CN117778401A - Donor fragment targeting hTUBB8 gene, construction method of oocyte maturation disorder animal model and its application - Google Patents

Abstract

This application provides a method for constructing a donor fragment of the mutated hTUBB8 gene, an animal model of egg maturation disorder, and its application. From the 5' end to the 3' end, the donor fragment consists of the ZP3 promoter region, Kozak sequence, mutated hTUBB8 gene fragment, tag sequence, WPRE sequence and terminator sequence. The mutated hTUBB8 gene fragment is different from the wild type. The wild-type hTUBB8 gene has the following mutation: c.785G>A. The cDNA sequence of the wild-type hTUBB8 gene is shown in SEQ ID NO: 3. The animal model constructed using the nucleic acid product of the present application can provide help for in-depth analysis of the pathogenicity of TUBB8 mutations and exploration of treatment strategies, and provide new reference for the clinical diagnosis and treatment of patients with this type of gene defect.

Description

Donor fragment targeting hTUBB8 gene and construction of animal model of egg maturation disorder Methods and their applications

Technical field

The present application relates to the technical field of animal models, and in particular to a donor fragment targeting the hTUBB8 gene, a method for constructing an animal model of egg cell maturation disorder, and its application.

Background technique

In recent years, infertility has become one of the major diseases affecting human physical and mental health. About 15% of couples around the world are affected by it, of which female infertility is the main factor. Oocyte maturation undergoes a series of complex physiological changes and molecular regulation processes such as resumption of meiosis, disappearance of germinal vesicles, and expulsion of polar bodies before it can gain the potential to be fertilized and develop into a new individual. When the oocyte maturation process is abnormal due to various reasons, the oocyte cannot mature and cannot complete the fertilization process, resulting in infertility. Clinically, recurrent complete oocyte maturation disorders are not uncommon. The main type is primary infertility caused by repeated maturation arrest of most of the patient's oocytes in different IVF/ICSI cycles. This is one of the reasons why a small number of women still fail to conceive despite repeated assisted reproductive technology. With the widespread application of next-generation sequencing technology, multiple disease-causing genes that cause developmental disorders in human eggs have been discovered. However, currently there is no effective clinical treatment for egg maturation disorders, and the pathogenesis of many female infertile patients remains unclear.

Therefore, the search for new disease-causing genes and new animal models is of great significance for the clinical diagnosis and treatment of diseases related to egg maturation disorders that lead to female infertility.

Summary of the invention

This application study found that the TUBB8 (c.G785A) mutation has a dominant negative effect, which can destroy the function of microtubules and the assembly of the oocyte meiotic spindle, thereby leading to female infertility. Based on this, the present application designed a simple and effective way to quickly knock in the hTUBB8 gene using the Crispr-Cas system to construct an animal model of the disease. This application uses the ZP3 promoter to drive the expression of the TUBB8 (c.G785A) gene. The Crispr-Cas system can accurately cut DNA to cause double-strand breaks under the guidance of gRNA, and can specifically knock in the hTUBB8 (c.G785A) gene mutation, thereby constructing an animal model of female infertility.

The specific plan for this application is as follows:

The first aspect of the present application provides a donor fragment targeting the hTUBB8 gene. From the 5' end to the 3' end, the donor fragment is the ZP3 promoter region, the Kozak sequence, the mutated hTUBB8 gene fragment, and the tag sequence. , WPRE sequence and terminator sequence, wherein the mutated hTUBB8 gene fragment has the following mutation compared with the wild-type hTUBB8 gene: c.785G>A, and the cDNA sequence of the wild-type hTUBB8 gene is shown in SEQ ID NO: 3 .

In one embodiment, the nucleotide sequence of the donor fragment is shown in SEQ ID NO: 2.

A hTUBB8 gene editing system, the editing system includes the above-mentioned donor fragment targeting the hTUBB8 gene;

Optionally, the editing system also includes one or more of Cas9 nuclease, Cas9 mRNA and gRNA.

A recombinant cell comprising the above-mentioned donor fragment targeting the hTUBB8 gene or the above-mentioned hTUBB8 gene editing system.

The present application also provides a method for constructing an animal model of egg maturation disorder, the method comprising the following steps:

The above-mentioned hTUBB8 gene editing system was used to construct an animal model of egg maturation disorder.

In one embodiment, the construction method comprises the following steps:

Transfer the hTUBB8 gene editing system into the fertilized eggs of the target animal;

Transplant the fertilized eggs transferred into the hTUBB8 gene editing system into female animals and produce F0 generations; and

The F0 generation is mated with the wild type to obtain F1 generation heterozygotes, and the F1 generation heterozygotes are selfed to screen out the homozygous F2 generation as an animal model for egg maturation disorders.

In one embodiment, the method of transfer includes microinjection.

In one embodiment, the construction method further comprises the following steps:

The hTUBB8 genotype of the target animal was identified using primer pairs with nucleotide sequences as shown in SEQ ID NO: 4 to 7.

In one embodiment, the identification method includes one or more of PCR and Sanger sequencing.

The present application utilizes the ZP3 promoter to drive the expression of the TUBB8 (c.G785A) gene, thereby simulating the expression characteristics of TUBB8 mutation patients. The present application provides a method for constructing a hTUBB8 (c.G785A) gene knock-in mouse model, which utilizes the Crispr-Cas system to precisely cut DNA under the guidance of gRNA to cause double-strand breaks, and can specifically knock in the hTUBB8 (c.G785A) gene mutation, accurately simulating the mutation site of TUBB8 mutation patients. Thus, an effective mouse model capable of simulating the TUBB8 expression characteristics and mutation sites carried by patients is constructed, which provides assistance for in-depth analysis of the pathogenicity of the mutation and exploration of treatment strategies, and provides a new reference for the diagnosis and treatment of such patients with genetic defects in clinical practice.

The present application also provides a method for screening or identifying drugs for treating egg maturation disorders, using an egg maturation disorder animal model prepared by the egg maturation disorder animal model construction method as described above to screen or identify drugs for treating egg maturation disorders.

Description of the drawings

Figure 1 is a schematic diagram of the genotype of the hTUBB8 (c.G785A) knock-in mouse in Example 1 of the present application, wherein Mouse ZP3 promoter represents the mouse ZP3 promoter region, Kozak-Human TUBB8 (c.G785A) CDS-Myc tag represents the region from the 5' end to the 3' end which is the Kozak sequence, the hTUBB8 (c.G785A) CDS sequence and the Myc tag sequence, WPRE is a cis-acting RNA element, which is a post-transcriptional regulatory sequence, BGH pA represents the transcription termination signal region, and arm represents the homology arm region;

Figure 2 is a diagram showing the identification results of F2 generation mice in Example 1 of the present application;

Figure 3 shows the HE staining results of hTUBB8 (c.G785A) gene knock-in mice.

Detailed ways

In order to make the above objects, features and advantages of the present application more obvious and understandable, the specific implementation modes of the present application are described in detail. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present application. However, the present application can be implemented in many other ways different from those described here. Those skilled in the art can make similar improvements without violating the connotation of the present application. Therefore, the present application is not limited by the specific embodiments disclosed below.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the technical field to which this application belongs. The terminology used herein in the description of the application is for the purpose of describing specific embodiments only and is not intended to limit the application. Unless otherwise specified, various raw materials, reagents, instruments and equipment used in this application can be purchased in the market or prepared by existing methods.

Cas9 mRNA can transiently express Cas9 protease. The characteristic of Cas9 protease is that it can autonomously bind and cleave target genes. The two domains of Cas9, RuvC- and HNH-, are inactive through point mutations. The formed Cas9 can only be mediated by sgRNA. It binds to target genes under guidance but does not have the function of cutting DNA.

