CN116769779A

CN116769779A - Construction method and application of Mybpc3 gene frameshift mutant mouse model

Info

Publication number: CN116769779A
Application number: CN202310727189.3A
Authority: CN
Inventors: 赵跃; 黎江溪; 张世梅; 王玉鑫
Original assignee: Dali University
Current assignee: Dali University
Priority date: 2023-06-19
Filing date: 2023-06-19
Publication date: 2023-09-19

Abstract

The invention provides a construction method and application of a Mybpc3 gene frameshift mutant mouse model, and belongs to the technical field of biology. The invention also provides a gRNA of the target mouse Mybpc3 gene, the nucleotide sequence of the gRNA comprises: gRNA-A1, SEQ ID NO.1; gRNA-B1, SEQ ID NO.2. The invention carries out fixed point deletion on the protein coding region c.3636T of the mouse Mybpc3 gene based on CRISPR/Cas9 gene editing technology, and constructs a mouse model of Mybpc3 gene frameshift mutation c.36delT for the first time, and the mouse model can be stably passaged. The Mybpc3 gene frameshift mutant mouse model obtained by the invention has important application value in the research of the mechanism of hypertrophic cardiomyopathy and the screening of targeted drugs.

Description

Construction method and application of Mybpc3 gene frameshift mutant mouse model

Technical Field

The invention belongs to the technical field of biology, relates to a preparation method of a disease animal model, in particular to a construction method and application of a Mybpc3 gene frameshift mutant mouse model, and particularly relates to a construction method of a fat-thickness cardiomyopathy animal model, in particular to a construction method and application of a fat-thickness cardiomyopathy mouse model of Mybpc3 gene frameshift mutant c.36delT.

Background

Hypertrophic cardiomyopathy (Hypertrophic cardiomyopathy, HCM) is a genetic heart disease prevalent worldwide with major clinical symptoms ranging from dyspnea to chest pain, chest distress, and even sudden cardiac death and fatal arrhythmia. HCM is characterized by a major pathological feature of left ventricular hypertrophy, biventricular, myocardial wall or ventricular septum thickening. HCM can develop at any age and is one of the most significant causes of sudden death in teenagers and young athletes. HCM is essentially characterized by compensatory hypertrophy of cardiomyocytes rather than an increase in cardiomyocyte numbers. Normally, cardiomyocytes are assembled regularly into linear bundle muscle fibers arranged in parallel, but the muscle fibers of hypertrophic myocardium are short, wide and hypertrophic, and the arrangement is disordered. There is no thorough treatment for HCM patients other than heart transplantation. The epidemiological survey data on a large scale show that HCM has a prevalence of not less than 1/500 in the general population worldwide.

The molecular genetics of HCM is based on gene mutations, whose onset occurs in a familial fashion, mainly following an autosomal dominant genetic pattern. HCM has typical genetic heterogeneity, i.e., the disease mechanism, clinical age of onset, progression of disease, severity of disease, prognosis, and risk of recurrence of different mutation sites may all be different. Therefore, it is important to study the disease mechanism and screen drugs for different mutation sites. In recent years, there is a certain understanding of the molecular mechanism of HCM myocardial hypertrophy diseases at home and abroad, but the mechanism of HCM myocardial hypertrophy diseases is not completely clear due to the diversity of genes and mutation sites related to HCM pathogenesis. Up to now, more than 30 pathogenic genes and about 1400 pathogenic mutation sites have been found to be associated with HCM pathogenesis. Among these causative genes associated with the onset of HCM, the most highly causative gene is focused on the gene associated with sarcomere protein coding, wherein Mybpc3, which codes for cardiac myoglobin binding protein C, is one of the most prominent causative genes of HCM (described in the literature: zhao Yue, zhang Hong, xia Xueshan. Application of the next-generation semiconductor sequencing technology in genetic cardiomyopathy molecular diagnosis [ J ]. Inheritance, 2015,37 (7): 10). The Mybpc3 gene is located in the transverse bridge region of striated muscle, is an important component of the thick muscle wire of striated muscle, and plays an important role in the structural integrity of sarcomere. After Mybpc3 gene mutation, obvious compensatory hypertrophy of cardiac muscle cells is caused, and heart tissues show the characteristics of enlargement of the whole heart, thickening of myocardial wall or ventricular septum and the like.

