CN104894163B - A kind of method and application of the non-human mammal preparing the dual-gene knockout of GGTA1 and iGb3S - Google Patents

Abstract

The present invention relates to the fields of production Gene Knock-Out Animal Model model to be specifically related to the method and application of a kind of non-human mammal for preparing the dual-gene knockout of GGTA1 and iGb3S.Preparation method are as follows: construct targeting vector respectively；Targeting vector is transferred to embryonic cell, by recombination embryonic cell injection foster animal embryo, is transplanted in pseudo pregnant animal body, mates with intact animal；Genotype verifying, the chimeric animal that the positive gene of screening-gene successful knockout knocks out are carried out to obtained chimeric animal；It further mates with wild animal, obtains F1 generation heterozygote；Post-coitum obtains GGTA1 the and iGb3S homozygous animals that two chromosomes are picked out between F1 generation heterozygote；GGTA1 and iGb3S homozygous animals are mated again, the dual-gene knockout homozygous animals that screening GGTA1 and iGb3S is lacked simultaneously, and building is to obtain Gene Knock-Out Animal Model population.

Description

A kind of method of the non-human mammal for preparing the dual-gene knockout of GGTA1 and iGb3S and Using

Technical field

The present invention relates to the fields of production Gene Knock-Out Animal Model model, specifically, are related to a kind of preparing GGTA1 and iGb3S The method and application of the non-human mammal of dual-gene knockout.

Background technique

The biogenic material being made of mammalian extracellular matrix is extensive with good biocompatibility because of it Timbering material etc. for the wound repair of surgery, tissue reconstruction and organizational project.Xenogeneic organ also early has become resolver official In transplanting for organ there is a serious shortage of one of potential approach.However, animal derived biomaterial or Xenogeneic organ's organizations in Immunological problem brought by human body directly affects the safety and validity of this kind of materials'use.Xenotransplant is most Big obstacle is that rear activating complement system, attack are generated for organ in conjunction with natural antibody in recipient's body for organ heterogenetic antigen Hyperacute immunological rejection (Hyperacute rejection, HAR), a few minutes of time of origin after heterograft are extremely A few hours, functional failure occurs in a short time for organ makes graft failure.Though animal derived biomaterial is anti-through various removals Former processing is but difficult to completely remove all heterogenetic antigens, and residual antigen is still to cause Chronic immune rejection and exempt from Epidemic disease toxicity and an important factor for influence wound healing.

Existing research shows that heterogenetic antigen α-galactosyl antigen (α -1,3-galactosyle, α-Gal) is animal derived Main target antigen in biomaterial or xenotransplant Hyperacute immunological rejection.α-Gal is containing poly lactose amine core The cell surface secreting type glycoprotein or glycolipid of heart terminal residue are widely present in pig and other lower animal bodies.α-Gal master It will be by α -1,3 galactosyltransferases (α 1,3-galactosyltransferase, α -1,3GT or GGTA1) and different red blood cell Glucosides Lipase absobed enzyme (isoglobotriosylceramide synthase or isogloboside 3synthase, iGb3S) Regulation.Since the galactoside transferase gene of human body and anthropoid, old century monkey has 2 base dislocation variations without expressing Gal antigen, but there are the human natural antibodies of high titre (1-3% for accounting for total serum globulin) in human serum, therefore when human body connects It will lead to Hyperacute immunological rejection and chronic immune poison when by the biomaterial containing Gal antigen or xenotransplant Property reaction.Have research confirm human serum in human natural antibodies both with GGTA1 catalysis Gal antigen (glycoprotein) reacted, also with Gal antigen (glycolipid fat) reaction of iGb3S catalysis.

Just have early in the nineties by constructing GGTA1 knock out mice, to study the relevant immunology of α-Gal in the world The construction method and feasibility of the cloned animal without Gal antigen are inquired into reaction.Early in 1996, RG Tearle etc. was reported The successful production method of GGTA1 gene knock-out mice model is begun with report later and is ground using GGTA1 gene knock-out mice model Study carefully its similitude and its amynologic characteristic with people institute induction of antibodies.The report such as Chiang TR, GGTA1 gene knock out mouse and exempt from The anti-Gal antibody induced after epidemic disease is similar with the anti-Gal antibody of the α-Gal compatibility combined and people, is that can induce Gal antigen The Hyperacute immunological rejection of positive heterotropic heart sticking patch.The report such as Chong A, GGTA1 knock out mice can induce Natural anti alpha-Gal IgM and IgG, and the enhancing of week old interdependence is presented；It can be seen after allogeneic or the transplanting of xenogenesis sticking patch Observe the human natural antibodies reaction of T-cell interdependence.These research prompt GGTA1 gene knock-out mice models are to Gal antigen The immunotoxicity of residual induction has sensitive reactivity.

Hyperacute immunological rejection caused by α-Gal antigen and the conquering method of Chronic immune toxicity have obtained deeply grinding Study carefully.Many laboratories use different methods and handle for organ or cell, wherein with enzymatic treatment method, physico credit Research from the methods of method and cross-linking method and genetic modification is most extensive.Researchers have started GGTA1 clpp gene at the beginning of 2000 Except the research of pig or even the research of GGTA1 gene knockout ox, it is desired to be able to directly be obtained not from GGTA1 gene knock-out pig or ox There are the tissue or organ of Gal antigen, to avoid animal derived biomaterial and the immunological rejection of xenogenesis organ transplantation.Dai The report such as Y and Lai L, they have gone out GGTA1 gene knock-out pig (GT/KO pig) with nuclear transfer technique successful incubation.Experiment Researches show that the biomaterials in GGTA1 gene knock-out pig source can significantly mitigate the hyperacute rejection of Gal antigen induction.

The country also achieves certain achievement, Dai Yifan and Lai Liangxue about the research of GGTA1 Gene Knock-Out Animal Model model Professor is the scholar for reporting GGTA1 gene knockout heterozygosis pigling earliest in the world.They successively successfully construct at home after coming back home The model of GGTA1 gene knock-out pig, and have been obtained for homozygote.However, the research state about iGb3S Gene Knock-Out Animal Model Inside have not been reported.

Studies have found that the mouse or pig of GGTA1 gene knockout still express alpha-Gal antigen, still are able to observe The immunological rejection in later period.In addition have research it has been confirmed that in the histoorgan of people not expression activity iGb3, prompt by The iGb3 lipoprotein containing galactosyl of iGb3S transferase gene transcription may be that animal tissue, organ or animal derived material move Plant another exogenous antigen that heteroimmune rejection is caused when human body.Milland etc. researches show that in GGTA1 base Because still expressing low-level in knock-out animal body but having the Gal antigen of significant meaning.GGTA1 knock out mice expresses iGb3S MRNA, it is often more important that Gal α (1, the 3) Gal for the fatty skeleton that the antibody in GGTA1 knock out mice source is synthesized with iGb3S Antigen-reactive.It may be to cause heteroplastic transplantation that this result of study, which prompts Gal α (1,3) Gal glycolipid fat antigen of iGb3S synthesis, The main reason for Chronic immune rejection.Therefore, it is acute to think although GGTA1 Gene Knock-Out Animal Model avoids by Milland etc. The Gal antigen of immunological rejection, fat connection is the root of heteroplastic transplantation later period Chronic immune rejection.There is scholar to start Study the immunological changes of immune response and iGb3S defect model animal that iGb3 is mediated.

Therefore, GGTA1 and iGb3S Double knockout mice model will further investigate and evaluate exempting from for Gal antigen mediation The tool of epidemic disease reaction.However, GGTA1 and iGb3S Double knockout mice is domestic, the world is all not yet reported that.For existing There are the deficiency and defect of technology, the present invention is specifically proposed.

Summary of the invention

Primary goal of the invention of the invention is to propose a kind of inhuman food in one's mouth for preparing the dual-gene knockout of GGTA1 and iGb3S The method of newborn animal.

Second goal of the invention of the invention is to propose the non-human mammal of the dual-gene knockout of the GGTA1 and iGb3S Using.

In order to achieve the object of the present invention, the technical solution of use are as follows:

A method of preparing the non-human mammal of the dual-gene knockout of GGTA1 and iGb3S, comprising the following steps:

(1) it constructs targeting vector: separating GGTA1 and iGb3S gene from genomic DNA respectively, expand through long-chain PCR method Increase and obtain homology arm, with the compound building GGTA1 targeting vector of antibiotic resistance genes and iGb3S targeting vector；

(2) GGTA1 targeting vector is transferred to embryonic cell, by recombination embryonic cell injection foster animal embryo, moved It plants in pseudo pregnant animal body, mates with intact animal；Genotype verifying, screening-gene success are carried out to obtained chimeric animal The chimeric animal that the positive gene of knockout knocks out；It further mates with wild animal, obtains the F1 generation heterozygote of GGTA1；

(3) iGB3S targeting vector is transferred to embryonic cell, by recombination embryonic cell injection foster animal embryo, moved It plants in pseudo pregnant animal body, mates with intact animal；Genotype verifying, screening-gene success are carried out to obtained chimeric animal The chimeric animal that the positive gene of knockout knocks out；It further mates with wild animal, obtains the F1 generation heterozygote of iGB3S；

(4) post-coitum between the F1 generation heterozygote of GGTA1 and the F1 generation heterozygote of iGB3S is obtained into two chromosomes quilt GGTA1 the and iGb3S homozygous animals picked out；

(5) GGTA1 and iGB3S homozygous animals are mated again, screening GGTA1 and iGb3S lacks biradical simultaneously It is to obtain Gene Knock-Out Animal Model population because knocking out homozygous animals, and building.