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR/Cas9) technology is based on the modification of the immune system in bacteria and archaea. It consists of an R-S structure composed of multiple regularly repeated short palindromic sequences and non-repeating spacer sequences. It consists of a gene operon encoding Cas9 nuclease. It uses guide RNA (gRNA) to mediate the endonuclease Cas9 protein to recognize the target DNA sequence and cause DNA double-strand breaks, promoting repair by homologous recombination or non-homologous end joining. Damaged DNA, thereby achieving multiple modifications such as targeted gene knockout, knock-in, and gene correction at the target site. Due to its high specificity, simple molecular construction, and short process, CRISPR/Cas9 technology has developed rapidly in recent years. Compared with zinc finger nuclease (ZFN) technology and transcription-like effector nuclease (TALEN) technology, it has become more and more popular due to its specificity, high efficiency and simplicity of design in targeted editing of target genes. The application has shown strong genome editing activity in bacteria, mammalian cells, zebrafish, mice, rats, etc.

The terms "and/or", "or/and" and "and/or" used in this article include any one of two or more related listed items, and also include any of the related listed items. and all combinations, including any two of the related listed items, any more of the related listed items, or a combination of all of the related listed items. It should be noted that when at least three items are connected in combination with at least two conjunctions selected from "and/or", "or/and", "and/or", it should be understood that in this application, the technical solution It undoubtedly includes technical solutions that are all connected by "logical AND", and it also undoubtedly includes technical solutions that are all connected by "logical OR". For example, "A and/or B" includes three parallel solutions: A, B and A+B. For another example, the technical solution of "A, and/or, B, and/or, C, and/or, D" includes any one of A, B, C, and D (that is, they are all connected with "logical OR" technical solution), also includes any and all combinations of A, B, C, and D, that is, including combinations of any two or any three of A, B, C, and D, and also includes A, B, C , four combinations of D (that is, technical solutions that are all connected by "logical AND").

One embodiment of the present application provides a donor fragment targeting the hTUBB8 gene. From the 5' end to the 3' end, the above donor fragment is the ZP3 promoter region, Kozak sequence, mutated hTUBB8 gene fragment, tag sequence, WPRE sequence and terminator sequence, among which the mutated hTUBB8 gene fragment has the following mutation c.785G>A compared with the wild-type hTUBB8 gene. The cDNA sequence of the wild-type hTUBB8 gene is shown in SEQ ID NO: 3.

Specifically, the sequence of the nucleotide shown in SEQ ID NO: 3 is: 5'-ATGAGGGAGATCGTGCTCACGCAGATCGGGCAGTGCGGGAATCAGATCGGCGCCAAGTTCTGGGAGGTGATCTCTGATGAACATGCCATCGACTCCGCTGGCACCTACCACGGGGACAGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTACGTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGC ACCATGGACTCTGTGCGCTCGGGGCCCTTCGGGCAGGTCTTCAGGCCAGACAACTTCATCTTCGGTCAGTGTGGGCCGGAAACAACTGGGCCAAGGGACACTACACCGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTTGTCAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTGGGTGGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAG TACCCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCGGACACCGTGGTGGAGCCCTACAACGCCACCCTCTCAGTCCACCAGCTCATAGAAAACGCAGATGAGACCTTTTGCATAGATAACGAAGCTCTGTATGACATATGTTCCAAGACCCTAAAACTGCCCACACCCACCTATGGTGACCTGAACCACCTGGTGTCTGCTACCATGAGTGGGGTCACCACGTGGGGTCACCACGTGCCTGCGCTTCCCGGGACCCCAGCTGAATGCTG TGCGGAAGCTGGCCGTGAACATGGTCCCGTTTCCCCAGCTGCATTTCTTCATGCCCGGCTTTGCCCCACTGACCAGCCGGGGCAGCCAGCAGTACCGGGCCTTGACTGTGGCTGAGCTTACCCAGCAGATGTTTGATGCTAAGAACATGATGGCTGCCTGTGACCCCCGTCACGGCCGCTACCTAACGGCGGCTGCCATTTTCAGGGGTCGCATGCCCATGAGGGAGGTGGATGAACAAATGTTCAACATTCAAGATAAGAACA GCAGTTACTTTGCTGACTGGCTCCCCAACAACGTAAAAACAGCCGTCTGTGACATCCCACCCCGGGGGCTAAAAATGTCAGCCACCTTTCATTGGGAATAATACGGCCATCCAGGAACTCTTCAAGCGTGTCTCAGAGCAGTTTACAGCAATGTTCAGGCGCAAGGCCTTCCTCCACTGGTACACGGGCGAGGGCATGGATGAGATGGAATTCACCGAGGCCGAGAGCAACATGAACGACCTGGTGTCTGAATATCAGCAATATCAGGATG CCACGGCCGAGGAGGAGGAGGATGAGGAGTATGCCGAGGAGGAGGTGGCCTAG-3'.

This application uses the ZP3 promoter to drive the expression of TUBB8 (c.G785A) gene, thereby simulating the expression characteristics of patients with TUBB8 mutations. This application provides a method for constructing a hTUBB8 (c.G785A) gene knock-in mouse model. The Crispr-Cas system is used to accurately cut DNA under the guidance of gRNA to cause double-strand breaks, which can specifically knock-in hTUBB8 (c. G785A) gene mutation accurately simulates the mutation site of TUBB8 mutation patients. This has resulted in the construction of an effective mouse model that can simulate the TUBB8 expression characteristics and mutation sites carried by patients, which will provide help for in-depth analysis of the pathogenicity of the mutation and exploration of treatment strategies, and provide clinical guidance for patients with this type of gene defect. Provide new insights into diagnosis and treatment.

In some embodiments, the nucleotide sequence of the above-mentioned donor fragment is shown in SEQ ID NO: 2.

Specifically, the nucleotide sequence shown in SEQ ID NO:2 is:

5'-CTTGTACCCTTTGGTCTCTGCTGCTAGTCACCCTCTCCTAAACCCTCGTCCTGGGACCCCTCTGCATTTGGCGGTGATGCAGCAGCAGCTACAGCGCTCAGGTAAGGTTTAGAAATAGGCCAGGTTAGCTGATCACACTGGAAAGTTCTGAGATTTCCAGGAGCAATAGTTATCACTGCCCCTTTGTTTCTTAGGTGTCACTAGAAAAACAGGTGAAGTGAACTGACCTGTGCAGTCTCAGGGATTACTACT GCAAGGACAGTCGGAGCCAGCCATGCTCTAGCTCTGTTTTTCACTTCTTATAAGCCTGAGAATTTTTGCTGAGATGTGAACATGTCAGCCTTGGTGGGCTTTCTTACGTTGCATTTTCTTACGTTGCATTTTGCACTTTAGGAAGCCTTTGGTTAAATCCTCTGGTAGACTTCCCATCCCCAAAGTAACAAACCATTCAAGCAAAGTAGGTCAGAAAATATTGTCAATACTGAGAACAGGACTTGGGAGTGAGTATCCAAGGGTGGTC TTAGTAGACTTGTGGGGTTCTGTGGGTGAGGTGTAGAGTAGAGCTACTTTGCTGCACTGACACTCTTCTCTCCATAGTTCTGCATCCTCCAGGCTCTAGTTCCCAGGCAGCAGCTATCAGCGTTTCAGACTCCTCAGAATGTACCCAGCCGGTCGGGCATGCCCCACATGCACTCCCAGCTGGAGCATCGTACCAGCCAAAGGAGCAGCTCCCCTGTGGGCCTTGCCAAATGGTTTGGCTCAGATGTGCTACAGCAGCCTC TGCCCTCCATGCCCACCAAAGTCATCAGTGTAGATGAACTGGAATATAGACAGTGAAGAGGGCAGGCTGGCTCACCCATACCTGGACCTGTGGTGACACCCTGGTCATGACTCTCATTCCCTCTTTGTAATGGGCTTTTACATTGGAGCACACTATGTGAAGATGTTTAGGGGATCCACATACCTACCATGATCTACATTATGACAGAAGGCTGTTAAATCGAATGAACCTACATGGTTCAAATACAAGGGATACAAGATTGTCAGTCCTG AGTCTTTCTTTTATAAAATATGTGAATGAAGTTGTGGTCTTCTAGAGGTGACACCTAAGGGTTCTGAAAAAATAAAATGTATAGACCCTTATGTACAGACCTGTGTATAAACTTTTGTACATACAAATAGGGTAGCTTTTTTTGAACTTATACATACAGCTGTACATAAAGTAACTATCAGTTAGGCTTGTGTCAACTGTTTGGATTTTTTTCACTTGAATATTTGGGACTTTTTCTTTTGGTTTAAAAGTTACATATGCCACGT GTGTGAACGATATGGCTGGTACTGTGTTTATTTCTTCCATGAACTAAGACAGTCTAAATGAGTTCCTTTCACGTTTTAATTTTACCTTAGGACTTCTGGAATTTCTTCTGCACATAAAGTTCTGATAGCATTAGTTTAAGCTGGACTAACCCTGAAAGTAGCTTGTGGCAAGTATCAAGGAATCAATATTACTCTACAAAATCAAAGTTTACAGAGAAGTCATATAGTAATTTTTCTGAAAATTTACTGGCACAATGTTAATCCAGCCTG ACTCCAACTAATTAATGGTCACATTAATTTAAGTCTTTCCCTTGCCTCTGCTGCATTAGTTTCTCTCAAAATTGTTAACTTACAACTTGAAGTCTGGTATTATAAATTGAATGTAAAGCATTCTGAAAGATACTATACTGATTGCAGGTTTTTCAGTCAGGTTCAAGCTAATTTGACCAGTCATTGGATTAATTATGGATCTGGGGCCATAAATGCTATTTTAATTCCACTATAGAGATTAAAATAAGCCATTCTCCATTTCATAATTCTATTGG ACTTTGACTGCAGGGGGCCTCCAAGTCTTGACAGTAGATTATAATCCTTCAGCTGCCCACTCTACTGGAGGAGGACAAACTGGTCACTTTTCAGCAAAACCTGGCTGTGGATCAGGGCAGTCTGGTACTTCCAAGCTCATTAGATGCCATCATGCTCTCACTGCCTCCTCAGCTTCAAGAGGAATCTGGAAAAAGCAGTCCCACTGGTCAGGAAAGGAACACTAGTGCACGGCGCGCCAATTCCTTTTAGCCCCGGTGGGGCAGGTGATTAG GAGCTGTGAAGCCTTTGTTCTTATTGGCAAAAGGGTCCCATATTCTTTCCCTTATACTTGTTGCCATATTAAATGGGTAATGTTTATAAAAGGTTTCCCCAGTGTCTGGCCCGCTCTAATGTGCTTAGCTATTGCTATGACTGCCCCCGTCTGACCTCCAAGAGCCAGATCTCATTCAATAGTTGTACGTGGCATATGATGTTCAGAAAATGTTTGTTGATGGGCTGAGTGAAATTGTGGCTATGAAGTCATAGAATGAAACAGAGG TCTCAGGAAGTAGTCAATGAGTTGGCTCAGCAGGTAAAGGTGACTGCTGCCAAGTCTGATGACCTAAGTTCAATTCCTGGGACCCAAATGTCAGAAGGCAAAACACTCTTGCAAGTTGCCCTGTGACTGTCACTTGTGCATGCCTGCACACACATAAATAAATAAATGCAATATTAAGAATTTTTTTTTTTTAAAGAAAGGGCTCTGGAGGTTTTTCAAAGGAAATTGTTATTACACAGAGAGAACACACACACACACACACACACACA CACACACAACTGAAGCATTCATACCTGTAGGGATGTTCTGGGTTCTTCCTCCAGATAATCCAAGTTTCAATCACTGCCTCTGCTCCAGGGACTTTAGGAGGGGGAAGGGCCCCCGAGATACAGATCAGCACAGACTTTTCTTCTTTTCTTTCCGTAGCTAGAAGGAGAGAAGAGGCAGTGTCCTTGGCCATGGAGCTGCCGGTGGCCCCAGCCTGTCCCCACCTGACCTTGGGGGCAGAGAGGCTAAGGGACAGTGGA AGTGGTCCGCAGTGTGGTGAGCAGCCCCGGAGGAAGGGCACCGAGGAAGAGGAGGAGCTAGGAGGCCAGGTGCCCCTCCTCCTGCCATCTCTCCCCCTGGGCTCAGGTTGCAGAGAAGCCCGAGTGGTTCCTCACCCCTGTGCAGGACAGCCGAGCATCAGACACTGGTGATGGAGAAGCAGCCTGGGTTACAGTGCGAGATCAAGGTTATCCCCAGCTACCTAGTGAGACCCTCTCGCAGCATAAAGAGGTGAAGGTGGG GGAGGGGGGAATTATCAGGATCGGCATAAGTCAGGTGGCTCAGAGGGTGAAGTTGATGGCTGCGCAGGCCTGGCAAATTCAGTTCAACCCCCAGACTCCACAGAATATCGAAAATCCAGGCTTGGTGCAGCACTCCTTTAATCCCAGCACTTGAGAGGCAGAGGCAGGGGCTGGTGAGATGGCTCAGGGGTTAAGAGCACGGGCTGCTCTCCCAAAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCC GTAACAAGATTGGATGCCTCTTCTGGAGTGTCTAAGACAGCTACAGTGTACTGACATATAATAAATAAATAAATATTAAAAAAAAAAGAGAGAGGCAGAGGCAAGTGGATCTTTTGTGAGTTTGAGGCCAGCCTGATCTACATAGTGAATGCCAGGACAGCCAAGGCTATATAGAGACTCTGTCTCAAAAACAAAACAAAACAAAATAAAACACCAGAAGAACAAAATCTTGTTAGAATTAAAACTTTCCCCCAGTTGTGAGTGTTTTGCT TGCATATATGCCTGTGTATCGCATTCAGGCCTCATGCCTTTGGAGGTGAGAGGAGGGCGTTGGCGCTCCTGAGTCTGACTGCAGACAGTTGTGAGCTGCCCTGTACGCACTAGGAATAGAACCTGGGTCCTCTGCAATAGCAACAATTTCTCTAACCACTGAGCCATCTCTCTAACCCTCCCTGTATATTTTATTTATGTATATGTACATGCATAAGTTTATGTGTGTCTTGTCTGCTGAGACTGGAGTTACAAATGGTTGTGA