CN108330130B - sgRNA, Gal antigen-deleted rabbit model prepared from sgRNA and application of sgRNA - Google Patents
sgRNA, Gal antigen-deleted rabbit model prepared from sgRNA and application of sgRNA Download PDFInfo
- Publication number
- CN108330130B CN108330130B CN201810207719.0A CN201810207719A CN108330130B CN 108330130 B CN108330130 B CN 108330130B CN 201810207719 A CN201810207719 A CN 201810207719A CN 108330130 B CN108330130 B CN 108330130B
- Authority
- CN
- China
- Prior art keywords
- sgrna
- seq
- rabbit
- recognition sequence
- gal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/027—New breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
- A01K67/0276—Knockout animals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/107—Rabbit
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/02—Animal zootechnically ameliorated
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
Abstract
The invention relates toAn sgRNA, a Gal antigen-deleted rabbit model prepared from the sgRNA and application of the sgRNA, and belongs to the technical field of animal model establishment. The sgRNA is specific to rabbit species GGTA gene, and the genome number of the sgRNA is LOC100348435, and the positive strand and the complementary strand of the 8 th exon meet (N)20And respectively designing the obtained recognition sequences of sequence parts of the AGG sequence mode, wherein the sgRNAs are respectively marked as a first sgRNA recognition sequence and a second sgRNA recognition sequence. The Gal antigen deletion rabbit model prepared by the Cas9-GGTA/sgRNA has the advantages that homozygotes lose the expression capacity of Gal antigens, and have similar expression tendency of anti-Gal antibodies with a human body; therefore, the Gal antigen deletion rabbit model can be used for immunological research of animal-derived biomaterials, animal tissues, organs and derivatives thereof, host implantation reaction evaluation of animal-derived medical products, calcification test research of animal-derived membrane biomaterials and effectiveness evaluation of implanted animal-derived biomaterial medical products.
Description
Technical Field
The invention relates to the technical field of animal model establishment, in particular to sgRNA, a Gal antigen deletion rabbit model prepared from the sgRNA and application of the sgRNA.
Background
It has been shown that the xenoantigen alpha-galactosyl antigen (alpha-1, 3-galactosyle, alpha-Gal, i.e., Gal antigen) is the main target antigen in animal-derived biomaterials or in hyperacute immune rejection reactions in xenotransplantation. Gal antigen is a cell surface secretory glycoprotein or glycolipid containing a core terminal residue of polylactosamine, and is widely present in lower animals such as pigs and rabbits. Gal antigens are mainly regulated by alpha-1, 3 galactosyltransferases ( alpha 1, 3 galactosyltransferases, alpha-1, 3GT, or GGTA 1). Since galactosyltransferase genes of human bodies, simians and old monkeys have 2-base mismutation and do not express Gal antigens, but human serum contains high-titer anti-Gal antibodies (accounting for 1-5% of total serum globulin), when a human body receives biological materials containing Gal antigens or xenogeneic organ transplantation, hyperacute immune rejection and chronic immune toxicity are caused.
In the early 90 s internationally, the GGTA1 knockout mice were constructed to study the immunological reaction related to Gal antigen, and the construction method and feasibility of cloned animals without Gal antigen were discussed. In 1996, RG Tearle et al reported a successful approach to the GGTA1 knockout mouse model. It was then reported that the similarity to human induced antibodies and their immunological features were studied using the GGTA1 knockout mouse model. These studies suggest that the GGTA1 knockout mouse model is sensitive to immune toxicity induced by Gal antigen residues. In the early 2000, researchers began to study GGTA1 knockout pigs, and even GGTA1 knockout cattle, it was expected that tissues or organs without Gal antigen could be obtained directly from GGTA1 knockout pigs or cattle to avoid immunological rejection reaction of animal-derived biomaterials and xenogeneic organ transplantation.