First optimal technical scheme of the invention are as follows: non-human mammal is mouse, further preferred C57BL mouse.

Second optimal technical scheme of the invention are as follows: GGTA1 gene knockout is the functional catalytic domain for knocking out GGTA1 gene 9th exon, nucleotide sequence is as shown in SEQ NO ID:1；IGb3S gene knockout is the functionality for knocking out iGb3S gene The 5th exon of catalytic domain, nucleotide sequence is as shown in SEQ NO ID:2.

Third optimal technical scheme of the invention are as follows: the GGTA1 targeting vector contains 5` homology arm, drug resistance antibiotic base Because of NeoR-PA and 3` homology arm, replace the 9th exon respectively with NeoR-PA；The iGb3S targeting vector contain 5` homology arm, Drug resistance antibiotic resistance gene NeoR-PA and 3` homology arm, the 5th exon is replaced with NeoR-PA respectively.

4th optimal technical scheme of the invention are as follows: the drug resistance antibiotic resistance gene NeoR- for the building of GGTA1 targeting vector The homology arm sequence at the end PA 5` and the end 3` is derived from the end 5` of the 9th exon of GGTA1 gene and 3` on mouse Article 2 chromosome End, respectively 4.123kb and 7.343kb；For iGb3S targeting vector building the drug resistance antibiotic resistance gene end NeoR-PA 5` and The homology arm sequence at the end 3` is derived from the end 5` and the end 3` of the 5th exon of iGb3S gene on mouse Article 4 chromosome, respectively 8.3kb and 9.1kb.

5th optimal technical scheme of the invention are as follows:

The construction step of GGTA1 targeting vector are as follows:

(1) genomic DNA is separated from normal C57BL/6J mouse, the 9th exon 5 ' of amplification holds C1 segment, A segment and 3 ' B segment, C2 segment are held, pBlunt carrier is connected respectively to；

(2) by digestion identification, correct A and B segment be sequenced be consecutively connected to pL452 carrier and obtain pL452-GGTA1-A- B, meanwhile, it is connected on pDTA-Down carrier after correct C1, C2 segment composition will be sequenced by Overlap PCR；

(3) correct pL452-GGTA1-A-B EcoRV digestion will be connected, pL452-AB cuts out 2885bp, 2930bp two Band, recycles target fragment A-NeoR-B, and electricity turns the BAC bacterium containing pBCTG and recombinated；Bacterium colony PCR detects A-NeoR-B segment BAC is recombinated, identification amplified band is correct；

(4) linearization process of pDTA-down-GGTA1-C, i.e. EcoRV digestion handle pDTA-Down-GGTA1-C, return Purpose band is received, electricity turns to have recombinated the BAC bacterium of the GGTA1 of NeoR；PDTA-GGTA1-C saves GGTA1-NeoR BAC (AmpR+KanR)；PCR Testing and appraisal is carried out to the bacterium colony after C rescue, the correct clone of recombination is expanded, is purified through Stbl3 Digestion verification afterwards；

The construction step of iGb3S targeting vector are as follows:

(1) genomic DNA is separated from normal C57BL/6J mouse, the 5th exon 5 ' of amplification holds C1 segment, A segment and 3 ' B segment, C2 segment are held, pBlunt carrier is connected respectively to；

(2) by digestion identification, correct A and B segment be sequenced be consecutively connected to pL452 carrier and obtain pL452-iGb3S-A- B, meanwhile, it is connected on pDTA-Down carrier after correct C1, C2 segment composition will be sequenced by OverlapPCR；

(3) correct pL452-iGb3S-A-B EcoRV digestion will be connected, pL452-AB cuts out 2880bp, 2885bp two Band, recycles target fragment A-NeoR-B, and electricity turns the BAC bacterium containing pBCTG and recombinated；Bacterium colony PCR detects A-NeoR-B segment BAC is recombinated, identification amplified band is correct；

(4) linearization process of pDTA-down-iGb3S-C, i.e. EcoRV digestion handle pDTA-Down-iGb3S-C, return Purpose band is received, electricity turns to have recombinated the BAC bacterium of the iGb3S of NeoR；PDTA-iGb3S-C saves iGb3S-NeoR BAC (AmpR+KanR)；PCR Testing and appraisal is carried out to the bacterium colony after C rescue, the correct clone of recombination is expanded, is purified through Stbl3 Digestion verification afterwards.

6th optimal technical scheme of the invention are as follows: step (2) is the following steps are included: the male mouse of preparation infertility and false pregnancy are female Mouse；Super ovulation；Harvest fertilized eggs；The preparation of target DNA；Target DNA is imported into fertilized eggs；The transplanting of fertilized eggs；Head is built in mouse The detection of target DNA integration；Mouse germline is picked out by crossbreed gene.

The invention further relates to sperm, egg cell, fertilized eggs, embryo, filial generation, tissues or thin from dual-gene knock-out animal Born of the same parents.

The invention further relates to the non-human mammal of dual-gene knockout or from clpp gene go out the sperm of animal, egg cell, Fertilized eggs, embryo, filial generation, tissue or cell are in biogenic material, xenotransplant area research and evaluation and Gal antigen Application in the tumour immunity research and evaluation of mediation；The biogenic material includes animal derived or is derived from human body, institute The animal derived biomaterial stated does not include primate；The type of the animal derived biomaterial includes being derived from animal Intracorporal various tissues, internal organs and its derivative, or by tissue or a variety of materials of internal organs preparation；The primate Refer in particular to ancient century monkey, baboon.The described application be included in immunological investigation, immunotoxicology, heteroimmune rejection and its Application in the research of mechanism, tumor immunology research and safety evaluatio；The safety evaluatio includes biogenic material The safety evaluatios of the xenotransplant before clinical test such as material, GGTA1 gene knock-out pig, ox.

Targeting vector picks out the overall length 694bp that sequence fragment is the 9th exon of GGTA1, nucleotide sequence such as SEQ NO ID:1:

20430 G TACATTGAGC ATTACTTAGA AGACTTTCTG

20461 GAGTCTGCTG ACATGTACTT CATGGTTGGC CATCGGGTCA TATTTTACGT CATGATAGAC

20521 GACACCTCCC GGATGCCTGT CGTGCACCTG AACCCTCTAC ATTCCTTACA AGTCTTTGAG

20581 ATCAGGTCTG AGAAGAGGTG GCAGGATATC AGCATGATGC GCATGAAGAC CATTGGGGAG

20641 CACATCCTGG CCCACATCCA GCACGAGGTC GACTTCCTCT TCTGCATGGA CGTGGATCAA

20701 GTCTTTCAAG ACAACTTCGG GGTGGAAACT CTGGGCCAGC TGGTAGCACA GCTCCAGGCC

20761 TGGTGGTACA AGGCCAGTCC CGAGAAGTTC ACCTATGAGA GGCGGGAACT GTCGGCCGCG

20821 TACATTCCAT TCGGAGAGGG GGATTTTTAC TACCACGCGG CCATTTTTGG AGGAACGCCT

20881 ACTCACATTC TCAACCTCAC CAGGGAGTGC TTTAAGGGGA TCCTCCAGGA CAAGAAACAT

20941 GACATAGAAG CCCAGTGGCA TGATGAGAGC CACCTCAACA AATACTTCCT TTTCAACAAA

21001 CCCACTAAAA TCCTATCTCC AGAGTATTGC TGGGACTATC AGATAGGCCT GCCTTCAGAT

21061 ATTAAAAGTG TCAAGGTAGC TTGGCAGACA AAAGAGTATA ATTTGGTTAG AAATAATGTC

21121 TGA

Targeting vector picks out the overall length 687bp that sequence fragment is the 5th exon of iGb3S, and nucleotides sequence is classified as such as SEQ NO ID:2:

7728 GTA CCTGGAGAAG

7741 TACCTGGAAC ACTTCCTGGT ATCGGCAGAG CAGCACTTCA TGGTCGGCCA GAACGTGGTG

7801 TACTATGTGT TTACGGATCG CCCGGAAGCA GTGCCCTATG TGGCTCTAGG CCAGGGTCGC

7861 CTGCTGCGGG CAAAACCCGT GCAGCGAGAG AGGCGCTGGC AGGACGTGTC CATGGCACGC

7921 ATGCCCACGC TACACGAGGC TCTGGGAGGG CAGCTGGGCC AAGAAGCTGA CTTTGTGTTC

7981 TGCCTGGACG TGGACCAGTA CTTCACCGGT AACTTCGGGC CTGAGGTGCT GGCAGATTTG

8041 GTGGCACAGC TGCACGCCTG GCACTACCGC TGGCCGCGGT GGCTGCTGCC CTACGAGAGG

8101 GACAAGCGAT CGGCTGCTGC GCTGTCGTTA AGCGAAGGCG ATTTCTACTA CCACGCTGCG

8161 GTGTTTGGCG GCAGTGTGGC TGCACTGCTC AAGCTGACGG CCCACTGTGC GACTGGCCAA

8221 CAGCTGGACC ATAAGCGCGG CATTGAGGCA CTCTGGCACG ACGAAAGCCA CCTTAACAAG

8281 TTCTTCTGGC TGAACAAGCC CACCAAGCTG CTGTCGCCTG AGTTCTGCTG GGCAGAGGAA

8341 ATTATCTGGA GGAGAGAGAT CCATCACCCA CGCCTGCTCT GGGCACCCAA GGAATATACG

8401 CTGGTGCGAA ACTAG

Technical solution of the present invention is made further explanation below.