TGCCCTGTGGGTGCTGGGAACCAGACTAAGGTCTTTCTAGGATCATCAAACCTTCTAACTACTGACTCCTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCGGTAGACCAGGCTAGCCTCAAACACAGATCCACCTGCCTCTGCCTCCAAGTGCTGGGATTAGAGGTGCATGCTACCCGCTGCCACCACCACTACCCAGATATTTTTCTTTTAAAGGGTTATTAATGTGTACGTGTGTGTGTGTGTGTGTGTGTGTG TGTTAGTGTATTCCATGTGCAAACGGAGGTTTGAGGAGGCCCGGAGAGGTCAAATCCCCTGTAGCTGGAGTTACAGATGGTTTGTAAGCCACCCGATATGGGTGCTGGGAACCGAACTCTGGACCTCTAGAGAAGCCAGAAGTGCTCATGATCTCTGAGCTACCTCTCCAGTCTTCCTTCCCCTTTGTGTGGATTCCAGGGATGAACCCAGACCCTCAGACTCTGAGGACAGCACTTTTATCTGCTGAGTCATCTGCTGAGTCATCC CATCAGCTGCTCTTGTTTATTTTTGCCAGACTCCCTCTTACTTCATAACCAAAGCTGGCTTCAAATACAATCCTCCTGCTTCAGTCCCCCAAGCGCCGTGTTTCAGGAGTGTGTCACCCCCAGGCCTTACAAATCTCTGGCTTTCCCCCCTGGTAGGCAGGTTACCCCAGTTCAGGGAGGAATGGGGATGTGAGTTCGAAACACAGGTTAACTCTGATCGTACATATCCAGCCCTTTCTTTCTGTTCCCAGCACAGCCATCAAACACAGC CTTGGGTAACAAGCCTGCCAAGGGCAGGTCCCCAAGCCCAGGCCCTGACTCCTAAGAACCATTAGCCCTTCTGTAATTCCTGCCAGGAGAGGTGCTATCTGTCTGGACCCCACCCGCACAGTTGCCTGGCAGCAGGCAGGTAGGCCTGGCACACTGTAAGAGGGGATGTTTGCCCCCTCCTCCCTCTCTTGCCCCCTTCCTTACTCCTCCTCCCCCTCTCCCCATTCCCTCACCCCTCTCTCCATGTGGTCATGGCCGGCC TCTACTTCTCTGCTCTCTCCTTCTCTCTGCCTTTCTCTCCCTCTGCTACCCTCTTAACTCCCCTCCCCATGCTCTGAATAAACTCTATTCTATATTATACAGTCCTGTGGCTGGTCTCTCAGGGGGAAGGGATGCCTTGGCATGGGCCCGCTGAGACACCCCCTTTCCCCACACCCAGACAGAACATATCTTGATAGCTCTTTCTCCTTTTATGATCACAACACTGTCGACAGCTGCCTCTGATAGGCGTCCATCCCTCCTCCCTCCCAGTG CTGACCATGTATCATGTACCATGTACCATGTACCATGTACCATGTATCATGTATCATGTATCAGCTTCAGCAAGTTAATACTCTCACGCGCCATGGCCAGCGGCTTAGCCTGGCACCCTCAGGGTCCTGCCTGGCCCGCCTCACCAGCCTTCGAGGCTCATCTCCCAGGACCTGGGCATTTCTGCAGGCCCACCTGAGCGTCTTTCTCCATCTTGGCTCACACAGCTGCCTCTGCCTAACCAGGGCTCATTGCTTACGCCCCATGAG TGGAGGGAGCACTGACCCAAGGATGTACTCAGGTGAATCGTTTGTTCTTTGATAATTGTGCCAAGCCATGTTAAAACCAAAGCCTGCACAAGGCCCTTGATTGCACCCCCAGTGTCTCAAAAATAAAATAAGAAATCAAAGCTGGGTAGGGCAATAGCCTGTCTAGAATGATAGCACTCAAAGCAGAGGCAGGAAGATCCTGCAGTTTGTTTGAGACAGGATCTCACTATGTGACTCTGGCTGGCCTGGAATTGGCCTCAGACTTACAGAGA TCCACCTGCCTCTGCCTCCTGAGTTTTGGAGTTTTATGTATTCATTTGTTTGTTTGTTTGTTTGTTTGTTTTGAGATAGAGTCTCACCATGTAACCCTAACTAACAGAAATTCACCTGCCTCTGCCTCCCTAGTGTGTGCACCTCAGAGGCAGCAGTGGGAGGCTTCTGATTTTGAGGCCAGCCTAGGATACACAGTAAGACCCTGTCATTCCCCCTCCCCAAATAGTTTATGTAAATATATCCACCAGAAAAAAATGTTGA GGCCTAGGAGGGTGGCAAAAGGCTGGAGGCTGAGACGGAAAAATTACTCTAGCCCAGGGTTCAAGGCTAGACCAAGTGATATAGTAAGACTACAGCTCTAAAAAGTAAAACAAACAAAACAAAACAAAACAAAAAACTATAGTCAGGTAGCATGGTTGATCCATCCAAAGTAAAAGCAAGAAGACTAGAAGCTGACAAAGTGGCTCAGTGCGTGTGGCATGCGCCGTGTATCCTAACTGCGTGAGCTGGAGCTCCGGGACCCACAAGATGGAAGGAG AAAACTGACCCCCGAAAGTCGTCTCTGACCGACCCCCACATGCAGACTGTGGCACATGAATACCCCTCCATACACACAAAGTAAATGTGTTTTAAAATAAAACGGGGTGTGGGCTTATACCTTGCAATCCTGGTACTAGGAAAGCTAAGCTGGGGAATTGTTATTTAGGGTCAGCTTGGGCTACATGTAATAGTTCTAGGCCAGCCTGGGCTATACAGCAAGACCTGTCTGAAAAAGCAAAATATCAATTTCCCTGATAGAGGAAA TACCATGATGAGGACTGTTGTGTGTGTGTGTGTGTGTGTGTGTGTATGGTATTTTCTTCTTTCTTTTTCTTTCTTAGGGGAGAGGTCCCTCCGTTGCACTACAGATGTGCTAGCCCCTGCAGGTTCCCCAGATTTGAAAAATAGGACTGCCGAATATTAGTTGTGGAACATTGTGATATTCCCATTAAAAATAAAGTAAAATAAAATTATGATACATAAGTGGGGAGGGGTGTGTGGCAGCAATGCATACCTTTAAC GCCAGCACTCAGAGGCAGAGGCAGGTAGATCTCTGGGAGTTCAAGGCCAGTCTGGTCCATACAGTGAGTTCCAGAAATACACAGAGAAATCCTGTCTCAAAAAACAAACAAAAAACAATATACATATATATGTATATGTATATATATATATATATATACATAAAATAGACAAATTAACTTAATTTGCTTTTTGCCTGGCAGGGGTTGCTCATAACTGAGGAGTTTACCCCAAGGGACAAGCTGTTGAATAGGTCCCAGGCACATATTATT TTCTCTTGACACCTAATTAATGGCTCTTTAGTCTTCACTTGCCAGGAGTCCTCCAGCTGATTCTAAGAAAACCCCTGTGTCTTCCTAAGTCTCTCCAGGGTCCCCTCCCAGGCCCATGATGACACCTGGAGAAGCCTGGAGCTTTGAGCTTCCAACATCCAACCATACAGCTCTGAGCACACCGGGTGGGGATGGGGAGAAAGTGAAAAACTATGGCCCACCAGGCTTTAACGTGCAAAGTCCAGCCTCCATGGCCAGGCCTTT CATCACAGCTACTTGAGAGATTGAGGCCAGAAGACTCAGAAGACTGTGAAGTTCAGGCTTCCAAGCCACAGAGTGAGTCCAAGGCCAAGAGGAGCAACTTAATAAAACTATCTTGAAAGAGAGAGAGAAAGAAAGAGAGGGTGGGGAAGAGAGGGAGAGAGAAAGAGCAAAAGAAAGGAAAGGAAAGGAAAGGAAAAAGCTGGGGTTAAAGCTTAGAGCACCTGCCTAGAGTACCCCTGTAAAGGGCTGGGGGCATGGCTCA GTGGTAGAGTCCCTGCCTAGAATCCCCCAGGGAGGGGTTGGGGGCGTGGCTCAGGGGTAGAGCCCCTGCCTAGAATCCTCCAGTGAGGGGCTGGGGGCGTGGCTCAGGGGTAGAGCCCCTGCCTAGAATCCTCCAGTGAGGGGCTGGGGCATGGCTCAGGGGTAGAGCCCCTGCCTAGAATCCCCCATTGAGGGGCTGGAGGCGTGGCTCAGTAGCAGAGCCCCTGCCTAAAATGCCCCAGGGAGGGGGTGGGTGCCTC ACTAGAGCACTTGGCTTATATTCAGGAAAAGAATTAAAATTTGAATAGGATCCTGGTGTGGTGACATAGGCCTTTCATCCCAGCATAGGCTTTTAATCTCTGGAGGCAGAGGTAGGCAGATTGCTGAATTCGAAGGCAGCCTAGTCTACGAATGCAGCCAGTTCCTCGACAGCCAGAGTTACACTGAGAAATCCTGCCCTGAAAAACAGAAATAAAACAAAACCCAACAACAGCAAAACCCCCAAAACCCAAAACAAAAAAAACAAAAACCTA