The study of disease mechanism is the early foundation for the development of therapeutic, prophylactic and effective drugs. Under the conditions that myocardial tissues of human HCM patients are not easily available, have poor replicability and are limited by medical ethics, the research on the disease mechanism of HCM and the development of medicaments are slow. More importantly, the myofestival gene mutation and the onset of HCM have obvious clinical phenotype and genetic heterogeneity, which means that the pathogenesis of HCM can be different due to different mutation sites of the same myofestival gene, and the disease progress, the disease severity, the prognosis, the recurrence risk and the like of HCM can be different as a result, which are also important reasons for the unsatisfactory clinical treatment effect and the higher mortality of HCM. Therefore, constructing replicable, diversified genetically modified animal or multifunctional stem cell models is an important tool for studying disease mechanisms and drug screening. Chinese patent literature (application number: 201811249586. X) discloses a preparation method and application of a hypertrophic cardiomyopathy mouse model, and the method is used for obtaining the hypertrophic cardiomyopathy mouse model by mutating a T2535G locus of a Mybpc3 gene from a base T to a base G. Chinese patent literature (application number 202010870802.3) discloses an HCM specific induced pluripotent stem cell line carrying a c.3369-3370insC mutation. However, a mouse hypertrophic cardiomyopathy model related to the Mybpc3 gene frameshift mutation c.3636delT is not reported at present.

Mybpc3 is one of the most important pathogenic genes of HCM, and the disease mechanism of the HCM in the occurrence and development processes is not completely clear, and the main reason is the clinical phenotype and genetic heterogeneity generated by the diversity of Mybpc3 gene mutation sites, namely the lack of experimental animal models carrying different mutation sites. Therefore, in order to solve the problem of serious shortage of diversification of Mybpc3 gene modified mice, a novel HCM mouse model of Mybpc3 gene frameshift mutation c.36delT is developed, which has very important scientific value and clinical significance for research of HCM disease mechanism and research and development of targeted drugs.

Disclosure of Invention

The invention aims to provide a construction method and application of a Mybpc3 gene frameshift mutant mouse model. The invention adopts CRISPR/Cas9 gene editing technology to establish the construction method of the Mybpc3 gene frameshift mutant mouse model, which has important application value for researching the mechanism of hypertrophic cardiomyopathy and developing targeted drugs.

In order to achieve the aim of the invention, the invention adopts the following technical scheme:

in a first aspect, the invention provides a gRNA targeting the mouse Mybpc3 gene, the nucleotide sequence of the gRNA comprising:

gRNA-A1 SEQ ID NO.1；

gRNA-B1 SEQ ID NO.2。

SEQ ID NO.1：TCCGAGGTAGTCCTAAGGTAGGG。

SEQ ID NO.2：TGCTGTCCGAGGTAGTCCTAAGG。

in a second aspect, the invention provides a gene editing system targeting the mouse Mybpc3 gene, the gene editing system comprising a gRNA targeting the mouse Mybpc3 gene of the first aspect.

Preferably, the gene editing system further comprises Cas9 mRNA and homologous recombination Donor DNA.

Preferably, the nucleotide sequence of the homologous recombination Donor DNA is shown in SEQ ID NO. 3.

SEQ ID NO.3：

CAAATCGCTCCATCATTGCAGGCTATAATGCCATCCTCTGCTGTGCTGTCCGAGGTA GTCC—AAGGTAGGGACTCAAGGTCCTGGGCTAGACTGACAGGAGGCTGGTCTCCTAG GCTCCTTAT。

Wherein "-" is the target site where mutation is desired.

In the invention, mybpc3 (myosin binding protein C3) gene codes for myocardial myoglobin binding protein C3, and the Mybpc3 gene frame shift mutation (c.3636delT) is positioned on the 32 rd exon of the mouse Mybpc3 gene, namely 3636 rd bit of a protein Coding region (CDS) of Mybpc3 (GenBank No. NM-008653.2) gene.

In a third aspect, the invention provides a method for constructing a mouse model of a Mybpc3 gene frameshift mutation, the method comprising the following steps:

(1) Constructing a gene editing system of the target mouse Mybpc3 gene;

(2) The gene editing system is utilized to carry out gene editing on the fertilized eggs of the mice, the edited fertilized eggs are transplanted into pseudopregnant female mice, the mice are born, F0-generation mice are obtained, positive F0-generation heterozygous mutant mice are screened, and the mice are marked as Mybpc3 ^+/- ，Het；

(3) Mating the positive F0 generation heterozygous mutant mice with wild type mice to obtain F1 generation mice, screening the positive F1 generation heterozygous mutant mice, and marking as Mybpc3 ^+/- ，Het；

(4) Carrying out the specific hybridization of the positive F1 generation heterozygous mutant mice, screening to obtain the F2 generation homozygous mutant mice with stable inheritance, and marking as Mybpc3 ^-/- ，Hom。

In the invention, the steps of constructing a gene editing system of a target mouse Mybpc3 gene comprise:

after the gRNA sequences are respectively connected with PX330 plasmid vectors, escherichia coli JM109 is transformed, positive monoclonal is selected and obtained, and then correct gRNA is selected.