However, there is no report of successful preparation of rabbit with GGTA1 gene knockout, and there is a need for rabbit model with Gal antigen deletion with GGTA1 gene knockout, which can be used for the immunological research of xenogeneic tissue/organ transplantation of pig, cow, etc., animal-derived biomaterials, animal tissues, organs and their derivatives.
Disclosure of Invention
In view of the above, there is a need to provide a sgRNA, a Gal antigen-deficient rabbit model prepared from the sgRNA, and applications of the sgRNA, and the Gal antigen-deficient rabbit model, which can be used for xenotransplantation of pig, cow, and the like, and immunological studies on animal-derived biomaterials, animal tissues, organs, and derivatives thereof; can be used as a human body implantation reaction test model of animal-derived biological materials/medical products and an effectiveness evaluation model for tissue regeneration, repair and reconstruction after implantation; can be used for calcification test research of membrane animal-derived biological materials/medical products.
An sgRNA for preparing a Gal antigen-deficient rabbit model, the sgRNA satisfying (N) on a plus chain and a complementary chain of the 8 th exon of the rabbit species genome number LOC10034843520Respectively designing the obtained recognition sequences of sequence parts of the AGG sequence mode, and respectively recording the sgRNAs as first sgRNA recognition sequencesColumns and a second sgRNA recognition sequence; wherein the first sgRNA recognition sequence is complementary to the 8 th exon on the strand (N)20AGG identity, the second sgRNA recognition sequence being in direct strand (N) with the 8 th exon20AGG are identical, N is A, T, C or G, and the subscript 20 indicates the number of N.
The selection and design of the target sequence are the key to the success of the target, aiming at the GGTA1 functional region of rabbit species, the inventor compares and screens a large amount of information, by analyzing the coding sequence of the rabbit species genome number LOC100348435, which comprises 8 exons such as Exon1:16-286(271bp), Exon2:34958-35072(115bp), Exon3:41258-41346(89bp), Exon4:48906-48941(36bp), Exon5:51613-51678(66bp), Exon6:52163-52279(117bp), Exon7:59218-59355(138bp), Exon8:63151-63844(694bp), finally selecting the 8 th Exon with 694bp as the GGTA1 functional region of the rabbit, screening the rabbit with inactivated GGTA1 function from the genetically manipulated rabbit through subsequent targeting, it was confirmed that the CDS region of exon8 of the rabbit GGTA1 gene is indeed the functional region of rabbit GGTA 1. It will be appreciated that the above Rabbit species is preferably, but not limited to, New Zealand White Rabbit (Latin name: New Zealand White Rabbit, NZWR).
In one embodiment, the first sgRNA recognition sequence is set forth in SEQ ID No.1, and the second sgRNA recognition sequence is set forth in SEQ ID No. 2. It can be understood that, in order to achieve the purpose of knocking out GGTA1 gene of rabbit species, a proper targeting sequence can be selected according to the requirements of CRISPR/Cas9 technology, but the sequences of SEQ ID No.1 and SEQ ID No.2 are selected, so that the targeting effect is good.
The invention also discloses a preparation method of the Gal antigen deletion rabbit model, which comprises the following steps:
construction of sgRNA vector: synthesizing an oligonucleotide chain according to the sgRNA, connecting the obtained double-stranded DNA into a pUC57-T7-sgRNA vector recovered by Bbs I enzyme digestion to obtain a pUC57-T7-sgRNA recombinant vector, and amplifying the recombinant vector;
transcription: transcribing and purifying the amplified PCR product of the recombinant vector to obtain synthesized sgRNA1 corresponding to the first sgRNA recognition sequence and synthesized sgRNA2 corresponding to the second sgRNA recognition sequence for later use;
and (3) injecting blastocysts: performing blastocyst injection on an embryo by using a Cas9sgRNA system consisting of Cas9mRNA and sgRNA in a cytoplasm injection mode;
embryo transplantation: and transplanting the injected embryo into an egg duct of a receptor rabbit for feeding.