AGTAAACAAAATAATAACAGAAACCCCAACCAACCGAAGAAATAAAAACCTTGAATAGGAATCACGTGGAGTGTCTTTACAACTATAACCCAGATTCTGATCGTTGGTTCAGATGAGGTTTGAGGCCACAGGTCTAATAATGTGTTGATAATGGGCTCCACCCGAGATTGAGGGAAGCAGAGGGAATTCAGGTGGGAGGGTGGGCCATCGGTGATATAAGAACAGTGGTGTCAGCCTGCGATCGCGCCGCCACCATGAGGGAGATC GTGCTCACGCAGATCGGGCAGTGCGGGAATCAGATCGGCGCCAAGTTCTGGGAGGTGATCTCTGATGAACATGCCATCGACTCCGCTGGCACCTACCACGGGGACAGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTACGTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACTCTGTGCGCTCGGGGCCCTTCGGGCAGGTCTTCAGGCCAGACAACTTCATCT TCGGTCAGTGTGGGGCCGGAAACAACTGGGCCAAGGGACACTACACCGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTTGTCAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTGGGTGGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTACCCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCGGACACCGTGG TGGAGCCCTACAACGCCACCCTCTCAGTCCACCAGCTCATAGAAAACGCAGATGAGACCTTTTGCATAGATAACGAAGCTCTGTATGACATATGTTCCAAGACCCTAAAACTGCCCACACCCACCTATGGTGACCTGAACCACCTGGTGTCTGCTACCATGAGTGGGGTCACCACGTGCCTGCGCTTCCCGGGCCAGCTGAATGCTGACCTGCGGAAGCTGGCCGTGAACATGGTCCCGTTTCCCCAGCTGCATTTCTTCATGCCCGGCT TTGCCCCACTGACCAGCCGGGGCAGCCAGTACCGGGCCTTGACTGTGGCTGAGCTTACCCAGCAGATGTTTGATGCTAAGAACATGATGGCTGCCTGTGACCCCCGTCACGGCCGCTACCTAACGGCGGCTGCCATTTTCAGGGGTCGCATGCCCATGAGGGAGGTGGATGAACAAATGTTCAACATTCAAGATAAGAACAGCAGTTACTTTGCTGACTGGCTCCCCAACAACGTAAAAACAGCCGTCTGGTGACATCCCACCGG GGGCTAAAAAATGTCAGCCACCTTTCATTGGGAATAATACGGCCATCCAGGAACTCTTCAAGCGTGTCTCAGAGCAGTTTACAGCAATGTTCAGGCGCAAGGCCTTCCTCCACTGGTACACGGGCGAGGGCATGGATGAGATGGAATTCACCGAGGCCGAGAGCAACATGAACGACCTGGTGTCTGAATATCAGCAATATCAGGATGCCACGGCCGAGGAGGAGGAGGATGAGGAGTATGCCGAGGAGGAGGTGGCCGAACAAAAAAA ACTCATCTCAGAAGAGGATCTGTAGTTAATTAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACG CAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCTTTCGGCCCTCCAATCCAGCGGACCTT CCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCACGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCTGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTGGGGGGTGCTGG GTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGACTCGAGTTATCCTGGGTGTCTGCTGAGCCAACAGTGGTAGTAAGGTAAGGGCAGGATGTGTCAAACTGCCAATAGAGAACTACTTACTCTTCAGGCTGAAGCTGATGGAACAGGTAACAAAGGCAAACACTAATCATGATCAGCAAGATGAAGCAGAAAGGGAACAAGGGGATATTAAATG TGTATAGACACGCTAGAGAGATGGCTCAGCAGTTAAGAGAACTAGCTGGTCTTTCAGAGGTCCTGAGATCAATTTTAGACACCCACATGGTGGCTCATGACCATCTATCTATAAATGGATCTGATTTTCATGTCTGGCAGTGTACAGAAGCTAACTGAAGAAAGGTGGAAGACCCACAAGAGTTCAAGATAAGCCCTATATAGTGAAGTTCAAGGCAAGCTTTTTCTACCTGAAACTTAGTCTCAAAAAAAAATGAATACGTAAACAGTCT TCCAGGGGATAAGAACCTTACAGAAAAAGCAGAAATGCCTGGGGCACTGGATTACCGATGTAATCAAATTCAGTCCTTGAATTGAACACAGGATTGCCTAGAGCAAGGCCAGCCAGAGATTCATCTCAGAGGGAGAAAGGTGTCTTTGGAGCAATTTTGTGGTAATCTAGTATGTATCACATAAGTTTAGACGCATTTGGGACTGGAAAGATGTGAACAAAGCACCCTATGGCTCACATCTGTCATTAACTCTAGTTCCAGTGCACCTGAC ACCGTCTTCTGGCCTCTGCAGTGACCAAGCACATGGGTAGTATGTAGACATATACATAAGCAAAACACACATCATTAAAAAGTGACATTTCCCAAAGGAAGCTGAAGAACCAGTTCTTGAGAAGATAGTAGAAATCAGAAGGGGAAATAGTAGACATACAGAGGGACTGACCAGGTTGTGTCACCTTTATAGGCTAGGCTAATGGATGATCGACACTAGCGCTCTTTGTGAAGGACACACAAATGAGACATAGTTTATAGGACTAAACAC ACTTCTAAGCAATTTAATGAGACTTAAGACCCTGTCTCTAGCAAATACTCTGGATGATATTCAGCTCAAGGCTCTTGTCAGACATGTTTCCATTTTCAAGGTGAGCTAACTGGCCAAAACTGCCAACAACCTGTAGTGAATAGAGAAGATGAGAAAATCTGGATTCTCAAATGACCTAATGAAAGCCACTGGAGCGCCATATGGTTTCTGTGAAAATGCCTTTTCAATCATTAACCTCTTAAATGAGTGTTAGCATCCTAACTAATGAGT GGTGCAGAATAGTGGGTCTGCTTAGCTTAACTAAGGCCAAGAAAACAAAACAGGAAATTCATTCCATGTCATGAGACTCATACTACGAGGTTCCCTTAGACCTCAGGAGAAAAAGTCTTTGGCTGTAAGAACACACCTCAGTGGATGTGGTAGACTATGCCTTTACTCTTTTTTTTTTTTTTTTTTTTTTGGGTTTTTCGACAGGGTTTCTCTGTGTAGCCTTGGCTGTCCTGGAACTCACTTTGTTGACCAGGCTGGCC GAACTCAGAGATCCGCCTGCCTCTGCCTCTCAAGTGCTAGAATTAAAAGTGTGCGCCACCACTCCCAGCTATATAGACTATGCCTTTAATCAGGACACTTGGGAGGCAGGGGGATCTCAAATTCAATTCCAGACAGATGACTGACAAACACACACATACACCATTCGTCTTTTCTTTTTTTCTTTTTTCTTTTGAAAACAGGTTTCTCTATGCAGCCCTGGCTTTCCTAGAATTCAATCTATAGACCCAGCTGGCCTCAAACACAGATC TTGCCTCTGCCTCCTCAACACTATGACTAAAGGTGTGAACCACCACCACCACCCACCTGGCCAAAGAATGAATTGAGTGAATAAGTACGAGTGCAACTCTCCAGCAGCCTGAGGCAAGAAAGCTTAACAGTTGAACCTGAGACCCTACTTCGTTTGTGTTGTACATATCTTCTCATAATGAACTAGGCAGCCTAGTCTCTCTACCAAATACACCATGCACTTACACCTCCTCAAACCAA-3'.