In the invention, the steps of gene editing on the fertilized ovum of the mouse comprise:

the correct gRNA, cas9 mRNA and homologous recombination Donor DNA cocktail was injected into individual fertilized eggs of mice to give post-injection embryos.

Preferably, the donor of the fertilized ovum of the mouse is a C57BL/6N mouse.

Preferably, the positive F0 generation heterozygous mutant mice, the positive F1 generation heterozygous mutant mice and the F2 generation homozygous mutant mice are screened by adopting a method comprising the following steps:

extracting the whole genome of the mouse, carrying out targeted PCR amplification on Mybpc3 gene mutation sites, and carrying out Sanger sequencing verification on PCR products.

Preferably, the whole genome is derived from mouse rat tail tissue and/or myocardial tissue.

Preferably, the nucleotide sequence of the primer for targeting PCR amplification is shown as SEQ ID NO. 4-5.

SEQ ID NO.4 forward 5'-GTGGTATCAGAGCTTATCATTG-3'.

SEQ ID NO.5, reverse 5'-GAACATGCGGAAGCGAGCAT-3'.

In the invention, the reaction system (25 mu L system) of the targeted PCR amplification is as follows: 1.5. Mu.L of mouse genome DNA, 1. Mu.L of forward primer (10. Mu.M), 1. Mu.L of reverse primer (10. Mu.M), 12.5. Mu.L of PCR amplification reaction mixed enzyme (Green Taq Mix) and 9. Mu.L of purified water.

In the invention, the reaction conditions of the targeted PCR amplification are as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95℃for 15 seconds, annealing at 60℃for 15 seconds, extension at 72℃for 1 minute for a total of 35 cycles; extension at 72℃for 5min and preservation of PCR products at 4 ℃.

In a fourth aspect, the invention provides a kit for constructing a mouse model of a Mybpc3 gene frameshift mutation, the kit comprising:

(1) A gRNA of a target mouse Mybpc3 gene, a Cas9 mRNA and a homologous recombination Donor DNA;

(2) Primers for carrying out targeted PCR amplification on the Mybpc3 gene frameshift mutation site;

the nucleotide sequence of the gRNA is shown as SEQ ID NO. 1-2;

the nucleotide sequence of the homologous recombination Donor DNA is shown as SEQ ID NO. 3;

the nucleotide sequence of the primer for targeting PCR amplification is shown as SEQ ID NO. 4-5.

In a fifth aspect, the present invention provides a device for screening a drug for treating and/or preventing hypertrophic cardiomyopathy, wherein the device adopts a mouse model with Mybpc3 gene frameshift mutation for drug screening, and the mouse model is constructed by the method for constructing the mouse model with Mybpc3 gene frameshift mutation in the third aspect and/or the kit for constructing the mouse model with Mybpc3 gene frameshift mutation in the fourth aspect.

In a sixth aspect, the invention provides the application of any one or a combination of at least two of the gRNA of the target mouse Mybpc3 gene, the gene editing system of the target mouse Mybpc3 gene, the construction method of the mouse model of Mybpc3 gene frameshift mutation, the kit for constructing the mouse model of Mybpc3 gene frameshift mutation or the device for screening the medicines for treating and/or preventing hypertrophic cardiomyopathy in the fifth aspect in preparing a hypertrophic cardiomyopathy targeted medicine screening product.

Compared with the prior art, the invention has the following beneficial effects:

the invention uses CRISPR/Cas9 gene editing technology to establish an HCM mouse model of Mybpc3 gene frameshift mutation (c.3636delT) for the first time, and provides a reliable experimental animal model for researching the disease mechanism of Mybpc3 gene mutation in HCM and screening targeted drugs.

Drawings

FIG. 1 is a schematic diagram of the target cleavage design of the frame shift mutation (c.3636delT) of Mybpc3 gene.

FIG. 2 is a sample genome PCR amplified agarose gel electrophoresis of mice; wherein lane M is a DNA molecular weight marker, lanes 1-16 are sample numbers, and the negative is a negative control.

FIG. 3 shows the results of the Sanger sequencing of the mouse genotype at the Mybpc3 gene (c.3636) site.

FIG. 4 is a graph showing heart size and HE staining results for mice of different genotypes having the same heart weight ratio.

FIG. 5 is a statistical analysis of WGA staining and cross-sectional areas of cardiomyocytes from mice of different genotypes.