In one embodiment, in the sgRNA vector construction step, the synthetic oligonucleotide strand sequences for the first sgRNA recognition sequence are shown in SEQ ID nos. 3 and 4, and the synthetic oligonucleotide strand sequences for the second sgRNA recognition sequence are shown in SEQ ID nos. 5 and 6; the oligonucleotides are annealed to synthesize double-stranded DNA.
In one example, in the transcription step, the PCR product of the recombinant vector was transcribed with MAXIscript T7 kit, amplified with T7 primer, and purified with miRNeasy Mini kit; the T7 primer sequence is shown in SEQ ID No.8 and SEQ ID No. 9.
In one embodiment, in the blastocyst injection step, the Cas9mRNA is obtained by: after the 3 XFLAG-NLS-SpCas 9-NLS vector is linearized by Not1, the transcription is carried out by using an mMessage mMachine SP6 reagent, and the DNA fragment is obtained. Preferably, it can be purified again using the RNeasy Mini kit.
In one embodiment, in the blastocyst injection step, the Cas9sgRNA system uses Cas9mRNA and sgRNA at a concentration ratio of 4-6: 1. Wherein the using concentration of the Cas9mRNA is preferably 150-250 ng/mu l, and the using concentration of the sgRNA is preferably 20-60 ng/mu l.
The invention also discloses the Gal antigen deletion rabbit model prepared by the preparation method of the Gal antigen deletion rabbit model. The model rabbit is homozygote with double-sided chromosome GGTA1 gene deleted.
The invention also discloses sperm, egg cells, fertilized eggs, embryos, filial generations, tissues or cells of the Gal antigen-deficient rabbit model animal.
The invention also discloses application of the Gal antigen-deficient rabbit model in xenotransplantation of tissues, immunological research of animal-derived biomaterials, human body implantation reaction test model of animal-derived biomaterials, evaluation model of tissue regeneration, repair and reconstruction after human body implantation of animal-derived biomaterials and/or calcification test research of membrane animal-derived biomaterials. Such xenogeneic species include, but are not limited to, swine, cattle, etc., i.e., tissues including organs, etc.
Compared with the prior art, the invention has the following beneficial effects:
the sgRNA for preparing the Gal antigen deletion rabbit model and the Gal antigen deletion rabbit model prepared by the invention are homozygote rabbits with double-sided chromosome GGTA1 genes removed by adopting a CRISPR/Cas9 targeting technology. The rabbit homozygote with the GGTA1 gene knockout loses the expression capacity of Gal antigen, and has similar expression tendency of anti-Gal antibody with a human body; therefore, the Gal antigen deletion rabbit model can be used for the xenogeneic tissue/organ transplantation of pigs, cows and the like and the immunological research of animal-derived biomaterials, animal tissues, organs and derivatives thereof; a human body implantation reaction test model of animal-derived biological materials/medical products and an effectiveness evaluation model of tissue regeneration, repair and reconstruction after implantation; the research on calcification test of membrane animal-derived biological materials/medical products, etc., has wide application and profound application prospect.
Drawings
FIG. 1 is a schematic diagram showing the comparison of the CDS sequences of the functional regions of the rabbit and mouse GGTA genes in the example;
FIG. 2 is a schematic diagram of gene targeting;
FIG. 3 is a schematic diagram of the identification of the mutation of the baby rabbit GGTA1 gene by T-clone and Sanger sequencing in the example.
Wherein: the target sites for the two sgrnas are underlined, the PAM region is bold in italics, the missing base is (-) and the added base is indicated by a double arrow.
Detailed Description
To facilitate an understanding of the invention, the invention will now be described more fully with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
The reagents used in the following examples are commercially available unless otherwise specified. PCR amplification or transcription in the following examples is performed in a conventional manner unless otherwise specified.
Examples
A Gal antigen deletion rabbit model is prepared by the following steps:
firstly, sgRNA vector construction.