One embodiment of the present application also provides an hTUBB8 gene editing system including the above donor fragment.

In some embodiments, the hTUBB8 gene editing system also includes one or more of Cas9 nuclease, Cas9 mRNA and gRNA.

In some embodiments, the nucleotide sequence of the above-mentioned gRNA is shown in SEQ ID NO: 1.

Specifically, the nucleotide sequence shown in SEQ ID NO: 1 is 5'-GAACACTAGTGCACTTATCCTGG-3'.

It can be understood that the gRNA targeted mutation site is the safe site H11 region (the region between 4.5kb downstream of the Drg1 gene and 0.7kb upstream of the Eif4enif1 gene). Inserting foreign genes into this region will not affect the expression of other genes in the mouse.

One embodiment of the present application also provides a recombinant cell including the above-mentioned donor fragment targeting the hTUBB8 gene or the above-mentioned hTUBB8 gene editing system.

It can be understood that by editing the hTUBB8 gene of cells through the hTUBB8 gene editing system, the recombinant cells obtained can pass the mutated genotype to progeny cells through cell division, and are stable and heritable.

One embodiment of the present application also provides a method for constructing an animal model of egg maturation disorder, including steps S10 to S50.

Step S10: Design gRNA and donor fragment targeting the hTUBB8 gene for the hTUBB8 c.785G>A mutation site of the target animal.

In a specific example, the nucleotide sequence of the donor fragment targeting the hTUBB8 gene is shown in SEQ ID NO: 2.

Using the above-mentioned donor fragment of the specific hTUBB8 gene, combined with the Crispr/Cas9 system, the mutation site of the hTUBB8 gene can be specifically knocked into the genome of the target animal, thereby constructing an animal model carrying the hTUBB8 gene mutation.

Step S20: Transfer the hTUBB8 gene editing system into the fertilized eggs to obtain fertilized eggs transferred into the hTUBB8 gene editing system.

In some embodiments, the above-mentioned hTUBB8 gene editing system includes the above-mentioned donor fragment, gRNA and Cas9 mRNA.

In some embodiments, the method of delivery is microinjection.

Step S30: Transplant the fertilized eggs in step S20 into the female animal and produce the F0 generation.

Step S40: Mate the F0 generation in step S30 with the wild type to obtain F1 generation heterozygotes, self-cross the F1 generation heterozygotes, and screen out the homozygous F2 generation as an animal model for egg maturation disorder.

In some of these embodiments, the target animal includes a rat or mouse.

Optionally, the target animal is a mouse.

In some embodiments, the above construction method further includes step S50.

Step S50: Identify the genotype of the target animal.

In some embodiments, primer pairs with nucleotide sequences such as SEQ ID NO: 4-7 are used to identify the genotype of the target animal.

In some embodiments, the steps of genetically identifying mice include step a, step b, step c, step d and step e.

Step a: Extract genomic DNA from mouse toes and/or tails.

Step b: Use the genomic DNA extracted from mouse toes and/or tail as a template, and use the first amplification primer with a forward primer sequence such as SEQ ID NO:4 and a reverse primer sequence such as SEQ ID NO:5. After performing PCR amplification on a second amplification primer pair with a forward primer sequence as SEQ ID NO:6 and a reverse primer sequence as SEQ ID NO:7, an amplification product is obtained.

Specifically, the sequences of the first amplification primer pair are: forward primer hTUBB8-F3 (SEQ ID NO:4):5'-CTCTACTGGAGGAGGACAAACTG-3'; reverse primer hTUBB8-R3 (SEQ ID NO:5) :5'-GTCTTCCACCTTTCTTCAGTTAGC-3'; the second amplification primer pair, whose sequences are: forward primer hTUBB8-F10 (SEQ ID NO: 6): 5'-GCCTCCAAGTCTTGACAGTAGATT-3'; reverse primer hTUBB8-R10 ( SEQ ID NO:7): 5'-TGAAAACCTCCAGAGCCCTTTC C-3'.

In some embodiments, the identification method includes one or more of PCR and Sanger sequencing.

In some of the embodiments, in step b, the PCR amplification program is set as follows: pre-denaturation at 95°C for 5 minutes; denaturation at 94°C for 30s-45s, annealing at 56°C-72°C for 30s-60s, and extension at 72°C for 30s-60s, in total. Cycle 30 to 35 times; finally extend at 72°C for 5 min to 10 min, and store the PCR amplification product at 4°C. It is understood that in some other specific examples the PCR procedure can be reasonably adjusted.

In a specific example, the PCR amplification program is set as follows: pre-denaturation at 95°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, a total of 35 cycles, and a final extension at 72°C for 5 minutes. The PCR amplification product Store at 4°C.

Step c: Perform agarose gel electrophoresis on the PCR amplification product.

In one embodiment, in step c, 3 μL to 5 μL of PCR amplification product and DL5000 DNA Marker are respectively spotted into the gel wells, electrophoresed at 220V for 10min to 20min, and imaged and photographed.

In one embodiment, in step c, it is determined by agarose gel electrophoresis that the band size of the PCR amplification product is correct.

Step d: Sequence the amplification product.

In one embodiment, in step d, the sequencing method is Sanger sequencing.

In one embodiment, in step d, the sequencing analysis is performed using the same primer pair as the PCR amplification primer pair.

Step e: Identify the hTUBB8 genotype of mice.

In one embodiment, in step e, the sequence obtained by sequencing in step d is compared with the corresponding DNA sequence of the wild-type hTUBB8 gene as shown in SEQ ID NO: 8 to analyze whether it is an hTUBB8 gene knockout mouse.

Specifically, the nucleotide sequence shown in SEQ ID NO: 8 is: 5'-CTCTACTGGAGGAGGACAAACTGGTCACTTTTCAGCAAAACCTGGCTGTGGATCAGGGCAGTCTGGTACTTCCAAGC TCATTAGATGCCATCATGCTCTCACTGCCTCCTCAGCTTCAAGAGGAATCTGGAAAAAGCAGTCCCACTGGTCAGGAAAGGAACACTAGTGCACTTATCCTGGGTGTCTGCTGAGCCAACAGTGGTAGTAAGGTAAGGGCA GGATGTGTCAAACTGCCAATAGAGAACTACTTACTCTTCAGGCTGAAGCTGATGGAACAGGTAACAAAGGCAAACACTAATCATGATCAGCAAGATGAAGCAGAAAGGGAACAAGGGGATATAGACACGCTAGAGAGATGGCTCAGCAGTTAAGAGAACTAGCTGGTCTTTCAGAGGTCCTGAGATCAATTTTAGACACCCACATGGTGGCTCATGACCATCTATCTATAAATGGATCTGATTTTCATGTCTGGCAGT ACAGAAGCTAACTGAAGAAAGGTGGAAGAC-3'.

In one embodiment, in step e, the knock-in mouse obtains hTUBB8 (c.G785A) gene mutation.

The above-mentioned method for constructing animal models of egg maturation disorders has at least the following advantages:

(1) By targeting the donor fragment of the hTUBB8 gene and the gRNA targeting the hTUBB8 gene, the hTUBB8 (c.G785A) gene mutation was specifically knocked in to construct an oocyte maturation disorder animal model.

(2) This construction method can achieve hTUBB8 (c.G785A) gene knock-in at a specific time and space through conditional gene knockout.

In addition, one embodiment of the present application also provides a method for screening or identifying drugs for treating egg maturation disorders. The egg maturation disorder animal model prepared by using the above-mentioned method for constructing an egg maturation disorder animal model can be used for screening or identification. Drugs used to treat egg maturation disorders.

The above-mentioned screening or identifying drug method for treating egg maturation disorder uses the egg maturation disorder animal model prepared by the above-mentioned method for constructing an egg maturation disorder animal model to screen or identify drugs for treating egg maturation disorder, because the above-mentioned egg maturation disorder animal model For egg maturation disorders, it is more accurate to screen or identify drugs involved in egg maturation disorders.

The present application will be further described below with reference to specific examples and comparative examples, but they should not be understood as limiting the protection scope of the present application. The raw materials involved in the following specific examples can all be commercially available unless otherwise specified. The instruments used can be commercially available unless otherwise specified. The processes involved can be commercially available unless otherwise specified. All are routine choices for those skilled in the art.