FIG. 6 is a statistical analysis of relative expression levels of mRNA of mice with different genotypes of cardiac hypertrophy markers (ANP, BNP, and beta-MHC).

FIG. 7 is a graph showing the ultrastructural view of myocardial tissue of mice of different genotypes.

FIG. 8 is a graph showing that mutant mice show lower Mybpc3 gene expression levels compared to wild-type mice.

Detailed Description

The technical scheme of the invention is further described by the following specific embodiments. It will be apparent to those skilled in the art that the examples are merely to aid in understanding the invention and are not to be construed as a specific limitation thereof.

The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents, strains, plasmid vectors or instruments used were not manufacturer-specific and were conventional products commercially available through regular channels.

The animal experiments in the examples described below were reviewed and approved by the university laboratory animal ethics committee (approval paper: 2022-P2-43).

The Mybpc3 gene frameshift mutation (c.3636delt) in the following examples is located on exon 32 of the mouse Mybpc3 gene, namely, 3636 th site of the protein Coding region (CDS) of the Mybpc3 (GenBank identifier: nm_ 008653.2) gene. The c.3636 locus of the Mybpc3 gene of the wild mouse is a base T, and the c.3636 locus of the Mybpc3 gene of the mutant mouse lacks the base T.

Example 1

This example provides a gRNA targeting the mouse Mybpc3 gene, the nucleotide sequence of which includes:

gRNA-A1 SEQ ID NO.1；

gRNA-B1 SEQ ID NO.2。

SEQ ID NO.1：TCCGAGGTAGTCCTAAGGTAGGG。

SEQ ID NO.2：TGCTGTCCGAGGTAGTCCTAAGG。

the nucleotide sequence of the gRNA was synthesized by the company Kirschner Biotech Co.

Example 2

The present embodiment provides a gene editing system targeting the mouse Mybpc3 gene, comprising the gRNA targeting the mouse Mybpc3 gene of embodiment 1, and further comprising Cas9 mRNA and homologous recombination Donor DNA. The nucleotide sequence of the homologous recombination Donor DNA is shown as SEQ ID NO. 3.

SEQ ID NO.3：

CAAATCGCTCCATCATTGCAGGCTATAATGCCATCCTCTGCTGTGCTGTCCGAGGTAGTCC—AAGGTAGGGACTCAAGGTCCTGGGCTAGACTGACAGGAGGCTGGTCTCCTAGGCTCCTTAT。

Wherein "-" is the target site where mutation is desired. The nucleotide sequence of Donor was synthesized by the company of Kinsrui Biotech Co.

Example 3

The embodiment constructs a mouse model of Mybpc3 gene frameshift mutation (c.3636delT) based on CRISPR/Cas9 technology, and the construction steps comprise:

(1) Design of target mouse Mybpc3 gene gRNA

Mybpc3 gene editing mouse strategies were designed as shown in FIG. 1. According to the strategy, the corresponding gRNA was designed at the corresponding position of exon 32 (E32) of Mybpc3 via an online website (http:// crispor. Tefor. Net /). Scoring according to the crisprter system gRNA: low efficiency (score < 0.56), medium efficiency (0.56 < = score < 0.74), high efficiency (score > = 0.74). The gRNA with high cutting efficiency and good specificity is screened out, and synthesized by Kirschner Biotechnology Co., ltd, and the DNA sequence before transcription corresponding to the gRNA comprises a nucleotide sequence shown as SEQ ID NO.1 or SEQ ID NO.2, and is specifically shown as table 1.

TABLE 1

gRNA name	gRNA sequence	PAM sequence
			gRNA-A1	SEQ ID NO.1：TCCGAGGTAGTCCTAAGGTAGGG	GGG
gRNA-B1	SEQ ID NO.2：TGCTGTCCGAGGTAGTCCTAAGG	AGG

(2) Donor Oligo sequence design

Based on the gRNA sequence, a homologous recombination Donor sequence is designed, and the designed Donor sequence is specifically as follows:

SEQ ID NO.3：

wherein "-" is the target site where mutation is desired. The Donor sequence was synthesized by the Kirschner Biotech Co.

(3) gRNA vector construction and in vitro transcription

The single-stranded gRNA of SEQ ID NO.1 and SEQ ID NO.2 and the complementary strand thereof are synthesized artificially (Kirschner Biotech Co., ltd.) and a designed BbsI cleavage site is added to facilitate cleavage ligation into the PX330 plasmid vector. The gRNA added with the cleavage site and the complementary strand sequence (excluding the PAM sequence) are shown in Table 2, and were synthesized by Perkins Biotechnology Co., ltd.