1. Functional regions of the rabbit Gal antigen regulatory gene GGTA1 were determined.
Aiming at the GGTA1 functional region of rabbit species, the inventor searches for rabbit GGTA1 gene information through NCBI website to obtain the splicing sequence (gene ID: LOC100348435, English name: N-acetyl amino acid alpha-1, 3-galactosyl transfer as) of the computer automatic analysis gene prediction method (Gnomon), analyzes the coding sequence of the rabbit species genome number LOC100348435 by a large amount of information comparison and screening, comprises Exon1:16-286, Exon2:34958 35072, Exon3:41258 41346, Exon4:48906-48941, Exon5:51613-51678, Exon4: 52163-279, Exon7:59218-59355, Exon8: 63151-844 and the like 8 exons, finally selects the full-length of the SEQ ID NO. 8: 58483 as the functional region of the mouse matched with the rabbit GGTA equivalent (GGTA) and finally selects the SEQ ID NO.7 as the high-position region matched with the rabbit GGTA 99 region (GGTA 8,589, SEQ ID NO. 9), as shown in fig. 1.
The following is the CDS (coding region) sequence (694bp) of the rabbit GGTA1 gene functional region shown in SEQ ID No. 7: 8 th exon gene sequence:
the selected targeting sequence is underlined in italics, with sgRNA1
Is 92 minutes, sgRNA2
A score of 84, high score helps predict targeting success.
2. Designing a targeting sequence sgRNA.
The schematic diagram of gene targeting based on the sgRNA design is shown in fig. 2; through comparative analysis, 2 sequences of the targeting sequence in the GGTA1 functional region (within exon 8) were selected, and the sgRNA recognition sequences and the oligonucleotide chains are shown in Table 1.
Table 1 sgRNA design sequences
3. sgRNA vector construction
In this example, the two complementary targeting sequence DNA oligonucleotides designed above were annealed at 95 ℃ for 5 minutes to synthesize double-stranded DNA; cloning the double-stranded DNA into a pUC57-T7 expression vector (gene ID 51306) recovered by Bbs I enzyme digestion; the recombinant vector (pUC57-T7-GGTA1/sgRNA) was subsequently amplified with the following T7 primer;
T7-F:5`-GAAATTAATACGACTCACTATA-3`(SEQ ID No.8)
T7-R:5`-AAAAAAAGCACCGACTCGGTGCCAC-3`(SEQ ID No.9)
secondly, transcription.
After obtaining a recombinant vector (pUC57-T7-GGTA1/sgRNA) for in vitro transcription by the above steps, the vector was amplified with MAXiScriptTMT7 kit (commercially available, Ambion) pairThe PCR product of Puc57-T7-GGTA1/gRNA was transcribed and purified using miRNeasy Mini kit (commercially available, Qiagen) to give synthetic GGTA/sgRNA1 and GGTA/sgRNA 2.
And thirdly, injecting blastocysts.
1. And (3) injecting follicle stimulating hormone (FSH, 50IU) into female New Zealand white rabbits of 6-8 months for promoting superovulation, wherein the injection is performed once every 12 hours for 3 days continuously. After the last injection, the male rabbits were housed and injected with 100IU human chorionic gonadotropin (hCG), female pregnant rabbits were euthanized at 18 hours, and the oviducts were flushed with DPBS-BAS to collect fertilized eggs. The embryo at the prokaryotic stage is cultured in oocyte culture fluid.
2. Blastocyst injections were performed using Cas9 at 200 ng/. mu.L and GGTA1/sgRNA mRNAs at 40 ng/. mu.L, according to the conventional cytoplasmic injection method.
3. Cas9-GGTA1/sgRNA mRNA-injected embryos were transferred to EBSS medium at 38.5 ℃ with 5% CO2Short-term cultivation was carried out under 100% humidity conditions.
And fourthly, embryo transplantation.
1. 224 embryos injected with Cas9-GGTA1/sgRNA mRNA were transplanted into 4 recipient rabbit oviducts (see table 2 for embryo transfer) and were routinely raised.
TABLE 2 GGTA knockout rabbit embryo transplantation
# Note: in 1 out of 4 rabbits, the reason for this analysis was probably that the recipient did not achieve good estrus synchronization.