Example 1

1. The applicant clinically discovered a patient carrying a TUBB8 gene mutation. The patient's TUBB8 gene contained a c.G785A mutation.

TUBB8 is a subtype of β-tubulin, which is only distributed in oocytes and early embryos. It is not expressed in somatic cells and sperm cells. This gene expresses β-tubulin. TUBB8 is specifically expressed in oocytes and is the main form of B-tubulin that constitutes the oocyte spindle. TUBB8 mutation affects the folding of the corresponding protein, changes the dynamics of microtubule action, and causes disordered spindle morphology and structure, which in turn affects meiosis and leads to phenotypes such as oocyte maturation disorders.

2. Sequence design

The gRNA targeting site designed for inserting the exogenous hTUBB8 (c.G785A) gene in mice is the safe site H11 region (the region between 4.5kb downstream of the Drg1 gene and 0.7kb upstream of the Eif4enif1 gene). Insert in this region Foreign genes will not affect the expression of other genes in mice. The nucleotide sequence of gRNA is: (SEQ ID NO: 1)5'-GAACACTAGTGCACTTATCCTGG-3'. Since the TUBB8 gene is unique to primates and has no homologous gene expression in mice, the mouse ZP3 promoter was used to drive expression. The mouse ZP3 promoter is a promoter with a clear sequence that has been reported so far. It starts to initiate gene expression in the oocytes of primary follicles and reaches its peak expression in oocytes of growing follicles, which is similar to that of human TUBB8 in growing follicles. The pattern of expression is consistent with the onset of expression in oocytes of follicles. Therefore, the present invention selects the mouse ZP3 promoter to activate the specific expression of the exogenous hTUBB8 (c.G785A) gene in the mouse primary follicle development stage, so as to simulate the TUBB8 (c.G785A) gene in patients as completely as possible. expression mode. That is, in order to simulate the period-specific expression characteristics of hTUBB8 (c.G785A) gene in patient eggs, this application uses the mouse ZP3 promoter to drive the expression of hTUBB8 (c.G785A) gene. The designed Donor DNA sequence is: Mouse Zp3promoter- Kozak-Human TUBB8-mutant CDS-Myc tag-WPRE-BGH pA, the nucleotide sequence is shown in SEQ ID NO:2, and all Donor DNA sequences are obtained through artificial synthesis.

3. Microinjection of F0 generation mice

Design and synthesize gRNA for the specific site in the H11 region, and in vitro transcribe it into mRNA with Cas9 nuclease. Design and synthesize a Donor DNA template that is highly homologous to the upstream and downstream sequences of the specific target site (SEQ ID NO: 2 ); gRNA, Donor DNA and Cas9 mRNA were injected into the fertilized eggs of C57BL/6J mice through microinjection, and the fertilized eggs after microinjection were transplanted into the uterus of the mother mouse. The mice born after conception are the F0 generation mice. .

4. Breeding of F1 generation mice

Genetically stable F1 generation heterozygous hTUBB8 (c.G785A) gene knock-in mice were obtained by mating F0 generation mice with positive sequencing results and WT wild mice.

5. Breeding of F2 generation mice

F1 generation heterozygous mice were bred with each other to obtain F2 generation homozygous point mutation mice, that is, a knock-in mouse model carrying hTUBB8 (c.G785A) mutation, as shown in Figure 1.

6. Mouse identification

6.1 Ten days after the birth of F0, F1 and F2 mice, the mouse DNA was extracted using the alkaline lysis method. The specific steps are as follows:

(1) Cut the toes or tail of the mouse in the animal room, put the cut tissue back in a 1.5mL EP tube, add 180 μL 50mM NaOH, and use alcohol-sterilized scissors to cut the tissue into pieces.

(2) Insert the EP tube into the float and place it in a 96°C metal bath for heating for 30 minutes, inverting and mixing once during this period.

(3) Add 20 μL of 1mM Tris-HCl and mix thoroughly by inverting.

(4) Centrifuge at 12,000 rpm for 2 minutes, pipet the supernatant into a new EP tube, and mark it.

The offspring mice of the crossbreeding were genotyped based on the toe genomic DNA by PCR and Sanger sequencing, and the primers used included: a first amplification primer pair, whose sequences were: forward primer hTUBB8-F3 (SEQ ID NO: 4): 5'-CTCTACTGGAGGAGGACAAACTG-3'; reverse primer hTUBB8-R3 (SEQ ID NO: 5): 5'-GTCTTCCACCTTTCTTCAGTTAGC-3'; a second amplification primer pair, whose sequences were: forward primer hTUBB8-F10 (SEQ ID NO: 6): 5'-GCCTCCAAGTCTTGACAGTAGATT-3'; reverse primer hTUBB8-R10 (SEQ ID NO: 7): 5'-TGAAAACCTCCAGAGCCCTTTC-3'; the reaction system of PCR amplification is shown in Table 1,

Table 1

Reagent name Added volume Green Master Mix 15μL gDNA 1.5μL hTUBB8-F3/F10 (10 μM) 0.5μL hTUBB8-R3/R10(10μM) 0.5μL RNase Free dH ₂ O 12.5μL Total 30μL

Mix the above PCR reaction system solution and put it into a PCR machine for amplification. The amplification program is shown in Table 2.

Table 2

temperature Number of cycles 95℃(5min) 1 94℃(30s)→72℃(30s)→Tm℃(30s)→72℃(30s) 35 72℃(10min) 1 4℃(save)

The PCR amplification product was subjected to agarose gel electrophoresis to confirm that the amplified target band was correct, and the remaining PCR amplification product was sent to Qingke Biotechnology Co., Ltd. (Beijing, China) for Sanger sequencing verification.

6.2 HE staining identification

The specific steps are:

(1) After washing the ovary samples twice in PBS, place them in 4% PFA for fixation at 4°C overnight.

(2) Place the sample in the embedding medium OCT and freeze it at -20°C overnight. Then cut it into thin slices using a freezing microtome and fix it on a glass slide.

(3) Soak the sample slide in clean water for 1 minute to wash away the OCT, then immerse it in a dye vat containing hematoxylin for 3-5 minutes, and then soak it in tap water three times, 5 minutes each time.

(4) Immerse the slide in absolute ethanol twice for 2 seconds each time, then soak it in a staining vat containing eosin for 1-3 minutes, and then soak it in absolute ethanol three times for 5 minutes each time.

(5) Soak the slides in the clearing agent three times for 2 minutes each time.

(6) Use mounting medium to mount the slides and observe and take photos under a microscope.

7. Result analysis

(1) Sequencing result analysis and sequence comparison

This application used the Crispr-Cas system to successfully construct a mouse (C57BL/6) model containing hTUBB8 (c.G785A) gene knock-in, as shown in Figure 1, where Mouse ZP3 promoter represents the mouse ZP3 promoter region, and Kozak- Human TUBB8(c.G785A)CDS-Myc tag represents the region from 5' end to 3' end, which is the Kozak sequence, hTUBB8(c.G785A) CDS sequence and Myc tag sequence. WPRE is a cis-acting RNA element. It is a post-transcriptional regulatory sequence, BGH pA represents the transcription termination signal region, and arm represents the homology arm region.

1) The criteria for judging genotype identification results are as shown in Table 3 below:

table 3

2) Analysis of mouse genotypes

① Wild type: Use hTUBB8-F3, hTUBB8-R3 and hTUBB8-F10, hTUBB8-R10 primers respectively according to the system in Table 1 to perform the PCR procedures in Table 2 above. The PCR products of hTUBB8-F3 and hTUBB8-R3 primers can be obtained as follows: The agarose gel electrophoresis pattern of the 519bp band is shown in Figure 2. Lane WT represents the electrophoresis pattern of wild-type mouse PCR amplification product. The PCR product was subjected to Sanger sequencing using hTUBB8-F3 and hTUBB8-R3 primers respectively. The results are shown in SEQ ID NO:8 below.

Specifically, the nucleotide sequence shown in SEQ ID NO: 8 is: 5'-CTCTACTGGAGGGAGGACAAACTGGTCACTTTTCAGCAAAACCTGGCTGTGGATCAGGGCAGTCTGGTACTTCCAAGCTCATTAGATGCCATCATGCTCTCACTGCCTCCTCAGCTTCAAGAGGAATCTGGAAAAAGCAGTCCCACTGGTCAGGAAAGGAACACTAGTGCACTTATCCTGGGTGTCTGCTGAGCCAACAGTGGTAGTAAGGTAAGGGCAGG ATGTGTCAAACTGCCAATAGAGAACTACTTACTCTTCAGGCTGAAGCTGATGGAACAGGTAACAAAGGCAAACACTAATCATGATCAGCAAGATGAAGCAGAAAGGGAACAAGGGGATATTAAATGTGTAGACACGCTAGAGAGATGGCTCAGCAGTTAAGAGAACTAGCTGGTCTTTCAGAGGTCCTGAGATCAATTTTAGACACCCACATGGTGGCTCATGACCATCTATCTATAAATGGATCTGATTTTCATGTCTGGCAGTGTACA GAAGCTAACTGAAGAAAGGTGGAAGAC-3'.

② Homozygous type: Use hTUBB8-F3, hTUBB8-R3 and hTUBB8-F10, hTUBB8-R10 primers respectively according to the system in Table 1 to perform the PCR procedures in Table 2 above to obtain the PCR products of hTUBB8-F10 and hTUBB8-R10 primers. There is a 748bp band, and its agarose gel electrophoresis pattern is shown in Figure 2. Lane M: Marker (5000bp). Sanger sequencing was performed on the PCR product using hTUBB8-F10 and hTUBB8-R10 primers. The results obtained are as follows: SEQ ID NO: 9 shown.

Specifically, the nucleotide sequence shown in SEQ ID NO:9 is:

5'-GCCTCCAAGTCTTGACAGTAGATTATAATCCTTCAGCTGCCCACTCTACTGGAGGAGGACAAACTGGTCACTTTTCAGCAAAACCTGGCTGTGGATCAGGGCAGTCTGGTACTTCCAAGCTCATTAGATGCCATCATGCTCTCACTGCCTCCTCAGCTTCAAGAGGAATCTGGAAAAAGCAGTCCCACTGGTCAGGAAAGGAACACTAGTGCACGGCGCGCCAATTCCTTTTAGCCCCGGTGGGGCAGGTGATTAGGAGC TGTGAAGCCTTGTTCTTATTGGCAAAAGGGTCCCATATTCTTTCCCTTATACTTGTTGCCATATTAAATGGGTAATGTTTATAAAAGGTTTCCCCAGTGTCTGGCCCGCTCTAATGTGCTTAGCTATTGCTATGACTGCCCCCGTCTGACCTCCAAGACAAGAGCCAGATCTCATTCAATAGTTGTACGTGGCATATGATGTTCAGAAAATGTTTGTTGATGGGCTGAGTGAAATTGTGGCTATGAAGTCATAGAATGAAACAGAGGGGTC AGGAAGTAGTCAATGAGTTGGCTCAGCAGGTAAAGGTGACTGCTGCCAAGTCTGATGACCTAAGTTCAATTCCTGGGACCCAAATGTCAGAAGGCAAAACACTCTTGCAAGTTGCCCTGTGACTGTCACTTGTGCATGCCTGCACACACATAAATAAATAAATGCAATATTAAGAATTTTTTTTTTTTAAAGAAAGGGCTCTGGAGGTTTTCA-3'.

③Heterozygous type: Use hTUBB8-F3, hTUBB8-R3 and hTUBB8-F10, hTUBB8-R10 primers respectively according to the system in Table 1 to perform the PCR program in Table 2 above. The results are shown in Figure 2. hTUBB8-F3, The PCR products of hTUBB8-R3, hTUBB8-F10, and hTUBB8-R10 primers will have bands at positions 519bp and 748bp.

(2) HE staining identification

As shown in Figure 3, HE staining showed that the follicle size of hTUBB8 (c.G785A) knock-in mice was smaller than that of wild-type mice at the same time.

In summary, the Donor DNA sequence designed in this application is: Mouse Zp3 promoter-Kozak-HumanTUBB8-mutant CDS-Myc tag-WPRE-BGH pA. This sequence contains the mutation position of the TUBB8 (c.G785A) gene carried by the patient. point, and the expression of the gene starts at the primary follicle stage of oocytes through the ZP3 promoter, thereby constructing an effective mouse that can simulate the mutation site and expression characteristics of the TUBB8 (c.G785A) gene carried by the patient. Model. Through subsequent breeding of heterozygous mice, homozygous hTUBB8 (c.G785A) gene knock-in mice can be continuously produced, which can be used as tool mice for subsequent TUBB8 gene function experiments. It is of great significance to provide in-depth analysis of the pathogenicity of this mutation and to explore treatment strategies, and to provide a theoretical basis for the clinical treatment of patients with this type of gene defect.

The technical features of the above-described embodiments can be combined in any way. To simplify the description, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, All should be considered to be within the scope of this manual.

The above-described embodiments only express several implementation modes of the present application, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the patent application. It should be noted that, for those of ordinary skill in the art, several modifications and improvements can be made without departing from the concept of the present application, and these all fall within the protection scope of the present application. Therefore, the scope of protection of this patent application should be determined by the appended claims.

Claims (10)

1. A donor fragment targeting the hTUBB8 gene, characterized in that, from the 5' end to the 3' end, the donor fragment is the ZP3 promoter region, the Kozak sequence, the mutated hTUBB8 gene fragment, the tag sequence, and the WPRE. Sequence and terminator sequence, wherein the mutated hTUBB8 gene fragment has the following mutation compared with the wild-type hTUBB8 gene: c.785G>A, and the cDNA sequence of the wild-type hTUBB8 gene is shown in SEQ ID NO: 3. 2. The donor fragment targeting the hTUBB8 gene according to claim 1, characterized in that the nucleotide sequence of the donor fragment is shown in SEQ ID NO: 2. 3. A hTUBB8 gene editing system, characterized in that the editing system includes the donor fragment targeting the hTUBB8 gene according to claim 1; Optionally, the editing system also includes one or more of Cas9 nuclease, Cas9 mRNA and gRNA. 4. A recombinant cell, characterized in that the recombinant cell includes the hTUBB8 gene-targeting donor fragment according to any one of claims 1 to 2 or the hTUBB8 gene editing system according to claim 3. 5. A method for constructing an animal model of egg maturation disorder, characterized in that the construction method includes the following steps: An egg maturation disorder animal model is constructed using the hTUBB8 gene editing system described in claim 3. 6. The construction method of an animal model of egg maturation disorder according to claim 5, characterized in that the construction method includes the following steps: Transfer the hTUBB8 gene editing system into the fertilized eggs of the target animal; Transplant the fertilized eggs transferred into the hTUBB8 gene editing system into female animals and produce F0 generations; and The F0 generation is mated with the wild type to obtain the F1 generation heterozygotes, the F1 generation heterozygotes are self-pollinated, and the homozygous F2 generation is screened out as an animal model of egg maturation disorder. 7. The method for constructing an animal model of egg maturation disorder according to claim 6, wherein the transfer method includes microinjection. 8. The construction method of the egg maturation disorder animal model according to any one of claims 6 to 7, characterized in that the construction method further includes the following steps: The hTUBB8 genotype of the target animal is identified using a primer pair whose nucleotide sequences are shown in SEQ ID NOs: 4 to 7. 9. The method for constructing an animal model of egg maturation disorder according to claim 8, wherein the identification method includes one or more of PCR and Sanger sequencing. 10. A method of screening or identifying drugs for treating egg maturation disorders, characterized by using an egg maturation disorder animal produced by the method for constructing an egg maturation disorder animal model according to any one of claims 5 to 9 Model, screen or identify drugs for the treatment of egg maturation disorders.