TABLE 2

gRNA name	gRNA sequence	Sequence name
			gRNA-A1-F	CACCGTCCGAGGTAGTCCTAAGGTA	SEQ ID NO.6
gRNA-A1-R	AAACTACCTTAGGACTACCTCGGAC	SEQ ID NO.7
			sgRNA-B1-F	CACCGTGCTGTCCGAGGTAGTCCTA	SEQ ID NO.8
sgRNA-B1-R	AAACTAGGACTACCTCGGACAGCAC	SEQ ID NO.9

gRNA-A1-F and gRNA-A1-R were annealed to give double strand gRNA-A1.

The gRNA-B1-F and the gRNA-B1-R were annealed to give double-stranded gRNA-B1.

After ligating the linearized PX330 plasmid vector (available from addgene corporation) with the gRNA double-stranded sequence via T4 DNA ligase (available from TaKaRa corporation), escherichia coli JM109 was transformed and incubated overnight at 37 ℃. Selecting monoclonal, and carrying out enzyme digestion, identification and screening of correct gRNA vector.

In vitro amplification was performed using PX330-gRNA as a template and PCR primers, the sequences of which are shown in Table 3, were synthesized by Kirschner Biotechnology Co., ltd.

TABLE 3 Table 3

After amplification by PCR, the in vitro transcription template for the gRNA was obtained. Subsequently using in vitro transcription kit MEGAShortscript ^TM T7 Transcription Kit (from Thermo Fisher Scientific company) transcribes gRNA in vitro to obtain gRNA (including gRNA-A1 and gRNA-B1) transcribed in vitro, and the gRNA is stored in a refrigerator at 80 ℃ for later use.

(4) Microinjection and embryo transfer

Selecting 6-8 week old female mice, and intraperitoneally injecting 5 International Units (IU) of pregnant horses for promoting sexual activityAdenohormone (PMSG), 5IU of human chorionic gonadotrophin (hCG) was injected approximately 46-48 hours apart, and hCG female mice were given a cage with single-placed mature male mice. The next day, the mice with the thrombus were taken out, after disinfection, the mice were euthanized, oviducts were separated, and the oviduct was placed in M2 medium prepared in advance, so that fertilized eggs slowly flowed out. The washed fertilized eggs were then transferred to a medium containing M16 droplets at 37℃and 5% CO ₂ And (5) placing the mixture in an incubator for standby. Mixing the gRNA transcribed in the step (3) in vitro with Cas9 mRNA (purchased from NEB company) and homologous recombination Donor DNA to obtain injection, sucking 5 mu L of injection liquid by a micropipette to fill the injection liquid into the needle point of the injection needle, and continuously pushing the injection needle by adjusting the fixing needle of a micromanipulator and the direction of the injection needle to ensure that the needle point of the injection needle and the pronucleus of the fertilized ovum of the mouse are positioned on the same horizontal plane, so that the injection needle penetrates through a transparent belt and enters the pronucleus. When prokaryotic expansion is observed, successful injection is indicated. After the injection is finished, transferring fertilized egg cells into M16 embryo culture solution, and placing into 37 ℃ and 5% CO ₂ After 6h of culture in the incubator, the active embryos are transplanted into the oviduct of the surrogate mother. F0 mice were obtained 19-21 days after implantation.

Exogenous gRNA-A1 or gRNA-B1 and Cas9 mRNA can cut DNA near c.3636 site of mouse Mybpc3 gene at fixed point, then integrate homologous recombination Donor to the cut site randomly through DNA repair process, finally the constructed Mybpc3 gene of mouse genome DNA has frame shift mutation of c.3636 site deletion base T.

Example 4

Molecular identification of Mybpc3 Gene frameshift mutant (c.3636delT) knockout mice

(1) Extraction of genomic DNA

Tail cutting is carried out on the weaned mice, and a rat tail tissue sample is obtained. The whole genome was extracted using a commercial minigenome extraction kit (available from Axygen corporation) and subjected to agarose gel electrophoresis, and the concentration and OD values were determined, with OD260/280 between 1.8 and 2.0 being available, while wild-type mice were used as controls.

(2) PCR amplification

PCR amplification primers including target sites were designed by goldThe nucleotide sequence shown in SEQ ID NO.4 or SEQ ID NO.5 is synthesized by the Style biotechnology Co., ltd., calculated amplification length: wild type mouse (Mybpc 3) ^+/+ WT) is 665bp, heterozygous mutant mice (Mybpc 3) ^+/- Het) is 665/664bp, homozygous mutant mice (Mybpc 3) ^-/- Hom) was 664bp, and the specific primer sequences are shown in Table 4.

TABLE 4 Table 4

Primer name	Primer sequence (5 '-3')
		SEQ ID NO.4	Forward direction: GTGGTATCAGAGCTTATCATTG
SEQ ID NO.5	Reversing: GAACATGCGGAAGCGAGCAT

The genome of the step (1) is used as a template for PCR amplification, and a specific reaction system of PCR is shown in Table 5.

TABLE 5

The reaction conditions for PCR amplification are shown in Table 6.

TABLE 6

And (3) performing amplification by using sterile water as a template as a negative control, and performing agarose gel electrophoresis after the PCR amplification reaction is completed, wherein the electrophoresis result is shown in fig. 2, and the size of the target fragment is consistent with the expected size, which indicates that the PCR primer works normally. It was then purified using agarose gel DNA purification kit (purchased from Invitrogen company) and stored at 4 ℃.

(3) Mouse genotype Sanger sequencing identification

Because the difference between wild type and mutant mice cannot be identified by PCR amplification, the PCR product obtained in the step (2) is sent to Shanghai JieRui bioengineering Co., ltd for Sanger sequencing as gold standard, and F0 generation heterozygote (Mybpc 3 is determined ^+/- Het) genetically mutated mice.

And (3) breeding the obtained positive F0 generation sexually mature gene mutant mice with C57BL/6N wild mice respectively to obtain F1 generation mice.

Further breeding F1 generation of mice to obtain F2 generation of mice, and screening Sanger sequencing to obtain stable genetic homozygote (Mybpc 3) ^-/- Hom) mutant mice.

For wild type mice (Mybpc 3) ^+/+ WT), heterozygous mutant mice (Mybpc 3 ^+/- Het) and homozygous mutant mice (Mybpc 3 ^-/- Hom) were subjected to Sanger sequencing assays and the results are shown in figure 3. From the sequencing peak diagram, it can be seen that: wild type mouse (Mybpc 3) ^+/+ WT) both homologous chromosomes are base T at position c.3636; heterozygous mutant mice (Mybpc 3) ^+/- Het) wherein one homologous chromosome c.3636 is a base T and the other homologous chromosome c.3636 is deleted of a base T, resulting in the forward shift of the subsequent base A. Thus, heterozygous mutant mice (Mybpc 3 ^+/- Position c.3636 of Het) shows the base T or a; homozygous mutant mice (Mybpc 3) ^+/- Het) the base T is deleted at position c.3636 on both homologous chromosomes.

Example 5

Phenotypic identification of Mybpc3 Gene frameshift mutant (c.3636delT) knockout mice

(1) Comparison of cardiac tissue cell levels

Weight and age closely related sexually mature wild-type mice (Mybpc 3) were selected for sequencing to determine genotype ^+/+ ，WT) Heterozygous mutant mice (Mybpc 3) ^+/- Het) and homozygous mutant mice (Mybpc 3 ^-/- Hom), after anesthesia, the dissected mice were removed and weighed, and the skin at the tibia of the hind limb of the mice was cut off, and the tibia length was measured and recorded. The heart weight/tibia length ratio, heart/weight ratio were compared and a mouse heart pathology hematoxylin-eosin staining (HE) stain was made. As shown in fig. 4, relative to the wild type (Mybpc 3 ^+/+ WT) mice, heterozygous mutations (Mybpc 3 ^+/- Het) and homozygous mutation (Mybpc 3 ^-/- Hom) mice had enlarged hearts, thickened myocardial walls or ventricular septum, and exhibited the major pathological features of HCM. Furthermore, heterozygous mutations (Mybpc 3 were also observed ^+/- Het) and homozygous mutation (Mybpc 3 ^-/- Hom) mice exhibited significant disorder of sarcomere alignment with myocardial cell enlargement.

Further, one of the pathological features of HCM is myocardial hypertrophy, and cellular levels manifest as myocardial cell hypertrophy. Myocardial tissue cell cross-sectional area (CSA) size was assessed by wheat germ lectin (WGA) staining. As shown in FIG. 5, compared to the wild type (Mybpc 3 ^+/+ WT) mice, heterozygous mutant (Mybpc 3) ^+/- Het) and homozygous mutant (Mybpc 3 ^-/- Hom) increase in the cross-sectional area of mouse cardiomyocytes, in particular homozygous mutant mice, was more pronounced (P is shown in the figure)<0.05; * Represents P<0.01; * Represents P<0.001)。

(2) Detection of marker molecules for myocardial hypertrophy

After PCR primer design was performed on cardiac markers of cardiac hypertrophy such as cardiac natriuretic peptide (ANP), brain Natriuretic Peptide (BNP), and myosin heavy chain protein beta (beta-MHC) and reference gene GAPDH, the primers were synthesized by Shanghai JieRui bioengineering Co., ltd, and are shown in Table 7.

TABLE 7

Real-time PCR amplification was performed and the PCR reaction system is shown in Table 8.

TABLE 8

The reaction conditions for performing Real-time PCR are shown in Table 9.

TABLE 9

Ct value of the sample was measured according to StepOne Software v 2.2.2 software, according to 2 ^-ΔΔCt The calculation method calculates the corresponding expression quantity F.

Wild-type mice (Mybpc 3) were subjected to Real-time PCR technique ^+/+ WT), heterozygous mutant mice (Mybpc 3 ^+/- Het) and homozygous mutant mice (Mybpc 3 ^-/- Hom) mRNA expression levels of cardiac hypertrophy markers ANP, BNP, and β -MHC were quantitatively analyzed. The results are shown in FIG. 6, compared to the wild type (Mybpc 3 ^+/+ WT) mouse myocardial tissue, heterozygous mutant (Mybpc 3) ^+/- Het) and homozygous mutant (Mybpc 3 ^-/- Hom) mice showed a significant increase in mRNA expression levels of the cardiac hypertrophy markers ANP, BNP and β -MHC (P is shown in the figure)<0.05; * Represents P<0.01; * Represents P<0.001)。

Example 6

Myocardial cell subcellular structure observation of Mybpc3 gene frameshift mutant (c.3636delT) knockout mice.

(1) Sampling and fixing

After the mice with different genotypes are anesthetized, the left ventricle of the mice is cut into volumes with the length, width and height of 1mm multiplied by 1mm, and the mice are rinsed with 0.1M phosphoric acid after being fixed by an electron microscope tissue fixing solution.

(2) Dewatering

And (2) placing the myocardial tissue samples fixed in the step (1) in 50%, 70% and 90% ethanol for about 15min each in sequence at 4 ℃, soaking in 90% ethanol and 90% acetone (1:1) for 15min, and finally soaking in 90% acetone for 15min. The mixture was washed with 100% acetone at room temperature for 15min/3 times.

(3) Embedding and curing

Embedding the myocardial tissue dehydrated in the step (2) with embedding liquid at room temperature for 3 hours, and then placing the tissue in a baking oven at 37 ℃ for baking overnight; then baking for half a day at 45 ℃; and finally baking in a baking oven at 60 ℃ for 24 hours.

(4) Slice and view

And (3) slicing the cured myocardial tissue in the step (3) by using an LKB-1 type ultrathin microtome, and observing and collecting pictures under an electron microscope. As shown in FIG. 7, the wild type mouse (Mybpc 3) ^+/+ WT) the myocardial ultrastructure shows a regular arrangement of sarcomere tissue and mitochondria are arranged in an oval beaded shape. Whereas heterozygous mutant (Mybpc 3) ^+/- Het) and homozygous mutant (Mybpc 3 ^-/- Hom) mice exhibited reduced myofibril content, disturbed myofilament alignment, variable length of muscle segments, and partial fracture; mitochondrial alignment disorder, partial swelling denaturation, widening of the cristae, or disappearance of the break, presence of autophagosomes around or within.

Example 7

Changes in Mybpc3 Gene frameshift mutation (c.3636delT) Gene knockout mouse Mybpc3 protein levels

(1) Myocardial tissue protein extraction

After the mice with different genotypes are anesthetized, the myocardial tissues of the mice are taken, the myocardial tissues are sheared into small fragments by tissue shears, the probe of the ultrasonic homogenizer is put into a centrifuge tube and fully crushed until no obvious particles are generated (the whole process is carried out on ice, and the tissue is prevented from being degraded by heated protein). The tissue homogenate was then allowed to stand on ice for 15min and then transferred to a1.5 mL centrifuge tube for centrifugation for 10min at 13000r/min. The supernatant was transferred to a new centrifuge tube and centrifuged again for 15min. Transferring the supernatant to another centrifuge tube for preservation, and avoiding sucking sediment below. Finally, after the protein concentration is measured by a conventional BCA method, the protein is denatured at 100 ℃ for 10min, and then the protein is stored in a refrigerator at-80 ℃ for standby.

(2) Western blotting experiment

Referring to a conventional operation method of protein electrophoresis, after finishing the protein electrophoresis and membrane transfer experiment process through the processes of gel preparation, protein sample loading, electrophoresis, PVDF membrane transfer and the like, adding a Mybpc3 primary antibody diluent (dilution ratio 1:1000) prepared in advance for incubation overnight. After the primary antibody is recovered the next day, the membrane is washed 3 times by using TBST buffer solution, and finally HRP-labeled secondary antibody diluent (dilution ratio 1:10000) is added, and the secondary antibody incubation time is 2h. After the incubation of the antibody is finished, the membrane is cleaned by TBST buffer solution for 3 times for 5min each time, ECL luminescence working solution (the ratio of A solution to B solution is 1:1) is dripped, a strip is displayed under a developing instrument, photographing is carried out, and the grey value is measured and calculated by Image J software.

(3) Analysis of Mybpc3 protein expression level results

Western blotting experiment results show that: compared with wild type mice (Mybpc 3) ^+/+ WT), heterozygous mutant mice (Mybpc 3) ^+/- Het) Mybpc3 gene protein expression was reduced, approximately 50% of wild type. While homozygous mutant mice (Mybpc 3) ^-/- Hom) Mybpc3 gene protein was not expressed as shown in fig. 8 (wherein P is represented by:<0.001). Mybpc3 protein experiments demonstrated that heterozygous mutant (Mybpc 3 ^+/- Het) and homozygous mutant (Mybpc 3) ^-/- Hom) mouse Mybpc3 protein was degraded.

From the above, the analysis of the results of the examples shows that the invention constructs Mybpc3 gene frameshift mutant (c.3636delT) mice for the first time, the genetically mutant mice show HCM related morphological characteristics such as heart enlargement, cardiac myocyte hypertrophy, cardiac myocyte structural abnormality and the like, and simultaneously the mRNA level expression of the marker related to cardiac hypertrophy of the mutant mice is increased and Mybpc3 protein is degraded. Therefore, the model can be used as an experimental animal model for research on the disease mechanism of HCM and/or screening of targeted drugs.

The applicant declares that the above is only a specific embodiment of the present invention, but the scope of the present invention is not limited thereto, and it should be apparent to those skilled in the art that any changes or substitutions that are easily conceivable within the technical scope of the present invention disclosed by the present invention fall within the scope of the present invention and the disclosure.

Claims

1. A gRNA targeting the mouse Mybpc3 gene, wherein the nucleotide sequence of the gRNA comprises:

gRNA-A1 SEQ ID NO.1；

gRNA-B1 SEQ ID NO.2。

2. a gene editing system targeting the mouse Mybpc3 gene, wherein the gene editing system comprises the gRNA of claim 1 that targets the mouse Mybpc3 gene.

3. The gene editing system targeting the mouse Mybpc3 gene of claim 2, further comprising Cas9 mRNA and homologous recombination Donor DNA;

4. A method for constructing a mouse model of a Mybpc3 gene frameshift mutation, which is characterized by comprising the following steps:

(1) Constructing a gene editing system of the targeted mouse Mybpc3 gene of claim 2 or 3;

5. The method of claim 4, wherein the donor of the fertilized mouse egg is a C57BL/6N mouse.

6. The method for constructing a mouse model of Mybpc3 gene frameshift mutation according to claim 4 or 5, wherein the positive F0 generation heterozygous mutant mouse, the positive F1 generation heterozygous mutant mouse and the F2 generation homozygous mutant mouse are selected by a method comprising the steps of:

7. The method of claim 6, wherein the whole genome is derived from mouse rat tail tissue and/or myocardial tissue;

8. A kit for constructing a mouse model of Mybpc3 gene frameshift mutation, comprising:

(2) Primers for carrying out targeted PCR amplification on Mybpc3 gene mutation sites;

the nucleotide sequence of the gRNA is shown as SEQ ID NO. 1-2;

9. A device for screening a drug for treating and/or preventing hypertrophic cardiomyopathy, which is characterized in that the device performs drug screening by using a mouse model of Mybpc3 gene frameshift mutation, which is constructed by the method for constructing a mouse model of Mybpc3 gene frameshift mutation according to any one of claims 4 to 7 and/or the kit for constructing a mouse model of Mybpc3 gene frameshift mutation according to claim 8.

10. Use of any one or a combination of at least two of the gRNA targeting the mouse Mybpc3 gene of claim 1, the gene editing system targeting the mouse Mybpc3 gene of claim 2 or 3, the method of constructing a mouse model of Mybpc3 gene frameshift mutation of any one of claims 4 to 7, the kit of constructing a mouse model of Mybpc3 gene frameshift mutation of claim 8, or the device of claim 9 for screening a medicament for the treatment and/or prevention of hypertrophic cardiomyopathy in the preparation of a hypertrophic cardiomyopathy targeted medicament screening product.