2. After checking that the gene-treated embryo injected by 3 rabbits is successfully implanted and pregnant, 15 newborn rabbits are born after conventional breeding.
Fifth, identification of new-born rabbit genotype
1. According to the CDS sequence of the rabbit GGTA1 gene functional region in the figure 1, the following amplification primers are designed to identify the genotype of the newborn rabbit:
F:TGGAGGAGTTCATAACATCTGC；(SEQ ID No.10)
R:TGCTGGGATTATCATATAGGCCT。(SEQ ID No.11)
2. and (4) carrying out an experimental process.
Extracting DNA from ear marginal tissue of newborn rabbit (TIAAMamp Genomic DNA kit), purifying after PCR amplification, carrying out heat denaturation and annealing on NEBuffer 2(NEB, USA), and digesting a hybridization PCR product at 37 ℃ for 30 minutes by T7 endogenous nucleotidase (NEB, USA); the agarose gel electrophoresis results were analyzed by purification after 2% agarose gel electrophoresis (TIAngel midi purification kit). Meanwhile, the PCR product is connected with a pGM-T (Tiangen) vector and then sequenced (DNAman), and the genotype of the newborn rabbit is determined.
3. Sequencing results
As shown in FIG. 3, the results show that 14 of 15F 0 newborn rabbits designed for GGTA1 gene have gene knockout mutation with a success rate of 93.3%, and the advantages of the gene knockout technology are embodied.
The selection of the target site of the invention conforms to the CRISPR design rule (NGG), after cas9 is cut, the cell initiates HDR or NHEJ mechanism repair, the coded CDS region is subjected to frame shift mutation, and the coding of the gene is damaged, so that the gene function is lost. According to the identification result, most of the obtained baby rabbit individuals are subjected to frame shift mutation, so that the function of the gene is deleted.
Sixth, GGTA1 gene knockout newborn rabbit postnatal weight statistics and survival condition
1. And (5) carrying out weight statistics on the born rabbits.
Table 3 shows the body weights of 9 rabbits which survived on the order of the year (wherein 15 is a non-genetically-altered rabbit). As a result, the body weights were slightly lower than those of wild-type rabbits of the same week of the year (see 15 and Table 4), and no significant difference was observed except for the individual rabbit (No. 4).
TABLE 3 weight statistics of the young rabbit with GGTA1 gene knockout (unit: Kg)
TABLE 4 weight statistics of wild type baby rabbit (unit: Kg)
3. Survival of born rabbits.
Of the 15F 0-generation baby rabbits, the baby rabbits numbered 1, 3, 7, 9, 11, and 12 died after 1 week, 3 weeks, 6 weeks, 10 weeks, and 6 weeks, respectively, and the death factor was judged to be natural death, and no difference from the wild-type death rate was observed. Other young rabbits grow normally. No other life habit, diet, behavior and other abnormalities are seen.
Phenotype identification of new-born rabbits
The rabbit with the GGTA gene knockout function has a new phenotype, and general vital signs are normal.
1. And (3) determining the GGTA mRNA expression of the knockout newborn rabbit.
The primers for quantitative PCR (SEQ ID No.12, SEQ ID No.13, SEQ ID No.14 and SEQ ID No.15) shown in the following table were designed in the GGTA functional region (within exon 8).
TABLE 5 RT-PCR primer sequences
A small amount of tissue was collected from the ear skin of a genetically manipulated F0 rabbit, RNA was extracted, and after reverse transcription into cDNA, amplification was carried out using GGTA-F/GGTA-R specific quantitative PCR primers. As a result, the genetically-extirpated homozygous rabbits completely lost the expression of GGTA1 mRNA.
2. Determination of Gal antigen in GGTA1 gene knockout newborn rabbit
Phenotypic characterization of protein expression levels of Gal antigens was detected by ELISA inhibition with specific anti-Gal antibodies.
Studies have shown that expression of Gal antigens is mainly regulated by GGTA, and that a deletion in GGTA gene expression will result in the disappearance of Gal antigen expression. Therefore, the ELISA inhibition method uses antibodies specific for Gal antigen (murine, M86), which first react with Gal antigen in the tissue using M86, and then centrifuge the unreacted residual antibody; the remaining antibodies were measured by coating a 96-well plate with an artificially synthesized Gal/BSA solid-phase antigen, and the expression level of the antigen reacting with the tissue was calculated.
Rabbit red blood cell membranes express abundant Gal antigens, and many studies adopt rabbit red blood cells as Gal antigen positive controls for relevant research. Therefore, the effect of GGTA gene knockout can be evaluated by detecting the expression condition of Gal antigen of rabbit blood erythrocytes. The specific operation is carried out according to the industrial standard YY/T1561-2017 (detection of the residual alpha-Gal antigen of the animal-derived scaffold material of the tissue engineering medical instrument product) and the reference (Yong Qiang et al, J. biomedical engineering 2015, 32 (3): 680-687).
The results are shown in Table 6, and the expression level of Gal antigen in the red blood cells of wild rabbit (WT) is 2.72X 107(number of epitopes/cell), consistent with literature reports; however, the expression level of Gal antigen of rabbit homozygous for GGTA1 gene knockout was not detected, which indicates that the Gal antigen-deficient rabbit model of this example was successfully prepared.
TABLE 6 detection results of expression level of Gal antigen
| Rabbit red blood cell | Gal expression level (number of epitopes/cell) |
| WT type | 2.72×107 |
| GGTA1KO | Not detected |
| decreased rate(％) | 100 |
The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> institute for testing and examining Chinese food and drug
<120> sgRNA, Gal antigen deletion rabbit model prepared from sgRNA and application of model
<140> 2018102077190
<141> 2018-03-14
<160> 15
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ctctcatagg taaattcgtc agg 23
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ttttggagga acaccccttc agg 23
<210> 3
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
taggctctca taggtaaatt cgtc 24
<210> 4
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aaacgacgaa tttacctatg agag 24
<210> 5
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
taggttttgg aggaacaccc cttc 24
<210> 6
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
aaacgaaggg gtgttcctcc aaaa 24
<210> 7
<211> 694
<212> DNA
<213> Rabbit GGTA1 Gene function CDS sequence (rabbitt GGAT1 CDS)
<400> 7
atacattgag cattacttgg aggagttcat aacatctgct aatagatact tcatgattgg 60
ccacaaagtc atattttaca tcctggtgga tgatgtctcc agaatccctt tgatagagct 120
gggtcctcta cgctccttca aagtgtttga gatcaagcca gagaagaggt ggcaggacat 180
cagcatgatg cgcatgaaga ccattgggga gcacatttca gcccatatcc aacacgaggt 240
tgacttcctc ttttgcatgg atgtggacca ggtcttccaa gacaactttg gggtggagac 300
cctgggccag tcagtggctc agctacaggc ctggtggtac aaagcagatc ctgacgaatt 360
tacctatgag aggcggaaag agtcggcagc atacattcca tttggacaag gggattttta 420
ttaccatgca gccatttttg gaggaacacc ccttcaggtt ctcaacctca cccaggagtg 480
ctttaaggga atcctccagg acaagcaaaa tgacatcgaa gctgagtggc atgatgaaag 540
ccacctgaac aagtatttcc tgctcaacaa acccactaaa atcttatctc cagaatactg 600
ctgggattat catataggcc taccttcaga tattaaaatt gtcaagatat cttggcagac 660
aaaagaatat agtttggtta ggaataatgt ctga 694
<210> 8
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gaaattaata cgactcacta ta 22
<210> 9
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
aaaaaaagca ccgactcggt gccac 25
<210> 10
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
tggaggagtt cataacatct gc 22
<210> 11
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
tgctgggatt atcatatagg cct 23
<210> 12
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
<210> 13
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
aagaaggtgg tgaagcaggc 20
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
tccaccaccc tgttgtgtag 20
Claims (6)
1. An sgRNA used for preparing a Gal antigen deletion rabbit model is characterized in that the sgRNA is respectively marked as a first sgRNA recognition sequence and a second sgRNA recognition sequence; the first sgRNA recognition sequence is shown in SEQ ID No.1, and the second sgRNA recognition sequence is shown in SEQ ID No. 2; and the oligonucleotide chain sequences aiming at the first sgRNA recognition sequence are shown as SEQ ID No.3 and SEQ ID No.4, and the oligonucleotide chain sequences aiming at the second sgRNA recognition sequence are shown as SEQ ID No.5 and SEQ ID No. 6.
2. A preparation method of a Gal antigen deletion rabbit model is characterized by comprising the following steps:
construction of sgRNA vector: the sgRNA synthetic oligonucleotide chain according to claim 1, connecting the obtained double-stranded DNA into a pUC57-T7-sgRNA vector recovered by Bbs I enzyme digestion to obtain a pUC57-T7-sgRNA recombinant vector, and amplifying the recombinant vector;
transcription: transcribing and purifying the amplified PCR product of the recombinant vector to obtain synthesized sgRNA1 corresponding to the first sgRNA recognition sequence and synthesized sgRNA2 corresponding to the second sgRNA recognition sequence for later use;
and (3) injecting blastocysts: performing blastocyst injection on an embryo by using a Cas9sgRNA system consisting of Cas9mRNA and sgRNA in a cytoplasm injection mode;
embryo transplantation: and transplanting the injected embryo into an egg duct of a receptor rabbit for feeding.
3. The method for preparing a Gal antigen-deficient rabbit model according to claim 2, wherein in the sgRNA vector construction step, synthetic oligonucleotide strands for the first sgRNA recognition sequence are shown as SEQ ID nos. 3 and 4, and synthetic oligonucleotide strands for the second sgRNA recognition sequence are shown as SEQ ID nos. 5 and 6; the oligonucleotides are annealed to synthesize double-stranded DNA.
4. The method of claim 2, wherein in the transcription step, the PCR product of the recombinant vector is transcribed with a MAXIscript T7 Kit, amplified with a T7 primer sequence, and purified with a miRNeasy Mini Kit; the T7 primer sequence is shown in SEQ ID No.8 and SEQ ID No. 9.
5. The method of claim 2, wherein the Cas9mRNA is obtained from the following method in the blastocyst injection step: after 3 XFLAG-NLS-SpCas 9-NLS vector is linearized by Not1, the transcription is carried out by using an mMessage mMachine SP6 reagent, and the DNA fragment is obtained.
6. The method for preparing a Gal antigen-deficient rabbit model according to claim 2, wherein in the blastocyst injection step, the using concentration ratio of Cas9mRNA to sgRNA in the Cas9sgRNA system is 4-6: 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810207719.0A CN108330130B (en) | 2018-03-14 | 2018-03-14 | sgRNA, Gal antigen-deleted rabbit model prepared from sgRNA and application of sgRNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810207719.0A CN108330130B (en) | 2018-03-14 | 2018-03-14 | sgRNA, Gal antigen-deleted rabbit model prepared from sgRNA and application of sgRNA |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108330130A CN108330130A (en) | 2018-07-27 |
| CN108330130B true CN108330130B (en) | 2021-09-07 |
Family
ID=62930780
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810207719.0A Active CN108330130B (en) | 2018-03-14 | 2018-03-14 | sgRNA, Gal antigen-deleted rabbit model prepared from sgRNA and application of sgRNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108330130B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022147759A1 (en) * | 2021-01-08 | 2022-07-14 | Susheng Biotech (Hainan) Co., Ltd. | Grna molecule targeting intron i or intron ii of hbb gene, synthetic method thereof, and method to correct types of hbb gene mutations |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9888673B2 (en) * | 2014-12-10 | 2018-02-13 | Regents Of The University Of Minnesota | Genetically modified cells, tissues, and organs for treating disease |
| CN104894163B (en) * | 2015-03-19 | 2019-01-18 | 中国食品药品检定研究院 | A kind of method and application of the non-human mammal preparing the dual-gene knockout of GGTA1 and iGb3S |
| CN104789592A (en) * | 2015-03-19 | 2015-07-22 | 中国食品药品检定研究院 | Method of preparing alpha-1,3GT gene knockout non-human mammal and application |
| CN105492609A (en) * | 2015-06-11 | 2016-04-13 | 深圳市第二人民医院 | Method for CRISPR-Cas9 specific knockout of pig GGTA1 gene and sgRNA for specific targeted GGTA1 gene |
| CN107630043A (en) * | 2017-11-14 | 2018-01-26 | 吉林大学 | The method that Gadd45a knockout rabbit models are established using knockout technology |
-
2018
- 2018-03-14 CN CN201810207719.0A patent/CN108330130B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN108330130A (en) | 2018-07-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109706184B (en) | Method for establishing autism model dog | |
| JP2002535963A (en) | Selection of animals by traits imprinted by parents | |
| CN108697068A (en) | Selection to the pluripotent cell for generating viable XY female mices | |
| CN101283105A (en) | Identification of genes and their products which promote hybrid vigour or hybrid debility and uses thereof | |
| Li et al. | Genomic analyses of wild argali, domestic sheep, and their hybrids provide insights into chromosome evolution, phenotypic variation, and germplasm innovation | |
| CN110894510A (en) | Method for breeding Lgr6 gene-deleted zebra fish through gene knockout | |
| CN108330130B (en) | sgRNA, Gal antigen-deleted rabbit model prepared from sgRNA and application of sgRNA | |
| CN110115248A (en) | A kind of immunodeficient mouse, the Its Preparation Method And Use of somatostatin gene defect | |
| CN116250509B (en) | Construction method and application of SIGLEC10 humanized mouse model | |
| CN114736926B (en) | Heg1 gene point mutation mouse model, construction method and application thereof | |
| Leonova et al. | Genetic markers of cow milk productiveness of the red steppe breed | |
| CN109694885B (en) | Method for preparing PI3K gamma whole-body knockout mode mouse based on CRISPR/Cas9 technology, application thereof and kit | |
| WO1999033987A1 (en) | Cloning of a high growth gene | |
| CN113430284A (en) | Molecular marker related to chicken pectoral muscle mass and pectoral muscle rate, kit and application | |
| CN114747541B (en) | Construction method and application of PSGL-1 humanized non-human animal model | |
| CN113430283B (en) | Application of chicken BMP15 gene as chicken testicular character molecular marker | |
| CN112430628B (en) | Method for establishing scoliosis animal model | |
| CN108165640B (en) | SNP locus related to resistance or susceptibility of diarrhea of suckling piglet and molecular marker detection and application | |
| CN116769779A (en) | Construction method and application of Mybpc3 gene frameshift mutant mouse model | |
| CN115029382B (en) | Preparation method of genetically modified mice capable of distinguishing Tbx1 two variable cutters | |
| CN111849977B (en) | Method for preparing transgenic animals by sperm vector, sgRNA for preparing short and small transgenic chickens and preparation method | |
| CN111676293B (en) | SNP molecular marker related to Qinghai eight-eyebrow pig litter size trait and application thereof | |
| Lestari et al. | Identification of single nucleotide polymorphisms on cattle breeds in Indonesia using Bovine 50K | |
| CN110331172B (en) | Method for constructing whitened hamster model based on CRISPR-Cas9 system | |
| Rehman et al. | Whole-Genome Sequencing and Characterization of Buffalo Genetic Resources: Recent Advances and Future Challenges. Animals 2021, 11, 904 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 102629 Beijing Daxing District biological medicine industry base No. 31 Hua Tuo road. Applicant after: National Institutes of Food and Drug Control Address before: 100176 Beijing Daxing Daxing District, Yizhuang Hongda Middle Road, a 8. Applicant before: National Institutes of Food and Drug Control |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |