animal model with optic atrophy feature, belongs to protection scope of the present invention.
Further, in some embodiments of the present invention, above-mentioned composition contains following ingredient: Cas9mRNA,
SgRNA and ssODN (i.e. single-stranded nucleotide homologous templates).
Further, in some embodiments of the present invention, above-mentioned animal is mouse, the base sequence of above-mentioned sgRNA
As shown in SEQ ID NO.1, the base sequence of above-mentioned ssODN is as shown in SEQ ID NO.2, the base sequence of above-mentioned Cas9mRNA
As shown in SEQ ID NO.3.
Some embodiments of the present invention are based on crispr/cas9 technical principle, are designed by the creative work of inventor
Suitable sgRNA and ssODN out overcomes the obstacle during gene mutation.Will containing sgRNA shown in SEQ ID NO.1,
Cas9mRNA composition described in ssODN and SEQ ID NO.3 shown in SEQ ID NO.2 is injected into mouse fertilized egg, then leads to
Homologous recombination is crossed, the 277th site G of 2 exon of OPA3 gene sports A in the fertilized egg cell that mouse can be made to divide, thus
The OPA3 gene of the individual mice developed into has mutation c.277G > A, and the optic nerve for showing autosomal dominant inheritance withers
Contracting feature.
It should be noted that the embodiment of the present invention is based on crispr/cas9 technical principle, gene editing is carried out, depending on
Neuratorphy animal model.In other examples, the Zinc finger nuclease technology (zinc- mediated using artificial nuclease
Finger nucleases, ZFN), activating transcription factor sample effector nucleic acid zymotechnic (transceription
Activator-like effector nucleases, TALEN) etc. other gene editing technologies edited, make OPA3 gene
The 277th site of 2 exon has mutation c.277G > A, obtains optic atrophy animal model, this also belongs to guarantor of the invention
Protect range.
To sum up, the construction method of optic atrophy animal model provided by the invention, by making 2 extra of animal OPA3 gene
The base in the 277th site of aobvious son sports A by G, and then makes the 93rd generation missense mutation of the OPA3 albumen of coding, by amino
Sour residue G sports S, so that the animal containing the mutation shows the optic atrophy feature of autosomal dominant inheritance, i.e.,
It can be used as the optic atrophy animal model of autosomal dominant inheritance, closed for such as optic atrophy selection of research ophthalmology disease
Suitable animal model provides more choices, and has also filled up at present without source of people autosomal dominant optic atrophy animal model
Shortcoming, enrich the classification of existing optic atrophy animal model, may advantageously facilitate ophthalmology disease especially optic atrophy
The research and development of disease etc..
In addition, the construction method modeling time of optic atrophy animal model provided by the invention is short, it is special not need
Reagent, operation and physical method, at low cost, method is simple and easy, and resulting optic atrophy animal model is autosome something lost
It passes, can show naturally the symptom of optic atrophy in cub short time for being born (in 1-2 months) with pangamy.
On the other hand, the present invention provides a kind of for constructing the kit of optic atrophy animal model comprising uses
In the composition for making the 277th site G of 2 exon of animal OPA3 gene sport A.
Further, in some embodiments of the present invention, above-mentioned composition contains following ingredient: Cas9mRNA,
SgRNA and ssODN.
Preferably, the base sequence of above-mentioned sgRNA is as shown in SEQ ID NO.1, the base sequence of above-mentioned ssODN such as SEQ
Shown in ID NO.2, the base sequence of above-mentioned Cas9mRNA is as shown in SEQ ID NO.3.
Some embodiments of the present invention are based on crispr/cas9 technical principle, are designed by the creative work of inventor
Suitable sgRNA and ssODN out overcomes the obstacle during gene mutation, will containing sgRNA shown in SEQ ID NO.1,
Cas9mRNA composition described in ssODN and SEQ ID NO.3 shown in SEQ ID NO.2 is injected into mouse fertilized egg, then leads to
Homologous recombination is crossed, the 277th site G of 2 exon of OPA3 gene sports A in the fertilized egg cell that mouse can be made to divide, thus
The OPA3 gene of the individual mice developed into has mutation c.277G > A, shows the optic atrophy of autosomal dominant inheritance
Feature.