The present invention relates to a kind of methods for making dual-gene knock-out animal model and the animal model in a variety of biological sources The immunological investigation of property material (animal derived, be derived from human body), heteroplasm or organ；The immunological rejection that Gal antigen mediates Reaction and its research of mechanism；Preclinical safety evaluation (such as immunology of animal tissue, organ or animal derived biomaterial Evaluate, transplant or implant experiment etc.) in purposes；The tumor immunology research that Gal antigen mediates；And spread out by the animal pattern Purposes of born cell, tissue, organ and the embryo in above-mentioned field.

Animal model of the invention has artificially been picked out the 9th exon of functional catalytic domain and iGb3S of GGTA1 gene The 5th exon of functional catalytic domain of gene.Bacterial artificial chromosome homologous recombination technique is utilized, with antibiotic resistance genes Targeting vector, the functional catalysis of replacement GGTA1 gene are constituted with the homology arm for being attached to the end 5` (upstream) and the end 3` (downstream) The 5th exon of functional catalytic domain of the 9th exon of area and iGb3S gene.The approach for implementing the invention mainly includes practicing shooting to carry Body building, recombination embryonic cell clone and blastaea microinjection.It is separated respectively from the genomic DNA of C57BL mouse first GGTA1 gene and iGb3S gene expand through long-chain PCR method and obtain homology arm, then beat with the compound building of antibiotic resistance genes Targeting vector；Embryonic cell is separated from the embryo of C57BL mouse, is turned after short-term expansion culture for the electricity of targeting vector, screening, Obtain positive embryos cell clone；It will be recombinated in embryonic cell injection mouse embryo through micro-injection method, and then be transplanted to false pregnancy In mouse body；Obtain blackspot shape allophenic mice；It further mates with wild type C57BL mouse, obtains F1 generation heterozygote；Using point Sub- biological method carries out genotype verifying to obtained F1 generation hybrid mice, and the positive gene of screening-gene successful knockout strikes The hybrid mice removed；Post-coitum obtains the homozygote mouse that two chromosomes are picked out between F1 generation heterozygote； After Southern Blot method carries out genotype identification, the heterozygote or homozygote of GGTA1 and iGb3S carry out crossbreed The homozygote mouse for obtaining GGTA1 and the dual-gene missing of iGb3S, building is to obtain Gene Knock-Out Animal Model population.On this basis, may be used Further to obtain the cell, organ and embryo of the animal model.

Specifically, the invention proposes a kind of the functionality of GGTA1 and iGb3S gene is eliminated from mouse genome urge Change the production method of the rodent Gene Knock-Out Animal Model of the 9th exon of area and the 5th exon.GGTA1 gene used in the present invention Overall length about 16.2kb, gene order are selected from the 2nd DNA sequence DNA of C57BL/6J mouse.GGTA1 gene contains aobvious outside 9 Son, functional catalytic domain are located at the 9th exon.The GGTA1 gene targeting carrier length of building is 18.966kb, such as Fig. 1-1 It is shown, contain 5` (upstream) homology arm (4.123kb), NeoR-PA (7.343kb) and 3` (downstream) homology arm (7.5kb).With NeoR-PA replaces the 9th exon.IGb3S full length gene about 10kb used in the present invention, gene order are selected from C57BL/6J mouse 4th DNA sequence DNA.IGb3S gene contains 5 exons, and functional catalytic domain is located at the 5th exon.Building IGb3S gene targeting carrier length is that 25.2kb contains 5` (upstream) homology arm (8.3kb), NeoR-PA as shown in Figs. 1-2 (7.343bp) and 3` (downstream) homology arm (9.1kb).Replace the 5th exon with NeoR-PA.

GGTA1 targeting vector designs and different (document 1:The Journal of reported in the literature in the present invention Biological Chemistry, Vol.270, No.37:21437-21440,1995), Fig. 2-1a is that document 1 reports target practice position Point schematic diagram.Fig. 2-1b shows 9 exons of GGTA1 gene.The maximum that the target practice site of document 1 is located at GGTA1 gene is outer aobvious Son, the i.e. end 5` of the 9th exon terminate coding by insertion pgkNeo, and before setting to terminate turn of Neo and the 9th exon It translates.Contain the end the genomic DNA 5`- end homology arm 11kb and 3- homology arm 0.9kb in the two sides of NeoR；Document 2 (Transplantation.61 (1): 13-19, January 15,1996): GGTA1 knock out mice targeting vector target practice position Point is the 8th and the 9th exon, is replaced with NeoR.

The design of iGb3S targeting vector and difference reported in the literature in the present invention: document Normal development and function of invariant natural killer T cells in mice with Isoglobotrihexosylceramide (iGb3) deficiency (PNAS, 2007,104 (14) 5977-5982) is utilized The loxP-NeoR that Cre- is mediated selects box (PGK-gb2-neomycin selection cassette (neo) symbolize LoxP sequences) the 5th exon is rejected, recombination takes off NeoR sequence after completing, and schematic diagram is as shown in Fig. 2-2.Most Upper end is wild type gene site (WT locus), contains 1~5 exon (Exon1-5)；The antibiotic resistance genes of insertion (neo, PGK-gb2-neomycin selection cassette) is instead of exon 5` and part 3` terminal sequence；It practices shooting and carries Body includes upstream homology arm (containing 2~4 exons), antibiotic resistance genes sequence and downstream homology arm；It is taken off after the completion of recombination Neo sequence (recombined locus).

By the process of microinjection (Microinjection) producer gene knock-out animal the following steps are included: preparing not Educate male mouse and false pregnancy female rat；Super ovulation；Harvest fertilized eggs；Recombinate the preparation of embryonic cell；The positive embryonic cell of recombination is led Enter fertilized eggs；The transplanting of fertilized eggs；The acquisition of allophenic mice, further mates with wild-type mice, obtains hybrid mice (head builds mouse)；Head builds the detection of recombinant DNA integration in mouse (Founder)；Mouse germline is picked out by crossbreed gene.

The head that the present invention obtains builds mouse with new phenotype.General vital signs are normal, and growth and development is normal.Due to There is not been reported for the dual-gene rejecting animal model of GGTA1 and iGb3S, and phenotypic characteristic needs to be further looked at.

It is built using the mating of following scheme and is: then mated with normal male mouse for female chimeras mouse (Fig. 7), select week old At 10 weeks, there is mating experience, healthy and strong C57BL mouse to mate therewith.Start to check situation of becoming pregnant after living together 1 week, such as Fruit discovery pregnancy individually raises female mice, until production.If it is Male chimeras body mouse, select 8 weeks or more, it is healthy and strong Female mice mates therewith.Detection discovery gene is picked out can stablize heredity in offspring, and litter size amount is no different with normal mouse, and one As can successfully feed, it is rare to eat the maternal instinct bad phenomenon such as son.

Gene level phenotypic evaluation uses RT-PCR identification method.Protein level phenotypic evaluation uses alpha-Gal ELISA inhibits method, and the detection of alpha-Gal antigen presentation is carried out using its specific antibody.Due to the table of alpha-Gal antigen Regulate and control up to by GGTA1 and iGb3S, so the missing of the two gene expressions will will lead to the reduction of alpha-Gal antigen presentation. Alpha-Gal ELISA inhibits method to use the specific antibody M86 of alpha-Gal antigen, first uses the alpha- in M86 and tissue Gal antigen-reactive, then unreacted remaining antibody is centrifuged；Remaining antibody is resisted by alpha-Gal/BSA solid phase 96 orifice plate of primordial covering is measured, and calculates the expression quantity with the alpha-Gal antigen of tissue reaction with this.GGTA1/iGb3S is bis- The life cycle and wild animal of gene knockout animal have no the different report of life cycle without significant difference.In the present invention, The life cycle that head builds mouse has no shortening phenomenon, and general state is normal.

The present invention relates to the methods of production Gene Knock-Out Animal Model model and the animal model in a variety of biogenic materials The research of the immunological investigation, immunological rejection and its mechanism of (animal derived, be derived from human body), heteroplasm or organ, Purposes in preclinical safety evaluation (such as immunological evaluation, implantation experiment)；And be derived by the animal pattern Cell, tissue, organ and embryo and its purposes in above-mentioned field.

This animal model has artificially been picked out the 9th exon of functional catalytic domain and the 5th of GGTA1 and iGb3S gene Exon.Currently, being showed no the dual-gene report for rejecting animal of GGTA1/iGb3S both at home and abroad, also nobody's research is used as A kind of tool and method or Xenogeneic organ, tissue transplantation of animal derived biomaterial safety evaluatio and quality control are (such as From GGTA1 gene knock-out pig, ox) evaluation and research.In addition to this, it can be induced there are many more research and utilization α-Gal The characteristic of the super acute immune reaction of human body is used for the immunization therapy of tumour, such as autologous tumor vaccine: by autologous tumor cell Such as blood tumor cell, solid tumor cell membrane, with neuraminic acid acid anhydride enzyme, uridine diphosphate galactose and recombination GGTA1 is co-cultured.The present invention constructs the GGTA1/iGb3S for stablizing heredity using homologous recombination technique and embryonic stem cell technologies Dual-gene rejecting mouse can be used for the research of animal tissue's Gal antigen relevant immunological investigation and immunological rejection mechanism；Animal Immunotoxicology research, the Regeneration and Repair medical research of source property biomaterial；The immunology that can also be used in treatment of cancer simultaneously is ground Study carefully.

Detailed description of the invention:

Fig. 1-1. GGTA1 gene targeting site schematic diagram, has marked restriction enzyme site relevant to full genome splicing and recombination The site of probe is used in verifying；

Fig. 1-2 iGb3S gene targeting site schematic diagram has marked restriction enzyme site relevant to full genome splicing and recombination The site of probe is used in verifying；

Fig. 2-1. background technique Literature reports target practice site schematic diagram；

Fig. 2-2. background technique Literature reports target practice site schematic diagram；

The electrophoretogram of Fig. 3-1. targeting vector pDTA-GGTA1-A-B-C and pDTA-iGb3S-A-B-C digestion verification；

The electrophoretogram of Fig. 3-2. targeting vector pDTA-GGTA1-A-B-C and pDTA-iGb3S-A-B-C digestion verification；

Fig. 4-1. targeting vector pDTA-GGTA1-A-B-C and pDTA-iGb3S-A-B-C plasmid proposes greatly rear digestion verification Electrophoretogram；

Fig. 4-2. targeting vector pDTA-GGTA1-A-B-C and pDTA-iGb3S-A-B-C plasmid proposes greatly rear digestion verification Electrophoretogram；

Fig. 5-1. is that plasmid pDTA-GGTA1-A-B-C recombination ES cell is positive through the Southern Blot confirmation of probe 1 Clone electrophoretogram；

Fig. 5-2. is that plasmid pDTA-iGb3S-A-B-C recombination ES cell is positive through the Southern Blot confirmation of probe 1 Clone electrophoretogram；

Fig. 6-1. plasmid pDTA-GGTA1-A-B-C recombinates positive gram of Southern Blot confirmation of ES cell through probe 2 Grand electrophoretogram；

Fig. 6-2. plasmid pDTA-iGb3S-A-B-C recombinates positive gram of Southern Blot confirmation of ES cell through probe 2 Grand electrophoretogram；

Fig. 7-1. GGTA1 allophenic mice photo；Fig. 7-2.iGb3S allophenic mice photo；

Fig. 8-1. GGTA1 hybrid mice photo；Fig. 8-2.iGb3S hybrid mice photo；

Fig. 9-1. GGTA1 hybrid mice genotype identification High fidelity PCR design of primers figure；

Fig. 9-2. iGb3S hybrid mice genotype identification High fidelity PCR design of primers figure；

Figure 10-1. GGTA1 hybrid mice genotype identification high-fidelity PC electrophoretogram；

Figure 10-2. iGb3S hybrid mice genotype identification high-fidelity PC electrophoretogram；

Figure 11-1. GGTA1 homozygote mouse photo；Figure 11-2.iGb3S homozygote mouse photo；

Figure 12-1. rejects the electrophoresis of GGTA1 genetic homozygous murine genes type identification high-fidelity PCR amplification genetic fragment Figure；

Figure 12-2. rejects the electrophoresis of iGb3S genetic homozygous murine genes type identification high-fidelity PCR amplification genetic fragment Figure；

Figure 13-1. rejects the schematic diagram of the Southern blot screening strategy of GGTA1 gene；

The schematic diagram of Figure 13-2. rejecting iGb3S gene Southern blot screening strategy；

Southern of Figure 14-1. genomic DNA through GGTA15 ' Probe1 (probe 1) and 3 ' Probe2 (probe 2) Blot figure；Upper figure is probe 1；The following figure is probe 2；

Southern of Figure 14-2. genomic DNA through 5 ' Probe1 of iGb3S (probe 1) and 3 ' Probe2 (probe 2) Blot figure；A, b is respectively probe 1 and probe 2；

The dual-gene knockout hybrid mice genomic DNA of Figure 15-1. GGTA1/iGb3S is detected through GGTA1 High fidelity PCR Electrophoretogram；

The dual-gene knockout hybrid mice genomic DNA of Figure 15-2. GGTA1/iGb3S is detected through iGb3S High fidelity PCR Electrophoretogram；

Figure 16 GGTA1 and iGb3S homozygote and the dual-gene mRNA detection of expression result figure for knocking out hybrid mice；a For the expression of GGTA1 gene knockout homozygote mouse GGTA1 gene；B is iGb3S gene knockout homozygote mouse iGb3S gene Expression；C is GGTA1/iGb3S and the dual-gene expression for knocking out hybrid mice iGb3S gene；D is GGTA1/iGb3S and double The expression of gene knockout hybrid mice GGTA1 gene.

The flow diagram of Figure 17 present invention production Gene Knock-Out Animal Model model；

A specific embodiment of the invention is only limitted to be explained further and illustrate the present invention, not to contents of the present invention structure At limitation.

Specific embodiment

Embodiment 1

1, the building of targeting vector

1.1 separate GGTA1 and iGb3S genomic DNA from normal C57BL/6J mouse respectively, then using PCR method point It Kuo Zeng not the end the 5th exon 5 ' of the 9th exon end C1, A and 3 ' B, C2 segment.

GGTA1 target practice site schematic diagram is as Figure 1-1: gene order is selected from the 2nd chromosomal gene of C57BL/6J mouse Group DNA (GRCm38.p1C57BL/6J, NCBI Reference Sequence:NC_000068.7).Gene Partial is rejected to be located at Exon 9, the length is the 246bp that the 9th exon catalytic domain overall length 694bp adds 5` (upstream) end, whole length are 940bp.Targeting vector length used in the present invention is 18.966kb (Fig. 1-1).

GGTA1 clones the primer sequence of A segment as shown in SEQ NO ID:3 and SEQ NO ID:4；

The nucleotide sequence of SEQ NO ID:3 are as follows: cgatGGTACCGATATCCGAGACCGCATAGTAAG；

The nucleotide sequence of SEQ NO ID:4 are as follows: cgatGAATTCCATATGTCGATGCCTGCCACACTG；

IGb3S target practice site schematic diagram is as shown in Figs. 1-2: gene order is selected from the 4th chromosomal gene of C57BL/6J mouse Group DNA (GRCm38.p1C57BL/6J, NCBI Reference Sequence:NC_000070.6).Gene Partial is rejected to be located at Exon 5, the length is the 255bp that the 5th exon catalytic domain overall length 687bp adds 5` (upstream) end, whole length are 942bp.Targeting vector length used in the present invention is 25.2kb (Fig. 1-2).

IGb3S clones the primer sequence of A segment as shown in SEQ NO ID:5 and SEQ NO ID:6；

The nucleotide sequence of SEQ NO ID:5 are as follows: CGATGGTACCGATATCACAGAATCTTTCTCTGTTTTC；

The nucleotide sequence of SEQ NO ID:6 are as follows: CGATGAATTCCATATGCAGGGTTTCTCTGTGTAGCC；

Amplification system and condition are as shown in table 1:

Table 1:

GGTA1 clones the primer sequence of B segment as shown in SEQ NO ID:7 and SEQ NO ID:8；

The nucleotide sequence of SEQ NO ID:7 are as follows: cgatGGATCCCATATGCTTCAAATTGTGATGGAAACTTGA

The nucleotide sequence of SEQ NO ID:8 are as follows: cgatGCGGCCGCGATATCAGCTTTTACAGACTGATGG

IGb3S clones the primer sequence of B segment as shown in SEQ NO ID:9 and SEQ NO ID:10；

The nucleotide sequence of SEQ NO ID:9 are as follows: CGATGGATCCCATATGCAGCCCTTCCCTGGCCAAGC

The nucleotide sequence of SEQ NO ID:10 are as follows: CGATGCGGCCGCGATATCCTGGTCACAGGAATGGCTTCA

Amplification system and condition are as shown in table 2:

Table 2:

Wherein the primer of GGTA1 cloned sequence A and segment B are as shown in table 3:

Table 3:

Wherein the primer of iGb3S cloned sequence A and segment B are as shown in table 4:

Table 4:

GGTA1 clones the primer sequence of C1 segment as shown in SEQ NO ID:19 and SEQ NO ID:20；

The nucleotide sequence of SEQ NO ID:19 are as follows: cgatCTCGAGATAATCACAAGCAAAGTGTCTGG

The nucleotide sequence of SEQ NO ID:20 are as follows:

CTATTAGGAGGATTGTTTACTTGATATCAGAAGAAGTACCAACACC

IGb3S clones the primer sequence of C1 segment as shown in SEQ NO ID:21 and SEQ NO ID:22；

The nucleotide sequence of SEQ NO ID:21 are as follows: CGATCTCGAGGTGGATGTCTCAGTGTGCGAA

The nucleotide sequence of SEQ NO ID:22 are as follows:

TACCGCAGACGGTGGATATCATTGACAGTCACTGAGCAA

Amplification system and condition are as shown in table 5:

Table 5:

GGTA1 clones the primer sequence of C2 segment as shown in SEQ NO ID:23 and SEQ NO ID:24；

The nucleotide sequence of SEQ NO ID:23 are as follows:

GGTGTTGGTACTTCTTCTGATATCAAGTAAACAATCCTCCTAATAG

The nucleotide sequence of SEQ NO ID:24 are as follows: cgatGCGGCCGCGAACACAAATGCCAGCCCAG

IGb3S clones the primer sequence of C2 segment as shown in SEQ NO ID:25 and SEQ NO ID:26；

The nucleotide sequence of SEQ NO ID:25 are as follows: TTGCTCAGTGACTGTCAATGATATCCACCGTCTGCGGTA

The nucleotide sequence of SEQ NO ID:26 are as follows: CGATGCGGCCGCCTATCGAGTGGTTATTCTCAGGG

Amplification system and condition are as shown in table 6:

Table 6:

Wherein the primer of GGTA1 cloned sequence C1 and C2 is as shown in table 7:

Table 7:

Wherein the primer of iGb3S cloned sequence C1 and C2 is as shown in table 8:

Table 8:

1.2 are connected to pBlunt carrier:

1.2.1 respectively by digestion identification, correct A and B segment be sequenced be consecutively connected to pL452 carrier, obtain pL452- GGTA1-A-B and pL452-iGb3S-A-B.

1.2.2 correct C1, C2 segment composition will be sequenced by Overlap PCR respectively and is connected to pDTA-Down carrier On, obtain pDTA-Down-GGTA1-C and pDTA-Down-iGb3S-C.

1.2.3 correct pL452-GGTA1-A-B and pL452-iGb3S-A-B EcoRV digestion will be connected respectively, be recycled Target fragment A-NeoR-B.

EcoRV restriction enzyme site is added on the forward primer of A segment and the reverse primer of B segment, so pL452-AB A-Neo-B segment can be scaled off with EcoRV.

Target fragment A-NeoR-B electricity is transferred to the BAC bacterium containing pBCTG respectively by 1.3 to be recombinated:

The A-Neo-B segment recovery purifying that will be scaled off respectively, is then transferred to by the method for electrotransformation containing pBCTG's Inside BAC bacterium.

1.4 carry out bacterium colony PCR detection A-NeoR-B segment respectively recombinates BAC, and identification amplified band is correct:

Suitable detection primer is designed at A and B segment both ends respectively, the sequence of detection primer is as shown in table 9,10；Pass through Whether the PCR at the both ends AB is correct to verify recombination.

Table 9:

Table 10:

The linearization process of 1.5pDTA-down-GGTA1-C and pDTA-Down-iGb3S-C:

EcoRV digestion handles pDTA-down-GGTA1-C and pDTA-Down-iGb3S-C respectively, makes its linearisation, recycling Then purpose band is transferred in the BAC bacterium for having recombinated NeoR by the method for electrotransformation by band is linearized respectively again.

1.6pDTA-GGTA1-C save GGTA1-NeoR BAC (AmpR+KanR)): pDTA-iGb3S-C saves iGb3S- NeoR BAC (AmpR+KanR):

After electricity goes to the BAC bacterium the inside for having recombinated the GGTA1 of NeoR after linearisation, by A- by way of homologous recombination In the rescue to pDTA-down-C of Neo-B segment；

After electricity goes to the BAC bacterium the inside for having recombinated the iGb3S of NeoR after linearisation, by A- by way of homologous recombination In the rescue to pDTA-down-C of Neo-B segment.

1.7 carry out PCR Testing and appraisal to the bacterium colony after C rescue respectively, the correct clone of recombination are expanded, in C1 and C2 Suitable detection primer is designed at both ends, and whether verify recombination by PCR correct, will recombinate correct bacterium colony and shakes bacterium and trains overnight It supports.

The sequence of detection primer is as shown in table 11:

Table 11-1:

Table 11-2:

After inverted Stbl3 competent cell, digestion verification is as shown in Figure 3.

Digestion detects pDTA-GGTA1-A-B-C: as shown in figure 3-1；

MfeI:1705bp+2104bp+3582bp+5249bp+6326bp；

HindIII+EcoRI:555bp+1129bp+6547bp+10735bp；

ScaI+NheI:229bp+588bp+1827bp+2798bp+3665bp+4128bp+5731bp.

Digestion detects pDTA-iGb3S-A-B-C: as shown in figure 3-2；

BgllI:740bp+2354bp+4252bp+5015bp+12389bp；

NheI:90bp+930bp+9890bp+13840bp；

SpeI:2850bp+3880bp+7110bp+10910bp.

1.8 GGTA1 digestions are correctly cloned to be identified through sequencing, is expanded through sequencing confirmation sequence correct plasmid.

Sequence correct plasmid sample proposes greatly rear digestion detection pDTA-GGTA1-A-B-C result and sees Fig. 4-1.

No. 1 plasmid of targeting vector pDTA-GGTA1-A-B-C proposes greatly rear digestion detection:

MfeI:1705bp+2104bp+3582bp+5249bp+6326bp；

HindIII+EcoRI:555bp+1129bp+6547bp+10735bp；

ScaI+NheI:229bp+588bp+1827bp+2798bp+3665bp+4128bp+5731bp.

Digestion is correctly cloned and is used for linearization for enzyme restriction electricity and turns embryonic stem cell (AscI).

IGb3S digestion is correctly cloned to be identified through sequencing, is expanded through sequencing confirmation sequence correct plasmid.

Sequence correct plasmid sample proposes greatly rear digestion detection pDTA-iGb3S-A-B-C result and sees Fig. 4-2.

No. 1 plasmid of targeting vector pDTA-iGb3S-A-B-C proposes greatly rear digestion detection:

BgllI:740bp+2354bp+4252bp+5015bp+12389bp；

NheI:90bp+930bp+9890bp+13840bp；

SpeI:2850bp+3880bp+7110bp+10910bp.

Digestion is correctly cloned and is used for linearization for enzyme restriction electricity and turns embryonic stem cell (AscI).

2, the recombination of embryonic cell

Linearisation recombinant DNA is turned into mode homologous recombination into embryonic stem cell by electricity respectively, then is screened by G418, sieve The embryonic stem cell not recombinated is removed, the remaining clone of picking carries out PCR and Southern screening, finally chooses correct gram It is grand to be injected.

Detailed step are as follows:

C57BL/6ES cell will be transfected after big upgrading grain pDTA-GGTA1-A-B-C linearisation, is screened, selected by G418 400 clones are screened with probe 1, and Fig. 1 is shown in the design of probe, and sequence is shown in Table 12-1.Reject the probe 1 of GGTA1 (Probe1) it is located at the outside of the end 5` homology arm, introduces the restriction enzyme site of NdeI at the end A segment 3`, therefore, wild type and prominent The size that probe marks after modification digestion is different, and determines whether to recombinate successfully with this, and confirm that recombination is special, and Nonrandom insertion.The positive colony screening of recombination ES cell is carried out with probe 1.As shown in fig. 5-1.Again by the positive colony selected Secondary screening is carried out with probe 2.The probe 2 (Probe2) for rejecting GGTA1 is located at the inside of the end 3` homology arm, wild type and mutant enzyme It cuts the result that rear probe 2 marks and sees Fig. 6-1, it was demonstrated that the positive colony that probe 1 filters out is confirmed by probe 2 will correctly be used for mouse The blastaea of embryo is injected.

C57BL/6ES cell will be transfected after big upgrading grain pDTA-iGb3S-A-B-C linearisation, is screened, selected by G418 200 clones are screened with probe 1, and Fig. 1 is shown in the design of probe, and sequence is shown in Table 12-2.Reject the probe 1 of iGb3S (Probe1) it is located at the outside of the end 5` homology arm, is held in A segment 3 ' and introduce the restriction enzyme site of NdeI, therefore, wild type and prominent What probe marked after modification digestion is of different sizes, determines whether to recombinate successfully with this, and confirm that recombination is special, Er Feisui The machine transplanting of rice enters.The positive colony screening of recombination ES cell is carried out with probe 1.As shown in Fig. 5-2.Reject the probe 1 of iGb3S (Probe1) it is located at the outside of the end 5` homology arm, is held in A segment 3 ' and introduce the restriction enzyme site of NdeI, therefore, wild type and prominent The size that probe marks after modification digestion is 25.2kb and 11.3kb respectively, determines whether recombinate successfully with this, and confirm again Group is special, rather than radom insertion.The positive colony selected is subjected to secondary screening with the probe 2 for rejecting iGb3S again.It rejects The probe 2 (Probe2) of iGb3S is located at the inside of the end 3` homology arm, the size that probe 2 marks after wild type and saltant type digestion It is that these positive colonies of 25.2kb and 12.3kb inject the blastaea for being used for mouse embryo respectively, as a result as in fig. 6-2.

The nucleotide sequence of probe 1 and probe 2 is as shown in table 12:

Table 12-1:

Table 12-2:

3, the blastaea injection of embryonic cell is recombinated

By microinjection (Microinjection) producer gene knock-out animal of blastaea, main process includes following Step:

The male mouse of 3.1 preparation infertility and false pregnancy female mice

3.1.1 anesthesia prepares: 7 week old hero mouse of selection weigh and 0.7% Nembutal sodium solution are injected intraperitoneally.

3.1.2 make arrangements for surgery instrument: ophthalmic tweezers 3, eye scissors 1, Shearing shears 1, alcolhol burner, one, alcohol watering can, Three-edged needle, suture, sterilized filter paper piece (diameter 15cm or so).

3.1.3 male mouse ligation: will anaesthetize male mouse abdomen away from cropping at genitals 2cm, after 70% alcohol swab cleaning disinfection, Be open skin layer and muscle layer respectively, clamps testis cellulite with ophthalmic tweezers and pulls out testis, epididymis, vas deferens, chooses vas deferens Middle section is tightened vas deferens and capillary with suture, is spaced at 1cm and is tightened again, with simply tightening suture Middle section cut, the ligation operation of side is completed, and ligatures other side again with the same manner, two sides completion is clamped with tweezers Cellulite backs into abdominal cavity, sutures muscle layer and skin layer, and single cage is raised after recovery.

3.1.4 Anabiosis after operation: ligation completes raising after two weeks, mates mating with 6 week old heat female mices, next day examines list after bolt Solely raising whether confirming gestation after 15 days, checks ligation success or not.

False pregnancy female mice prepares:

3.1.5 heat female mice is selected: select proestrum and oestrus female mice, tissue characterization is vagina crack, organize be Pale red is relatively wet to pink colour, all occurs many wrinkles in length and breadth on vagina dorsal lip and abdomen lip.

3.1.6 it mates with the male mouse of ligation: feelings female mice 1:1 will have been published and ligatured male mouse mating, secondary daily test bolt, single cage is raised standby With seeing on the day of bolt to be 0.5 day, common oviduct transplantation is with being shown in 0.5 day false pregnancy mouse of bolt, and uterine transplantation is with being shown in 2.5 days false pregnancy mouse of bolt.

3.2 surpass ovulation

3.2.1 hormone prepares: with 0.9% normal saline dilution pregnant mare serum (PMSG) and Human ChorionicGo-nadotropin (hCG), domestic hormone is diluted to 10IU/0.1ml, and import hormone is diluted to 5IU/0.1ml.

3.2.2 injection of hormone: preparing 4~6 week old female mices, is spaced 48 hours, every is injected intraperitoneally PMSG and hCG respectively 10IU.It mates and mates with same strain sexal maturity hero mouse after hCG injection, secondary daily test bolt, single cage raising is spare, sees that the bolt same day is 0.5 It, puts to death female mice and acquires blastaea after 3.5 days.

3.3 acquisition blastaeas

3.3.1 culture solution prepares: M2 culture solution is put into 37 DEG C of water-baths and incubates, KSOM culture solution and 1mg/ml hyaluronic acid Enzyme is made into culture drop in superclean bench, and it is spare to be put into 37 DEG C of carbon dioxide incubators incubations.

3.3.2 it dissects animal: after cervical dislocation execution is shown in that 3.5 days female mices of bolt, the disinfection of 70% alcohol swab wipe abdomen, opening Abdominal cavity takes its uterus, is put into the 35mm culture dish for having incubated 1ml M2 culture solution.

3.3.3 embryo collection: taking protokaryon embryo is put into fallopian tubal in 300 μ l hyaluronidase drops, micro- in entity Under mirror, magnum tubae uterinae is found, is punctured with 1ml syringe needle, egg mother cell group is discharged, micro- after 3~4 minutes Under the microscope, the granular cell around egg mother cell has digested, so that it may collect egg mother cell, KSOM training is put into after washes clean Nutrient solution drop, is put into spare in carbon dioxide incubator.Taking blastaea is put into uterus in 60mm culture dish, is inhaled with 1ml syringe M2 culture solution is taken, under stereomicroscope, syringe needle is inserted into uterus one end, rinses uterus, and collect blastaea under mirror, Be put into after washes clean KSOM culture drop, be put into carbon dioxide incubator cultivate it is spare.

The embryonic cell of recombination is imported blastaea by 3.4

Blastaea microinjection: ellipse injection drop is made on 60mm culture dish of M2 culture solution, paraffin oil is covered, will cultivate Ware is put under micromanipulation instrument mirror, and 30 blastaeas is taken to be put into injection drop, then is drawn stem cell and be added in injection drop, is adjusted micro- Endoscope objective lens adjust injection needle under suitable multiple, suck 50~100 stem cells, and blastaea is found under mirror, and ovum needle is held in operation, 10~15 embryonic cells are injected into 1 blastocoele by fixed blastaea, operation injection needle, complete injection.A collection of blastaea injection It is put back in KSOM culture drop after the completion, in carbon dioxide incubator culture, the blastaea of select carries out son after restoring 30 minutes Palace transplanting.

The transplanting of 3.5 fertilized eggs

Blastaea transplanting: coat at dorsal line of the false pregnancy mouse back far from 3~4cm of tail portion, after 70% alcohol swab cleaning disinfection Skin layer is cut off, then finds ovary position, cuts off muscle layer, ovary, fallopian tubal and uterus are taken out, fixed with haemostatic clamp, 8 blastaeas are drawn under stereomicroscope, while the false pregnancy mouse for having fixed ovary, fallopian tubal being put under microscope, are found Uterus and the few position of oviductal junction blood vessel pierce an osculum with 1ml syringe needle, the suction oviduct bead for having blastaea are inserted Enter, embryo is blown into, transplants the other side with the same manner.Postoperative skin suture layer, single cage is raised after animal revival, is waited to be implanted The fertilization egg implantation of embryonic cell is recombinated, female rat is become pregnant.

4, it mates, breed and builds and be

By ES cell (the C57BL/6ES cell GGTA1 of above-mentioned acquisition^-/-) positive colony injects through microinjection technique The fertilized eggs of C57BL/6 mouse (black), then it is implanted into the intrauterine of replace-conceive female rat (Balb/C, white), it is small to obtain chimera Mouse (black piebald).Chi-meric mice confirmation: the produce surviving of son after transplanting 17 days records produce surviving of son quantity, is according to hair color confirmation at 10~15 days It is no to have Chi-meric mice.Embryonic cell derives from C57BL/6, black；False pregnancy mouse Balb/C is white, so obtaining black splotch Piebald allophenic mice, (wherein Fig. 7-1 is the allophenic mice for rejecting GGTA1 gene to photo such as Fig. 7, and Fig. 7-2 is to reject The allophenic mice of iGb3S gene) shown in；Mouse germline is picked out by crossbreed gene.

It is built using the mating of following scheme and is: then mated with wild type hero mouse for female chimeras mouse, week old is selected to exist 10 weeks, there is mating experience, healthy and strong C57BL/6 mouse to mate therewith.Start to check Pregnancy after living together 1 week, such as Fruit discovery pregnancy individually raises female mice, until production.If it is Male chimeras body mouse, select 8 weeks or more, it is healthy and strong Wild type C57BL/6 female mice mates therewith, obtains F1 generation hybrid mice, (wherein Fig. 8-1 is to reject GGTA1 base to photo such as Fig. 8 The hybrid mice of cause, Fig. 8-2 are the hybrid mice for rejecting iGb3S gene) shown in.F1 generation hybrid mice again with wild type C57BL/6 mating, screens homozygote mouse.Crossbreed, sieve are carried out using the heterozygote or homozygote of GGTA1 and iGb3S Select the homozygote mouse of the dual-gene knockout of GGTA1 and iGb3S, and carry out conservation and build be.

5, genotype identification

The detection of purpose recombinant DNA integration in 5.1 heterozygotes and homozygote mouse:

Respectively from the tail point tissue extraction DNA of gene knockout animal (hybrid mice, Fig. 8), pass through high-fidelity PCR amplification The Partial Fragment of gene carries out the identification of genotype.Design of primers for genotype identification is shown in that Fig. 9, primer sequence are shown in Table 13, Its PCR condition is shown in Table 14.

Table 13-1. primer sequence

Table 13-2. primer sequence

14. PCR condition of table:

WT-F/WT-R Neo-F/WT-R

For the electrophoretogram of GGTA1 model mouse PCR amplification genetic fragment as shown in Figure 10-1, Figure 10-1 left hand view is GGTA1- WT-F/WT-R High fidelity PCR electrophoretogram；Wherein, it is 189bp by the segment of GGTA1-WT-F/WT-R pairing primer amplification, represents Wild type；Figure 10-1 right part of flg is GGTA1-Neo-F/WT-R High fidelity PCR electrophoretogram；Drawn by GGTA1-Neo-F/WT-R pairing The segment of object amplification is 302bp, represents recombinant type.5 heterozygote clones of acquisition are shown in Figure 10,10,13,2,3, No. 4 are sun Property clone.

For the electrophoretogram of iGb3S model mouse PCR amplification genetic fragment as shown in Figure 10-2, Figure 10-2 (a) is iGb3S-WT-F/ WT-R High fidelity PCR electrophoretogram；It is wherein 173bp by the segment of iGb3S-WT-F/WT-R pairing primer amplification；Figure 10-2 (b) For iGb3S-Neo-F/WT-R High fidelity PCR electrophoretogram, the segment by iGb3S-Neo-F/WT-R pairing primer amplification is 3 heterozygote clones of acquisition are shown in 276bp, Figure 10-2,2,3, No. 7 are positive colony.

Batch homozygote mouse is obtained through repeatedly breeding respectively.(wherein Figure 11-1 is to pick to homozygote mouse photo such as Figure 11 Except the homozygote mouse of GGTA1 gene, Figure 11-2 is the homozygote mouse for rejecting iGb3S gene) shown in, the F1 of GGTA1 is miscellaneous Zygote mouse and the mating of F1 hybrid mice, obtain the F2 homozygote mouse of GGTA1；By the F1 hybrid mice and F1 of iGb3S Hybrid mice mating, obtains the F2 homozygote mouse of iGb3S；Again by the F2 of the F2 homozygote mouse of GGTA1 and iGb3S homozygosis Sub- mouse carries out crossbreed, obtains GGTA1 and iGb3S Double knockout mice；Or by the F1 hybrid mice of GGTA1 with The F1 hybrid mice of iGb3S carries out crossbreed, screens GGTA1 and iGb3S Double knockout mice homozygote mouse. Apparent physiology shape is showed no within 20 weeks after GGTA1, iGb3S and GGTA1 and the birth of iGb3S Double knockout mice homozygote mouse Condition is abnormal, grow, develop and ingest, activity etc. it is normal.More long observation is also underway.

Homozygous genotype identification uses high-fidelity PCR amplification method (its primer and PCR condition are with table 13 and table 14), (wherein Figure 12-1 is the electrophoretogram for rejecting GGTA1 gene to the electrophoretogram of PCR amplification genetic fragment such as Figure 12, and Figure 12-2 is to reject The electrophoretogram of iGb3S gene) shown in.

After homozygote High fidelity PCR genotype screening, Southern Blot identification is carried out with probe 1 and probe 2, is confirmed Knock out the correctness and stability of gene.(wherein Figure 13-1 is to reject to schematic diagram such as Figure 13 of Southern blot screening strategy The schematic diagram of the Southern blot screening strategy of GGTA1 gene, Figure 13-2 are to reject iGb3S gene Southern blot sieve Select the schematic diagram of strategy), wherein having indicated the site of 5`-Probe1 and 3`-Probe 2 with short-term.Shown probe 1 and probe 2 design of primers is the same as table 12；Introduce the southern restriction enzyme site at both ends respectively on the outside of the end 5` and the end the 3` site loxP, respectively Digestion is digested with NdeI, gene knockout homozygote mouse is detected by the southern blot of 5`-Probe and 3`-Probe (Mut/Mut) only saltant type band can be generated, hybrid mice (Mut/WT) can generate wild type and saltant type band, and gene The wild-type mice (WT/WT) not knocked out can only generate wild type band.The size of each band is shown in Table 15.

The size of the Southern blot detection genetic fragment of table 15-1. GGTA1

	Probe	WT/WT	Mut/WT	Mut/Mut
					Ndel	5`-Probe 1	16.2kb	5.7kb/16.2kb	5.7kb
Ndel	3`-Probe 2	16.2kb	9.5kb/16.2kb	9.5kb

The size of the Southern blot detection genetic fragment of table 15-2. iGb3S

	Probe	WT/WT	Mut/WT	Mut/Mut
					Ndel	5`-Probe 1	25.2kb	25.2kb/11.3kb	11.3kb
Ndel	3`-Probe 2	25.2kb	25.2kb/12.3kb	12.3kb

Southern Blot 6 mouse (homozygote, heterozygote and each 2 of wild type) of total detection, extract rat-tail gene Group DNA.Its Southern Blot qualification result is respectively as (14-1 is the probe 1 (top) and probe 2 (lower part) of GGTA1 to Figure 14 Testing result；A, b of 14-2 is respectively the testing result of iGb3S probe 1, probe 2) shown in, it was confirmed that homozygote mouse is Through obtaining stable heredity.

The High fidelity PCR testing result of GGTA1 and iGb3S Double knockout mice heterozygote is shown in Figure 15, it was confirmed that GGTA1 With the presence of the unilateral side iGb3S chromosomal variation.

6, phenotypic evaluation

GGTA1 the and iGb3S Double knockout mice that the present invention obtains has new phenotype.General vital signs are normal, Growth and development is normal.Since the dual-gene rejecting animal model quotient of GGTA1 and iGb3S has not been reported, phenotypic characteristic needs into one Step observation.

Model mice gene expression dose phenotypic evaluation uses the RT-PCR identification method of mRNA expression.Take GGTA1 and iGb3S Homozygote and the dual-gene a variety of organs and tissues for knocking out hybrid mice, including liver, lung, kidney, spleen, heart, carry out the table of mRNA Up to measurement.RT-PCR the primer is shown in Table 16；Its testing result is shown in that (wherein scheme a is GGTA1KO mice organs tissue to Figure 16 The verification result of GGTA1mRNA；Scheme the verification result that b is iGb3S KO mice organs tissue iGb3S mRNA；Figure c is GGTA1 The dual-gene verification result for picking out hybrid mice organs and tissues iGb3S mRNA of KO and iGb3S KO；Scheme d be GGTA1 KO and The dual-gene verification result for picking out hybrid mice organs and tissues GGTA1mRNA of iGb3S KO), GGTA1 and iGb3S are individually knocked out Mouse loses the expression of corresponding mRNA completely；The hybrid mice of dual-gene rejecting significantly reduces GGTA1 and iGb3S The expression of mRNA.

Model mice protein expression level phenotypic evaluation inhibits method to carry out alpha-Gal using alpha-Gal ELISA The detection of antigen presentation.The expression of alpha-Gal antigen is regulated and controled by GGTA1 and iGb3S, GGTA1 and iGb3S gene expression lacks Mistake will will lead to substantially reducing or completely disappearing for alpha-Gal antigen presentation.Alpha-Gal ELISA inhibits method to use The specific antibody M86 of alpha-Gal antigen, first with M86 with tissue in alpha-Gal antigen reacted, then carry out from The unreacted remaining antibody of heart separation；Remaining antibody is coated with 96 orifice plates by alpha-Gal/BSA solid phase antigen to be measured, The expression quantity with the alpha-Gal antigen of tissue reaction is calculated with this.Its testing result is shown in Table 17, GGTA1 and iGb3S gene picks The expression quantity of the alpha-Gal antigen of homozygote mouse is compared compared with wild-type mice (WT) and is substantially reduced out.GGTA1 is The major regulatory gene of alpha-Gal, thus GGTA1 gene pick out so that the expression of alpha-Gal reduce 52%~ 94%；And the individual gene delection of iGb3S makes the expression of alpha-Gal reduce 8.8%~46.6%；GGTA1 and iGb3S It is dual-gene to pick out hybrid mice, it is compared compared with wild-type mice and significantly reduces the expression of Gal antigen.GGTA1 and iGb3S are biradical The expression of alpha-Gal antigen will be almost eliminated because picking out homozygote mouse, this will prove this section for the first time in the world Learn phenomenon.

The RT-PCR primer sequence of table 16-1:GGTA1

The RT-PCR primer sequence of table 16-2:iGb3S

The detection of expression result of table 17-1:GGTA1KO homozygote mouse alpha-Gal antigen

The detection of expression result of table 17-2:iGb3S KO model homozygote mouse alpha-Gal antigen

The detection of expression result of table 17-3:GGTA1/iGb3S Double knockout mice heterozygote alpha-Gal antigen

Alpha-Gal expression	Liver	Kidney	Spleen	Lungs	Heart
						Decrease rate (%WT)	52.4	60.1	71.2	59.4	48.3

7, gene picks out the life cycle of animal

The life cycle and wild animal of GGTA1/iGb3S Double knockout mice have no Life Cycle without significant difference Phase different report.The dual-gene life cycle for knocking out gene knockout mice of GGTA1/iGb3S is there is not yet shorten existing in the present invention As, and general state is normal.

Claims (8)

1. a kind of method for the non-human mammal for preparing the dual-gene knockout of GGTA1 and iGb3S, which is characterized in that including following Step:

(1) it constructs targeting vector: separating GGTA1 and iGb3S gene from genomic DNA respectively, obtained through the amplification of long-chain PCR method Homology arm is obtained, with the compound building GGTA1 targeting vector of antibiotic resistance genes and iGb3S targeting vector；

(2) GGTA1 targeting vector is transferred to embryonic cell, by recombination embryonic cell injection foster animal embryo, be transplanted to In pseudo pregnant animal body, mate with intact animal；Genotype verifying, screening-gene successful knockout are carried out to obtained chimeric animal Positive gene knock out chimeric animal；It further mates with wild animal, obtains the F1 generation heterozygote of GGTA1；

(3) iGB3S targeting vector is transferred to embryonic cell, by recombination embryonic cell injection foster animal embryo, be transplanted to In pseudo pregnant animal body, mate with intact animal；Genotype verifying, screening-gene successful knockout are carried out to obtained chimeric animal Positive gene knock out chimeric animal；It further mates with wild animal, obtains the F1 generation heterozygote of iGB3S；

(4) post-coitum between the F1 generation heterozygote of GGTA1 and the F1 generation heterozygote of iGB3S two chromosomes are obtained to be picked out GGTA1 and iGb3S homozygous animals；

(5) GGTA1 and iGB3S homozygous animals are mated again, the dual-gene of missing strikes screening GGTA1 and iGb3S simultaneously Except homozygous animals, and building is to obtain Gene Knock-Out Animal Model population；

Wherein, non-human mammal is mouse；

The GGTA1 gene knockout is the 9th exon of functional catalytic domain for knocking out GGTA1 gene, and nucleotide sequence is such as Shown in SEQ NO ID:1；The iGb3S gene knockout is the 5th exon of functional catalytic domain for knocking out iGb3S gene, Its nucleotide sequence is as shown in SEQ NO ID:2；Wherein, GGTA1 gene knockout is to replace α -1 with NeoR-PA, 3GT gene Functional the 9th exon of catalytic domain, the length for being replaced part are 694 bp of the 9th exon catalytic domain overall length plus the end 5` 246 bp, whole length are 940 bp；

The dual-gene expression quantity for knocking out alpha-Gal in homozygote mouse of GGTA1 and iGB3S is almost eliminated.

2. the method for the non-human mammal according to claim 1 for preparing the dual-gene knockout of GGTA1 and iGb3S, special Sign is that the mouse is C57BL mouse.

3. the method for the non-human mammal according to claim 1 for preparing the dual-gene knockout of GGTA1 and iGb3S, special Sign is that the GGTA1 targeting vector contains 5` homology arm, drug resistance antibiotic resistance gene NeoR-PA and 3` homology arm, uses NeoR- PA replaces the 9th exon respectively；It is same that the iGb3S targeting vector contains 5` homology arm, drug resistance antibiotic resistance gene NeoR-PA and 3` Source arm replaces the 5th exon with NeoR-PA respectively.

4. the method for the non-human mammal according to claim 1 for preparing the dual-gene knockout of GGTA1 and iGb3S, special Sign is, takes for the drug resistance antibiotic resistance gene end NeoR-PA 5` of GGTA1 targeting vector building and the homology arm sequence at the end 3` From the end 5` and the end 3` of the 9th exon of GGTA1 gene on mouse Article 2 chromosome, respectively 4.123 kb and 7.343 kb； Mouse the is derived from for the drug resistance antibiotic resistance gene end NeoR-PA 5` of iGb3S targeting vector building and the homology arm sequence at the end 3` The end 5` and the end 3` of the 5th exon of iGb3S gene, respectively 8.3kb and 9.1kb on four articles of chromosomes.

5. the method for the non-human mammal according to claim 1 for preparing the dual-gene knockout of GGTA1 and iGb3S, special The step of sign is, constructs targeting vector are as follows:

Wherein, the construction step of GGTA1 targeting vector are as follows:

(1) genomic DNA, the 9th exon 5 ' of amplification end C1 segment, A segment and 3 ' end B pieces are separated from normal C57BL/6J mouse Section, C2 segment, are connected respectively to pBlunt carrier；

(2) by digestion identification, correct A and B segment be sequenced be consecutively connected to pL452 carrier and obtain pL452-GGTA1-A-B, together When, it is connected on pDTA-Down carrier after correct C1, C2 segment composition will be sequenced by Overlap PCR；

(3) correct pL452-GGTA1-A-B EcoRV digestion will be connected, pL452-AB cuts out 2885 bp, 2930 bp two Band, recycles target fragment A-NeoR-B, and electricity turns the BAC bacterium containing pBCTG and recombinated；Bacterium colony PCR detects A-NeoR-B segment weight Group BAC, identification amplified band are correct；

(4) linearization process of pDTA-down-GGTA1-C, i.e. EcoRV digestion handle pDTA-Down-GGTA1-C, recycle mesh Band, electricity turn recombinated NeoR GGTA1 BAC bacterium；PDTA-GGTA1-C saves GGTA1-NeoR BAC (AmpR+ KanR)；PCR Testing and appraisal is carried out to the bacterium colony after C rescue, the correct clone of recombination is expanded, through Stbl3 digestion after purification Verifying；

The construction step of iGb3S targeting vector are as follows:

(1) genomic DNA, the 5th exon 5 ' of amplification end C1 segment, A segment and 3 ' end B pieces are separated from normal C57BL/6J mouse Section, C2 segment, are connected respectively to pBlunt carrier；

(2) by digestion identification, correct A and B segment be sequenced be consecutively connected to pL452 carrier and obtain pL452-iGb3S-A-B, together When, it is connected on pDTA-Down carrier after correct C1, C2 segment composition will be sequenced by Overlap PCR；

(3) correct pL452-iGb3S-A-B EcoRV digestion will be connected, pL452-AB cuts out 2880bp, 2885bp two Band, recycles target fragment A-NeoR-B, and electricity turns the BAC bacterium containing pBCTG and recombinated；Bacterium colony PCR detects A-NeoR-B segment weight Group BAC, identification amplified band are correct；

(4) linearization process of pDTA-down- iGb3S-C, i.e. EcoRV digestion handle pDTA-Down-iGb3S-C, recycling Purpose band, electricity turn to have recombinated the BAC bacterium of the iGb3S of NeoR；PDTA-iGb3S-C saves iGb3S-NeoR BAC (AmpR+KanR)；PCR Testing and appraisal is carried out to the bacterium colony after C rescue, the correct clone of recombination is expanded, is purified through Stbl3 Digestion verification afterwards.

6. the method for the non-human mammal according to claim 1 for preparing the dual-gene knockout of GGTA1 and iGb3S, special Sign is that step (2) is the following steps are included: the male mouse of preparation infertility and false pregnancy female rat；Super ovulation；Harvest fertilized eggs；Target DNA Preparation；Target DNA is imported into fertilized eggs；The transplanting of fertilized eggs；Head builds the detection of target DNA integration in mouse；Pass through hybridization Breeding gene picks out mouse germline.

7. a kind of method of the non-human mammal of dual-gene knockout as described in claim 1 is in biogenic material immunology Application in research；The biogenic material is animal derived biomaterial, and the animal derived biomaterial does not include Primate；The type of the animal derived biomaterial includes being derived from the intracorporal various tissues of animal, internal organs and its spreading out Biology, or by tissue or a variety of materials of internal organs preparation.

8. application according to claim 7, which is characterized in that the application is included in immunological investigation, immune toxicity Learn research, the safety of research, the Regulation Mechanism research of α-Gal antigen presentation, the immunological rejection of heterograft and its mechanism Property evaluation in application；The immunological investigation includes heterogenous animal tissue, the organ or animal derived that α-Gal antigen mediates The research of biomaterial and tumour immunity；The safety evaluatio includes animal derived biomaterial before clinical and experimental study Safety evaluatio and GGTA1 Gene Knock-Out Animal Model tissue, organ transplant immunological evaluation.