In other examples, the Zinc finger nuclease technology (zinc-finger mediated based on artificial nuclease
Nucleases, ZFN) design composition or be based on activating transcription factor sample effector nucleic acid zymotechnic (transceription
Activator-like effector nucleases, TALEN) etc. other gene editing Technology designs composition, make OPA3
The 277th site of 2 exon of gene has mutation c.277G > A, obtains optic atrophy animal model, these compositions also belong to
In protection scope of the present invention.
There are also on the one hand, the present invention also provides by the obtained neuratorphy animal model of above-mentioned construction method in ophthalmology
Application in disease research.
Further, the studies above is for the purpose of the treatment of non-disease.
It is special that the neuratorphy animal model obtained by construction method of the invention shows typical optic atrophy disease
Sign, the symptom of optic atrophy can be shown naturally in a short time by being selfed the cub given birth to, therefore it is with boundless
Application prospect, such as the research field for arriving optic atrophy, then for example for understanding optic atrophy disease in depth
Pathogenesis, filters out the fields such as the active drug for treating optic atrophy at curative effect mechanism.
Detailed description of the invention
In order to illustrate the technical solution of the embodiments of the present invention more clearly, below will be to needed in the embodiment attached
Figure is briefly described, it should be understood that the following drawings illustrates only certain embodiments of the present invention, therefore is not construed as pair
The restriction of range for those of ordinary skill in the art without creative efforts, can also be according to this
A little attached drawings obtain other relevant attached drawings.
Figure 1A is sgRNA and the pass corresponding with the 77th site of 2 exon of mouse OPA3 gene ssODN in embodiment
It is schematic diagram；In figure: blue font (cca) is the position PAM.
Figure 1B is the part F2 in embodiment for the sequencing result in the 277th site of 2 exon of OPA3 gene of mouse；Figure
In: arrow meaning is the sequencing result in the 277th site；WT represents wild-type mice.
Fig. 2 is the visual evoked potential testing result in experimental example, in figure: * represents the n=6 compared with wild type.
Fig. 3 is the knot of the pattern of retinal ganglion cells cell space arrangement that observation Mouse Retina slice is dyed using HE in experimental example
Fruit.
Fig. 4 is the ganglionic layer of retina and nerve fibre that observation Mouse Retina slice is dyed using HE in experimental example
The result of thickness degree；In figure: position shown in * represents ganglionic layer of retina and nerve fibre layer.
Fig. 5 is micro- using the RGCs and nerve fibre layer of immunofluorescence dyeing observation Mouse Retina slice in experimental example
The result of tubulin.
Fig. 6 is the intracellular mitochondrial distribution that Mouse Retina slice is observed using immunofluorescence dyeing in experimental example
As a result.
Fig. 7 is the result of the optic nerve density that observation optic nerve transection face slice is dyed using HE in experimental example.
Fig. 8 is the optic nerve axons density using transmission electron microscope observation mouse optic nerve section in experimental example
As a result.
Specific embodiment
It in order to make the object, technical scheme and advantages of the embodiment of the invention clearer, below will be in the embodiment of the present invention
Technical solution be clearly and completely described.The person that is not specified actual conditions in embodiment, according to normal conditions or manufacturer builds
The condition of view carries out.Reagents or instruments used without specified manufacturer is the conventional production that can be obtained by commercially available purchase
Product.
Feature and performance of the invention are described in further detail with reference to embodiments.
Embodiment
The present embodiment is illustrated the construction method of the optic atrophy mouse model of the present embodiment by taking mouse as an example.
Concrete operations are as follows:
(1) CRISPR design tool (Photographing On-line tool http://tools.genome- is utilized
Engineering.org), selection CRISPR/Cas system knocks out target spot, i.e., using the 18bpDNA that NGG is ending as target sequence:
CATCTTCATTGTGGGCGG(5'-3')；It is PAM motif location at underscore.
(2) it is directed to above-mentioned target spot, what is synthesized in vitro has T7 promoter sequence and 60bp target sequence (i.e. sgRNA precursor
Sequence) oligonucleotide chain, the sequence of sgRNA precursor sequence is as follows:
GATCACTAATACGACTCACTATAGGCATCTTCATTGTGGGCGGGTTTTAGAGCTAGAAAT；Underscore is
Target sequence.
(a) as template, PCR reaction is carried out with high-fidelity KOD enzyme, obtains the DNA profiling of transcribed sgRNA.
PCR reaction system:
PCR response procedures:
| Circulation | Denaturation | Annealing | Extend |
| 1 | 95 DEG C, 2min | ||
| 2-25 | 95 DEG C, 30s | 50 DEG C, 30s | 68 DEG C, 20s |
| 26 | 68 DEG C, 7min |
Wherein, upstream primer sequence (T7-Fwd prime):
CCTGAGTGAAGCAAGGGACA；
Downstream primer sequence (Scaffold-Rev prime):
CCAATAGAGCCTTCTCCTCACA。
(b) DNA profiling that above-mentioned PCR product transcribes sgRNA is extracted with phenol-chloroform extraction method, with T7 transcript reagent box
Responsive transcription is carried out, then extracts the sgRNA that transcription obtains with phenol-chloroform method, dissolves RNA with RNA-free water.
Obtained sgRNA sequence (SEQ ID NO.1) is as follows:
GAUCACUAAUACGACUCACUAUAGGCAUCUUCAUUGUGGGCGGGUUUUAGAGCUAGAAAU。
(c) equally, with SP6 transcript reagent box using the cDNA of Cas9 albumen as template, transcription obtains the mRNA of Cas9 albumen,
Then the Cas9mRNA that transcription obtains is extracted with phenol-chloroform extraction process.
The sequence of Cas9mRNA sequence is as shown in SEQ ID NO.3.
SgRNA (SEQ ID NO.1) and Cas9mRNA (SEQ ID NO.3) that extracting obtains are placed in -80 DEG C of preservations, it is standby
With.
(d) ssODN is synthesized in vitro, and sequence is following (SEQ ID NO.2):
TCAAGCCACTGAATGAGGAGGCAGCAGCAGAGCTGGGTGCTGAGCTGCTGGGCGAGGCCACCATCTTCATTGTGGGC
GGAAGCTGCCTGGTCCTGGAGTACTGGCGCCACCAGACTCAGC。
The corresponding relationship in the 77th site of 2 exon of sgRNA and ssODN and mouse OPA3 gene is shown in Figure 1A.
(3) C57/BL6 female mice is injected intraperitoneally with horse human chorionic gonadtropin (PMSG), is injected intraperitoneally after 46 hours
Human chorionic gonadotrophin (hCG), mates with male mice and mates, and next day puts to death female rat, and fertilized eggs is taken to carry out microinjection；
The Cas9mRNA (SEQ ID NO.3) that above-mentioned steps are obtained, sgRNA (SEQ ID NO.1) and ssODN (SEQ ID NO.2)
It is injected into fertilized eggs, takes in the zygote transplation to false pregnancy rat body survived after injection, the mouse of output, as F0 is for small
Mouse.
(4) its toe is cut, DNA is extracted for mouse 1 week big left and right to F0, designed target spot upstream and downstream primer and carry out PCR expansion
Increase, and send product to sequencing, identifies whether be chimera；
(5) identify that correctly (the 277th site G of 2 exon of body cell OPA3 gene is sported to male Founder
A F0) can mate respectively with wild type opposite sex mouse for mouse to 7 week old, female mice to 4 week old and obtain F1 generation heterozygote
Mouse cuts mouse toe, extracts DNA, PCR amplification simultaneously send product to sequencing, if there is positive mice birth, then it represents that mutation
C.277G > A has been integrated into reproduction cell.
(6) F1 generation hybrid mice is hybridized and obtains OPA3 gene with mutation c.277G > A F2 for heterozygote and homozygosis
Sub- mouse.
(7) to the mouse model of optic atrophy is obtained, its toe is cut, DNA is extracted and is sequenced, sequencing result figure
Shown in 1B, F2 in mouse include heterozygote OPA3G93S/+With homozygote OPA3G93S/G93S, two types can be used as optic nerve
The mouse model of atrophy.
Experimental example
The phenotypic evaluation of the mouse model of optic atrophy
(1) visual evoked potential (VEP) is measured
The mouse being derived under right light adaptation state connects reference electrode, tail portion respectively at cheek linkage record electrode, cranium
Grounding electrode is connected, measures visual evoked potential using visual electrophysiology recorder (VEP), detection waveform (N1 wave and P1 wave) is
No exception.
As a result as shown in Fig. 2, heterozygote OPA3G93S/+With homozygote OPA3G93S/G93STwo kinds of animal models show to regard
Feel that Evoked ptential (VEP) is abnormal, N1 wave and P1 wave amplitude difference decline.
(2) in vitro tissue detects: blunt separation eyeball and optic nerve after mouse is put to death, scissors go deep into socket of the eye deep, cut
Optic nerve takes out eyeball together with optic nerve.
(a) retinal slice: after eyeball of mouse is fixed 2-3 hours with eyeball fixer, cornea is cut off, is removed crystalline
Body, softly clears away vitreum, and paraffin embedding after alcohol serial dehydration is sliced (thickness 4-5um) film-making, utilizes hematoxylin-eosin
Row HE is dyed, and is taken pictures under micro- white light, and observing retinal thickness and each confluent monolayer cells density and arrangement, (primary part observation retinal ganglion is thin
Born of the same parents' layer and nerve fibre layer)；As a result see Fig. 3 and Fig. 4.
It can be seen that compared with wild-type mice from the result of Fig. 3, there is OPA3G93SThe retinal ganglion of the mouse of mutation
Cell body is disorganized, heterozygote OPA3G93S/+Also there are corresponding phenotype, homozygote OPA3G93S/G93SPerformance becomes apparent.
It can be seen that compared with wild type from the result of Fig. 4, OPA3G93SMutant mice ganglionic layer of retina and nerve
Fibrous layer is thinning, heterozygote OPA3G93S/+Also there are corresponding phenotype, homozygote OPA3G93S/G93SWhat is showed is more prominent.
(b) immunofluorescence dyeing: primary antibody is using tubulin β 3-tubulin antibody to tubulin in ganglion cell's aixs cylinder
After (β 3-tubulin) is marked plus secondary antibody, DAPI contaminate mounting after nucleus, image are acquired under fluorescence microscope, observe fluorescence
Intensity, to judge the thickness of ganglion-cell layer and nerve fibre layer.As a result see Fig. 5.
It can be seen that compared with wild type from the result of Fig. 5, OPA3G93SThe RGCs and nerve fibre layer of mutant mice are micro-
Tubulin content is reduced.
(c) it pattern of retinal ganglion cells mitochondria coherent detection: uses mitochondria mark antigen TOMM20 as primary antibody, adds secondary antibody
DAPI contaminates mounting after nucleus afterwards, and image is acquired under fluorescence microscope, observes fluorescence intensity, to judge that intracellular mitochondrial is distributed
Situation.As a result see Fig. 6.
It can be seen that compared with wild type from the result of Fig. 6, OPA3G93SMutant mice RGCs mitochondria fluorescence intensity is not
, homozygote OPA3G93S/G93SWhat is showed is more prominent, prompts its intracellular mitochondrial abnormal distribution.
(d) optic nerve transection face is sliced: production optic nerve cross-sectional slices, step is the same, utilizes hematoxylin-eosin row HE
It dyes, takes pictures under micro- white light, observe aixs cylinder and myelin, and then analyze the degree of impairment of ganglion cell's aixs cylinder；As a result see Fig. 7.
It can be seen that compared with wild type from the result of Fig. 7, OPA3G93SMutant mice optic nerve density unevenness, cross section
Cell density is reduced, and " vacuole " phenomenon, homozygote OPA3 occursG93S/G93SPhenotype be very.
(e) transmission electron microscope: after taking optic nerve, it is trimmed to about 1mm3Tissue block, 2.5% glutaraldehyde fixes, second
Alcohol serial dehydration, oven for curing after embedding liquid embedding, ultramicrotome slice, thickness about 50nm, 3% acetic acid uranium-citric acid
The double dyeing of lead, transmission electron microscope observing, film making.As a result see Fig. 8.
It can be seen that compared with wild type from the result of Fig. 8, OPA3G93SMutant mice optic nerve axons density unevenness, greatly
It is small etc., homozygote OPA3G93S/G93SPhenotype be very.
The foregoing is only a preferred embodiment of the present invention, is not intended to restrict the invention, for the skill of this field
For art personnel, the invention may be variously modified and varied.All within the spirits and principles of the present invention, made any to repair
Change, equivalent replacement, improvement etc., should all be included in the protection scope of the present invention.
SEQUENCE LISTING
<110>Shanghai Bang Yao Biotechnology Co., Ltd
<120>a kind of construction method, kit and the application of optic atrophy animal model
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 60
<212> RNA
<213>artificial sequence
<400> 1
gaucacuaau acgacucacu auaggcaucu ucauuguggg cggguuuuag agcuagaaau 60
<210> 2
<211> 120
<212> DNA
<213>artificial sequence
<400> 2
tcaagccact gaatgaggag gcagcagcag agctgggtgc tgagctgctg ggcgaggcca 60
ccatcttcat tgtgggcgga agctgcctgg tcctggagta ctggcgccac cagactcagc 120
<210> 3
<211> 4101
<212> RNA
<213>artificial sequence
<400> 3
cuguucuuca ugucguagcc ggaccuguag ccgugguuga gacacccgac ccggcacuag 60
uggcugcuca uguuccacgg gucguucuuu aaguuccacg acccguugug gcuggccgug 120
ucguaguucu ucuuggacua gccucgggac gacaagcugu cgccgcuuug ucggcuccgg 180
ugggccgacu ucucuuggcg gucuucuucu auguggucug ccuucuuggc cuagacgaua 240
gacguucucu agaagucguu gcucuaccgg uuccaccugc ugucgaagaa ggugucugac 300
cuucucagga aggaccaccu ucuccuauuc uucgugcucg ccguggggua gaagccguug 360
uagcaccugc uccaccggau ggugcucuuc augggguggu agauggugga cucuuucuuu 420
gaccaccugu cguggcuguu ccggcuggac gccgacuaga uagaccggga ccggguguac 480
uaguucaagg ccccggugaa ggacuagcuc ccgcuggacu uggggcuguu gucgcugcac 540
cuguucgaca aguaggucga ccacgucugg auguuggucg acaagcuccu uuugggguag 600
uugcggucgc cgcaccugcg guuccgguag gacagacggu cugacucguu cucgucugcc 660
gaccuuuuag acuagcgggu cgacgggccg cucuucuucu uaccggacaa gccuuuggac 720
uaacgggacu cggacccgga cuggggguug aaguucucgu ugaagcugga ccggcuccua 780
cgguuugacg ucgacucguu ccuguggaug cugcugcugg accuguugga cgaccggguc 840
uagccgcugg ucaugcggcu ggacaaagac cggcgguucu uggacaggcu gcgguaggac 900
gacucgcugu aggacucuca cuuguggcuc uagugguucc ggggggacuc gcggagauac 960
uaguucucua ugcugcucgu ggugguccug gacugggacg acuuucgaga gcacgccguc 1020
gucgacggac ucuucauguu ucucuaaaag aagcuggucu cguucuugcc gaugcggccg 1080
auguaacugc cgccucgguc gguccuucuc aagauguuca aguaguucgg guaggaccuu 1140
uucuaccugc cguggcuccu ugacgagcac uucgacuugu cucuccugga cgacgccuuc 1200
gucgccugga agcuguugcc gucguagggg guggucuagg uggacccucu cgacgugcgg 1260
uaagacgccg ccguccuucu aaaaaugggu aaggacuucc uguuggcccu uuucuagcuc 1320
uucuaggacu ggaaggcgua ggggaugaug cacccgggag accggucccc uuugucgucu 1380
aagcggaccu acuggucuuu cucgcuccuu ugguaguggg ggaccuugaa gcuccuucac 1440
caccuguucc cgcgaaggcg ggucucgaag uagcucgccu acugguugaa gcuauucuug 1500
gacggguugc ucuuccacga cggguucgug ucggacgaca ugcucaugaa guggcacaua 1560
uugcucgacu gguuucacuu uaugcacugg cucccuuacu cuuucgggcg gaaggacucg 1620
ccgcucgucu uuuuccggua gcaccuggac gacaaguucu gguuggccuu ucacuggcac 1680
uucgucgacu uucuccugau gaaguucuuu uagcucacga agcugaggca ccuuuagagg 1740
ccgcaccuuc uagccaaguu gcggagggac ccguguaugg ugcuagacga cuuuuaauag 1800
uuccuguucc ugaaggaccu guuacuccuu uugcuccugu aagaccuucu auagcacgac 1860
ugggacugug acaaacuccu gucucucuac uagcuccuug ccgacuuuug gauacgggug 1920
gacaagcugc uguuucacua cuucgucgac uucgccgccu cuauguggcc gaccccgucc 1980
gacucggccu ucgacuaguu gccguaggcc cuguucguca ggccguucug uuaggaccua 2040
aaggacuuca ggcugccgaa gcgguugucu uugaaguacg ucgacuaggu gcugcugucg 2100
gacuggaaau uucuccugua ggucuuucgg guccacaggc cggucccgcu aucggacgug 2160
cucguguaac gguuagaccg gccgucgggg cgguaauucu ucccguagga cgucugucac 2220
uuccaccacc ugcucgagca cuuucacuac ccggccgugu ucgggcucuu guagcacuag 2280
cuuuaccggu cucucuuggu cugguggguc uucccugucu ucuugucggc gcucucuuac 2340
uucgccuagc uucucccgua guuucucgac ccgucggucu aggacuuucu uguggggcac 2400
cuuuuguggg ucgacgucuu gcucuucgac auggacauga uggacgucuu acccgcccua 2460
uacaugcacc ugguccuuga ccuguaguug gccgacaggc ugaugcuaca ccugguauag 2520
cacggagucu cgaaagacuu ccugcugagg uagcuguugu uccacgacug gucuucgcug 2580
uucuuggccc cguucucgcu guugcacggg aggcuucucc agcacuucuu cuacuucuug 2640
augaccgccg ucgacgacuu gcgguucgac uaaugggucu cuuucaagcu guuagacugg 2700
uuccggcucu cuccgccgga cucgcuugac cuauuccggc cgaaguaguu cucugucgac 2760
caccuuuggg ccgucuagug uuucgugcac cgugucuagg accugagggc cuacuuguga 2820
uucaugcugc ucuuacuguu cgacuaggcc cuucacuuuc acuaguggga cuucagguuc 2880
gaccacaggc uaaaggccuu ccuaaagguc aaaauguuuc acgcgcucua guuguugaug 2940
guggugcggg ugcugcggau ggacuugcgg cagcacccuu ggcgggacua guuuuucaug 3000
ggauucgacc uuucgcucaa gcacaugccg cugauguucc acaugcugca cgccuucuac 3060
uagcgguucu cgcucguccu uuagccguuc cgauggcggu ucaugaagaa gaugucguug 3120
uaguacuuga aaaaguucug gcucuaaugg gaccgguugc cgcucuaggc cuucgccgga 3180
gacuagcucu guuugccgcu uuggccccuc uagcacaccc uauucccggc ccuaaaacgg 3240
uggcacgccu uucacgacuc guacgggguu cacuuauagc acuuuuucug gcuccacguc 3300
uguccgccga agucguuucu cagauaggac ggguucuccu ugucgcuauu cgacuagcgg 3360
ucuuucuucc ugacccuggg auucuucaug ccgccgaagc ugucggggug gcaccggaua 3420
agacacgacc accaccgguu ucaccuuuuc ccguucaggu ucuuugacuu cucacacuuu 3480
cucgacgacc ccuaguggua guaccuuucu ucgucgaagc ucuucuuagg guagcugaaa 3540
gaccuucggu ucccgauguu ucuucacuuu uuccuggacu aguaguucga cggauucaug 3600
agggacaagc ucgaccuuuu gccggccuuc ucuuacgacc ggagacggcc gcuugacguc 3660
uucccuuugc uugaccggga cgggagguuu auacacuuga aggacaugga ccggucggug 3720
auacucuucg acuucccgag ggggcuccua uuacucgucu uugucgacaa acaccuuguc 3780
guguucguga uggaccugcu cuaguagcuc gucuagucgc ucaagagguu cucucacuag 3840
gaccggcugc gauuagaccu guuucacgac aggcggaugu uguucguggc ccuauucggg 3900
uagucucucg uccggcucuu auaguaggug gacaaauggg acugguuaga cccucgggga 3960
cggcggaagu ucaugaaacu guggugguag cuggccuucu ccaugugguc gugguuucuc 4020
cacgaccugc ggugggacua gguggucucg uaguggccgg acaugcucug ugccuagcug 4080
gacagagucg acccuccgcu g 4101
Claims (10)
1. a kind of construction method of optic atrophy animal model, characterized in that it comprises: will be used to make animal OPA3 gene
The composition that the 277th site G of 2 exon sports A is injected into fertilised non-human eggs, takes the zygote transplation survived after injection
Into pseudopregnant females body, the animal of output is as F0 for animal.
2. the construction method of optic atrophy animal model according to claim 1, which is characterized in that the construction method
Further include: the 277th site G of 2 exon of identified correct body cell OPA3 gene is sported into the F0 of A for animal and open country
Raw type opposite sex animal mating is to obtain F1 generation both heterozygote.
3. the construction method of optic atrophy animal model according to claim 2, which is characterized in that the construction method
Further include:
The 277th site G of 2 exon of identified correct body cell OPA3 gene is sported to the F1 generation both heterozygote of A
Selfing, obtains F2 for animal, as optic atrophy animal model.
4. the construction method of optic atrophy animal model according to claim 3, which is characterized in that the animal is non-
People mammal.
5. the construction method of optic atrophy animal model according to claim 4, which is characterized in that the inhuman lactation
Animal is mouse, rat, dog, monkey or ape.
6. the construction method of optic atrophy animal model according to claim 5, which is characterized in that the composition contains
There is following ingredient:
Cas9mRNA, sgRNA and ssODN.
7. the construction method of optic atrophy animal model according to claim 6, which is characterized in that the animal is small
Mouse, the base sequence of the sgRNA as shown in SEQ ID NO.1, the base sequence of the ssODN as shown in SEQ ID NO.2,
The base sequence of the Cas9mRNA is as shown in SEQ ID NO.3.
8. a kind of for constructing the kit of optic atrophy animal model, which is characterized in that it includes for making animal OPA3
The 277th site G of 2 exon of gene sports the composition of A.
9. kit according to claim 8, which is characterized in that the composition contains following ingredient: Cas9mRNA,
SgRNA and ssODN；
Preferably, the base sequence of the sgRNA is as shown in SEQ ID NO.1, the base sequence of the ssODN such as SEQ ID
Shown in NO.2, the base sequence of the Cas9mRNA is as shown in SEQ ID NO.3.
10. being ground by the obtained neuratorphy animal model of the described in any item construction methods of claim 1-7 in ophthalmology disease
Application in studying carefully.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810938043.2A CN109022485B (en) | 2018-08-16 | 2018-08-16 | Construction method, kit and application of optic atrophy animal model |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810938043.2A CN109022485B (en) | 2018-08-16 | 2018-08-16 | Construction method, kit and application of optic atrophy animal model |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109022485A true CN109022485A (en) | 2018-12-18 |
| CN109022485B CN109022485B (en) | 2021-02-02 |
Family
ID=64630713
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810938043.2A Active CN109022485B (en) | 2018-08-16 | 2018-08-16 | Construction method, kit and application of optic atrophy animal model |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109022485B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110250109A (en) * | 2019-07-01 | 2019-09-20 | 上海交通大学医学院附属新华医院 | Construction method, composition and the kit of glyoxalic acid metabolic disorder related disease model and application |
| CN111979273A (en) * | 2020-08-24 | 2020-11-24 | 苏州启辰生物科技有限公司 | Method for preparing humanized ACE2 mouse model |
| CN113068660A (en) * | 2021-03-29 | 2021-07-06 | 华东师范大学 | Construction method of spontaneous rheumatoid arthritis mouse model |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102978284A (en) * | 2012-11-19 | 2013-03-20 | 金子兵 | Gene chip for screening various ophthalmological hereditary diseases as well as preparation and usage method of gene chip |
| CN104263754A (en) * | 2014-08-29 | 2015-01-07 | 中国科学院广州生物医药与健康研究院 | Reconstructed ovum of albinism model pig and construction method thereof, and construction method of model pig |
| CN104293831A (en) * | 2014-09-28 | 2015-01-21 | 上海云舜生物技术有限公司 | Method for establishing hypertension mouse model and application of hypertension mouse model |
| CN104726494A (en) * | 2015-02-12 | 2015-06-24 | 中国人民解放军第二军医大学 | Method for constructing chromosome translocation stem cell and animal model by CRISPR-Cas9 technology |
| CN104745626A (en) * | 2014-12-19 | 2015-07-01 | 中国航天员科研训练中心 | Rapid construction method and applications of conditional gene knockout animal model |
| CN107287245A (en) * | 2017-05-27 | 2017-10-24 | 南京农业大学 | A kind of construction method of the Glrx1 Gene Knock-Out Animal Model models based on CRISPR/Cas9 technologies |
-
2018
- 2018-08-16 CN CN201810938043.2A patent/CN109022485B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102978284A (en) * | 2012-11-19 | 2013-03-20 | 金子兵 | Gene chip for screening various ophthalmological hereditary diseases as well as preparation and usage method of gene chip |
| CN104263754A (en) * | 2014-08-29 | 2015-01-07 | 中国科学院广州生物医药与健康研究院 | Reconstructed ovum of albinism model pig and construction method thereof, and construction method of model pig |
| CN104293831A (en) * | 2014-09-28 | 2015-01-21 | 上海云舜生物技术有限公司 | Method for establishing hypertension mouse model and application of hypertension mouse model |
| CN104745626A (en) * | 2014-12-19 | 2015-07-01 | 中国航天员科研训练中心 | Rapid construction method and applications of conditional gene knockout animal model |
| CN104726494A (en) * | 2015-02-12 | 2015-06-24 | 中国人民解放军第二军医大学 | Method for constructing chromosome translocation stem cell and animal model by CRISPR-Cas9 technology |
| CN107287245A (en) * | 2017-05-27 | 2017-10-24 | 南京农业大学 | A kind of construction method of the Glrx1 Gene Knock-Out Animal Model models based on CRISPR/Cas9 technologies |
Non-Patent Citations (1)
| Title |
|---|
| C VERNY ET AL: ""An OPA3 Gene Mutation Is Responsible for the Disease Associating Optic Atrophy and Cataract With Extrapyramidal Signs"", 《CASE REPORTS REV NEUROL 》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110250109A (en) * | 2019-07-01 | 2019-09-20 | 上海交通大学医学院附属新华医院 | Construction method, composition and the kit of glyoxalic acid metabolic disorder related disease model and application |
| CN111979273A (en) * | 2020-08-24 | 2020-11-24 | 苏州启辰生物科技有限公司 | Method for preparing humanized ACE2 mouse model |
| CN111979273B (en) * | 2020-08-24 | 2022-05-27 | 苏州启辰生物科技有限公司 | Method for preparing humanized ACE2 mouse model |
| CN113068660A (en) * | 2021-03-29 | 2021-07-06 | 华东师范大学 | Construction method of spontaneous rheumatoid arthritis mouse model |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109022485B (en) | 2021-02-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106929533B (en) | Construction method and application of KARS gene point mutation mouse model | |
| WO2018177351A1 (en) | Method for preparing non-chimeric gene knockout animal based on crispr/cas9 technology | |
| Walker | Haploid screens and gamma-ray mutagenesis | |
| Patterson | Evolution | |
| de Angelis et al. | Large scale ENU screens in the mouse: genetics meets genomics | |
| Hirsch et al. | Xenopus, the next generation: X. tropicalis genetics and genomics | |
| Hu et al. | High-efficiency CRISPR/Cas9-mediated gene editing in honeybee (Apis mellifera) embryos | |
| Holtzman et al. | Learning to fish with genetics: a primer on the vertebrate model Danio rerio | |
| Liu et al. | Production of gynogenetic progeny from allotetraploid hybrids red crucian carp× common carp | |
| Knapik | ENU mutagenesis in zebrafish—from genes to complex diseases | |
| Goda et al. | Genetic screens for mutations affecting development of Xenopus tropicalis | |
| CN109022485A (en) | A kind of construction method, kit and the application of optic atrophy animal model | |
| Salzberg et al. | Meig1 deficiency causes a severe defect in mouse spermatogenesis | |
| Fjelldal et al. | Development of supermale and all-male Atlantic salmon to research the vgll3 allele-puberty link | |
| Awazu et al. | An enhancer trap in the ascidian Ciona intestinalis identifies enhancers of its Musashi orthologous gene | |
| Müller-Belecke et al. | Performance testing of clonal Oreochromis niloticus lines | |
| KR101757619B1 (en) | Preparing method of synthetic pig by a cross between Duroc and Korean native pig, and synthetic pig using the same | |
| Stundl et al. | Efficient CRISPR mutagenesis in sturgeon demonstrates its utility in large, slow-maturing vertebrates | |
| Lehnert et al. | Sperm competition, but not major histocompatibility divergence, drives differential fertilization success between alternative reproductive tactics in Chinook salmon | |
| Ma et al. | Maternal control of visceral asymmetry evolution in Astyanax cavefish | |
| Cohen et al. | Genetic, morphometric, and molecular analyses of interspecies differences in head shape and hybrid developmental defects in the wasp genus Nasonia | |
| CN115261360A (en) | Method for constructing gata6 gene knockout zebra fish model | |
| Hussain et al. | Production of heterozygous and homozygous clones in Nile tilapia | |
| US11653636B2 (en) | Method of making a rat model of retinal degeneration and rat model made thereby | |
| Vega | Fundamentals of genetics |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |