CN113106101B

CN113106101B - Preparation method and application of NOD genetic background double-gene defect mouse model

Info

Publication number: CN113106101B
Application number: CN202110513456.8A
Authority: CN
Inventors: 李贤�
Original assignee: Guangzhou Xy Biotechnology Co ltd
Current assignee: Guangzhou Xy Biotechnology Co ltd
Priority date: 2021-05-11
Filing date: 2021-05-11
Publication date: 2023-04-07
Anticipated expiration: 2041-05-11
Also published as: CN113106101A

Abstract

The invention provides a preparation method of an NOD genetic background double-gene immunodeficiency mouse model, which comprises the steps of knocking out DNA fragments of all coding regions of No. 2 exons of RAG1 genes and DNA fragments including No. 18-21 exons on JAK3 genes of NOD mice by using a gene editing technology; the sequence of the knocked-out RAG1 gene is shown as SEQ ID NO. 9, and the sequence of the knocked-out JAK3 gene is shown as SEQ ID NO. 10. The simultaneous knockout of RAG1 and JAK3 genes by using a CRISPR/Cas9 system in NOD genetic background mice is the first time at home and abroad, and the model is also a homozygote mouse immunodeficiency mouse model of RAG1 and JAK3 double knockout genes, and has high originality and very important basic research and practical application values.

Description

Preparation method and application of NOD genetic background double-gene defect mouse model

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a preparation method and application of a mouse model with the RAG1 gene and the JAK3 gene deleted simultaneously in the NOD genetic background.

Background

The RAG1 gene (recombination activating gene 1) is located in mouse chromosome 2, comprises 2 exons, and all coding regions are located in No. 2 exons, and the gene codes Rag1 protein consisting of 1040 amino acid residues. The phenomenon of somatic DNA rearrangement, also known as V (D) J recombination, which is unique to lymphocytes, is the molecular basis for antibody production by B cells and T cell receptor diversity in immune responses. Rag1 constitutes a heterodimer with its family protein Rag2, involved in The introduction of a DNA nick during immunoglobulin V (D) J recombination (Ru, h., p.zhang, and h.wu, structural diagnostics of Rag-mediated DNA clearance in V (D) J recombination. Curr Opin Struct Biol,2018.53, 178-186 schatz, d.g., m.a.oettiger, and d.baltimore, the V (D) J recombination activation gene, rag-1.cell,1989.59 (6): 1035-48.), loci at which V (D) J recombination can occur include The immunoglobulin heavy, kappa, and lambda light chains of B lymphocytes, and The T cell receptor alpha, beta, gamma, and delta chains of T lymphocytes. Mice with this gene deletion were unable to produce mature T cells due to the disruption of the V (D) J recombination process. Maturation of B cells is also affected without T cell help (Mombaerts, P., et al., RAG-1-specific microwave liver No. B and T lymphocytes. Cell,1992.68 (5): 869-77). However, loss of Rag1 function does not affect the innate immune response system, such as NK Cell maturation, and even increases in NK Cell numbers are observed in non-lymphoid tissues of Rag 1-deficient mice (Grundy, M.A. and C.L. sentman, immunological nucleic acid having expressed numbers of NK cells in non-lymphoid tissues, exp cells, 2006.312 (19): p.3920-6).

The JAK3 gene is located on mouse chromosome 8 and contains 23 exons, which encode receptor tyrosine kinases whose proteins belong to members of the Janus kinase family. Wherein the Jak3 protein is mainly expressed in immune cells, is a downstream signal molecule of a cytokine IL-2/4/7/9/15/21gamma receptor subunit and mediates a receptor/JAK 3/STAT signal pathway. Since NK precursor cell maturation in bone marrow requires stimulation of IL2/4/15/21, T cell maturation in thymus requires IL2/4/7/15/21 to be involved. Impaired function of the JAK3 gene directly affects the signaling of these cytokines. Thus, individuals with mutations in the JAK3 gene may develop T, B cells and NK cells deleted (Thomis, D.C., et al, defects in B lymphocyte activation and T lymphocyte activation in microwave lacking Jak3.Science,1995.270 (5237): 794-7 binding, M.L., et al, jak3 default blocks in lymphocyte cell differentiation Mucosal Immunol,2018.11 (1): 50-60.).

NOD mice were a japanese scholar to the inbred line Jcl: the separation of non-obese diabetic (NOD) and non-obese Normal (NOD) strains from cataract-susceptible sublines in the 6 th generation of inbred breeding of JCR mice is the most widely used mouse strain in type I diabetes research and humanization model establishment, and some classical humanized mouse models such as NOG and NSG are prepared in the genetic background of NOD mice at present. At present, no report about the successful preparation of an immunodeficient mouse model with the simultaneous deletion of the RAG1 gene and the JAK3 gene exists worldwide. The NOD mouse is a type I diabetes mouse, and a homozygous mouse after JAK3 is knocked out independently can suffer from diabetes after growing for 6-7 weeks, so that the death rate of newborn children is high; the mouse had a very large stomach at 9-12 weeks, and could not be pregnant at all. Therefore, the homozygous for the RAG1 gene knockout and the homozygous for the JAK3 gene knockout are difficult to integrate into the same mouse. Therefore, an immunodeficient mouse model with the RAG1 gene and the JAK3 gene deleted simultaneously is made in a mouse with NOD genetic background, so that a better mouse model is provided for starting the research of the mouse in the xenotransplantation, and a brand-new field of view is also opened for the research of the humanized mouse.

Disclosure of Invention

In order to solve the technical problems, the invention provides a preparation method of a mouse model with the RAG1 gene and the JAK3 gene deleted simultaneously under the NOD genetic background, and the method has strong operability and high construction power.

In order to achieve the purpose, the invention adopts the technical scheme that:

a preparation method of NOD genetic background double-gene defect mouse model comprises knocking out all coding region DNA fragments of No. 2 exon of RAG1 gene of NOD mouse and DNA fragments including No. 18-21 exon sequence on JAK3 gene by gene editing technology; the sequence of the knocked-out RAG1 gene is shown as SEQ ID NO. 9, and the sequence of the knocked-out JAK3 gene is shown as SEQ ID NO. 10.

According to the invention, the CRISPR/Cas9 system is utilized to realize specific knockout of key genes RAG1 and JAK3 for controlling a mouse immune system in an NOD genetic background mouse model for the first time, a mouse animal model with a severe combined immunodeficiency phenotype under an NOD genetic background is obtained, and immune cells in the model mouse completely disappear. Partial fragments of RAG1 and JAK3 genes are knocked out, the sequence of the knocked-out RAG1 gene is shown as SEQ ID NO. 9, and the sequence of the knocked-out JAK3 gene is shown as SEQ ID NO. 10.

Preferably, the gene editing technology is a CRISPR-Cas9 gene editing tool.

Preferably, the method comprises the following steps:

(1) Designing two sgRNA recognition sites aiming at No. 2 exon of RAG1 gene of NOD mice, wherein the recognition sequences are as follows:

Ragl-5sgRNA-1：TAATAGGTACCAGGGACGTTGGG(SEQ ID NO:1)

Ragl-5sgRNA-2：CTAATAGGTACCAGGGACGTTGG(SEQ ID NO:2)

Ragl-3sgRNA-1：CTTGGAGCAGCGGTAGCTGCAGG(SEQ ID NO:3)

Ragl-3sgRNA-2：AGCGGTAGCTGCAGGGGACCAGG(SEQ ID NO:4)；

(2) Designing sgRNA recognition sites at two ends aiming at No. 18 to No. 21 exons of JAK3 gene of NOD mice, wherein the recognition sequences are as follows:

Jak3-17sgRNA-1：CACAGACTGGCGTCACTGCATGG(SEQ ID NO:5)

Jak3-17sgRNA-2：CGACAAGATGTTCTCATCTGAGG(SEQ ID NO:6)

Jak3-21sgRNA-1：TTCTAGCTCCGTCCCTCCGCAGG(SEQ ID NO:7)

Jak3-21sgRNA-2：TCTAGCTCCGTCCCTCCGCAGGG(SEQ ID NO:8)；

(3) Obtaining corresponding sgRNA mRAN and Cas9mRNA by using an in vitro transcription technology; sgRNA mRAN and Cas9mRNA can be obtained using CRISPR/Cas9 system kits in the art.

(4) sgRNA mRAN and Cas9mRNA were co-injected into the zygote cells of NOD mice, which were then transplanted into recipient mothers to generate a RAG1 and JAK3 double gene-deleted NOD mouse model.

The inventors found through a large number of experimental studies that the selection of the site of the knockout is a key factor in gene inactivation. Even if the gene can be knocked out technically, the obtained mice do not necessarily have relevant physiological and pathological phenotypes. In the present invention, other sites on the RAG1 gene are knocked out, and the immune cells of the mouse are detected to find that the mouse still contains the same number of immune cells as the mouse without knocking out the RAG1 gene. As shown in FIG. 5, the T cells, B cells, and NK cells of the RAG1 knockout NOD mice were not significantly different from those of normal NOD mice. In the invention, other sites on the JAK3 gene are knocked out, and the immune cells of the mice are detected to find that the mice still contain the same number of immune cells as the mice without knocking out the JAK3 gene. As shown in FIG. 6, in JAK3 knockout NOD mice, T cells, B cells and NK cells were not much different from those in normal NOD mice. In the RAG1 and JAK3 double knockout NOD mice of the present invention, T cells and B cells were not detected at all, and NK cells were significantly less than those of normal NOD mice, as shown in FIG. 4. This indicates that the sgRNA-bound target of the invention can completely not express a receptor supporting maturation of T cells, B cells and NK cells, and NOD mice completely without immunological competence can be obtained.

In addition, because NOD mice are type I diabetes mellitus mice, homozygous mice after JAK3 is knocked out independently can suffer from diabetes mellitus after growing for 6-7 weeks, and the death rate of newborn children is high; the mouse had a very large stomach at 9-12 weeks and could not be pregnant at all. Therefore, the homozygous for the RAG1 gene knockout and the homozygous for the JAK3 gene knockout are difficult to integrate into the same mouse. The selected sgRNA target spot can also relieve the symptoms of diabetes of NOD mice, delay the onset time of diabetes, strive for time for reproduction, and improve the conception probability, and the JAK3 homozygote mice can only be existed when the maturation of T cells is inhibited in vivo in the existing RAG1 homozygote mice, otherwise, the diabetes of the JAK3 mice is very early.

Further, the method further comprises the step of identifying the genotype of the F0 generation NOD mouse by using the primer.

Further, the primers used for genotyping the F0-generation NOD mice were as follows:

rag1 forward primer: 5 'CTGGGAAGCATGGTGAGC 3' (SEQ ID NO: 11)

Rag1 reverse primer: 5'TTGGGCAGTAAGAAAATGTGGAC 3' (SEQ ID NO: 12)

Jak3 forward primer: 5 'GGAGCCCGCCAAAGCAGAACC 3' (SEQ ID NO: 13)

Jak3 reverse primer: 5'CAGGCCCCATCATGCTCAGGAACT 3' (SEQ ID NO: 14).

Further, the method comprises the steps of examining the F2 generation mouse immune system for F0 generation NOD mice and examining pathological tissues.

Further, the index for examining the immune system of F2 generation mice of F0 generation NOD mice adopts a flow cytometry edge separation method.

Further, the method further comprises hybridizing the F0 generation NOD mice genotypically identified as double-gene deleted with NOD mice to obtain RAG1 and JAK3 double-gene knockout heterozygous F1 generation daughter mice; and then, the F1 generation of mice are mated automatically to obtain F2 generation of mice with RAG1 and JAK3 double gene knockout positive homozygotes.

The invention also provides application of the method in preparing animal models for research in the fields of tumor, transplantation, immunology and inflammation.

The invention also provides application of the DNA segment shown as SEQ ID NO. 1-4 in targeted knockout of mouse RAG1 gene No. 2 exon as a target sequence for specific recognition of sgRNA; and the application of the DNA segment shown in SEQ ID NO. 1-4 as a target sequence of sgRNA specific recognition in targeted knockout of mouse JAK3 gene exon 18-21.

The invention has the beneficial effects that: the simultaneous knockout of RAG1 and JAK3 genes by using a CRISPR/Cas9 system in NOD genetic background mice is the first time at home and abroad, and the model is also a homozygote mouse immunodeficiency mouse model of RAG1 and JAK3 double knockout genes, and has high originality and very important basic research and practical application values.

Drawings

FIG. 1 is a schematic diagram of a scheme for knockout of exon 2 of the RAG1 gene;

FIG. 2 is a schematic diagram of a scheme for knocking out exons 18 to 21 of the JAK3 gene;

FIG. 3 is a diagram showing the results of gene identification of the F0 generation double gene knockout NOD (finally showing that the 9 th and 64 th mice are RAG1/JAK3 double gene knockout positive mice);

FIG. 4 is a schematic diagram showing the results of detecting immune cells by flow cytometry in RAG1/JAK3 double knockout NOD mice (eventually showing that T cells and B cells are not detected in the mice, and NK cells are significantly less than those in normal NOD mice);

FIG. 5 is a schematic diagram showing the flow cytometry results of immune cells in NOD mice with other sites of RAG1 gene knockout (eventually showing that T cells, B cells and NK cells of the mice are not much different from those of normal NOD mice);

FIG. 6 is a diagram showing the result of detecting immune cells in NOD mice with other JAK3 gene knockout sites by flow cytometry (finally, it is shown that T cells, B cells and NK cells of the mice are not much different from those of normal NOD mice).

Detailed Description

In order to show technical solutions, objects and advantages of the present invention more concisely and clearly, the technical solutions of the present invention are described in detail below with reference to specific embodiments. Unless otherwise specified, the reagents involved in the examples of the present invention are all commercially available products, and all of them are commercially available.

Example 1 preparation of mice with NOD deleted in RAG1 and JAK3 genes

1. Determining a knockout region

All regions of exon 2 are knocked out according to RAG1 gene domain selection, and the sequence of the knocked-out RAG1 gene is shown as SEQ ID NO 1. All regions of exons 18-21 were knocked out based on JAK3 gene domain selection.

2. Determining the sequence of recognition target sites of sgRNA on RAG1 and JAK3 genes:

knockout was performed for exon 2 of the RAG1 gene according to the knockout scheme shown in fig. 1, with sgRNA recognition sites located at Intron 1 and 3'utr of mouse Ragl gene, respectively, and the target sites for sgRNA sequence binding were designed according to exon Intron 1 and 3' utr, respectively:

the intron 1 sequence is as follows:

AAACAATTATTGAGCACCTAATAGGTACCAGGGACGTTGGGAGATGAAATTAGTCAAAGGCTCTGTGTTCAAAGATGTCAAGGTTTTTGTGGAAAGGGAATTAAATTTCACATATACATGTATTTAAAATCATGCATATATTTAGTATAAGTGTCCCCAAATATTGTCAG

the sgRNA recognizes the target sequence as follows:

Ragl-5sgRNA-1：TAATAGGTACCAGGGACGTTGGG(SEQ ID NO:1)

Ragl-5sgRNA-2：CTAATAGGTACCAGGGACGTTGG(SEQ ID NO:2)

3' UTR sequence is as follows:

GAGCCGTTTAGTGAGGCCAGAAGAGCAACAGGAGAAATCAGTTATTTGGAAGCTCAATAACTTGGAGCAGCGGTAGCTGCAGGGGACCAGGGATGCACAGAGATATGTGTGTGCATGCCACTGTGTGCCATGAAAATTGAAGCCAAGGCTGTC

the sgRNA recognizes the target sequence as follows:

Ragl-3sgRNA-1：CTTGGAGCAGCGGTAGCTGCAGG(SEQ ID NO:3)

Ragl-3sgRNA-2：AGCGGTAGCTGCAGGGGACCAGG(SEQ ID NO:4)

knocking out exons 18-21 of JAK3 gene according to a knocking-out scheme shown in figure 2, wherein sgRNA recognition sites at two ends are respectively positioned on intron 17 and intron 21 of mouse Jak3 gene, and the sgRNA sequence combined targets are respectively designed according to intron 17 and intron 21:

intron 17 sequence is as follows:

TCATGGGTGCTGGGATTTGGTTTTATTTTGTTATTCTTAAATTTTGTCGACAAGATGTTCTCATCTGAGGGTATCCAAGTCACAGACTGGCGTCACTGCATGGCTCTGTCTCTCGGGTCC

sgRNA recognizes the target sequence as follows:

Jak3-17sgRNA-1：CACAGACTGGCGTCACTGCATGG(SEQ ID NO:5)

Jak3-17sgRNA-2：CGACAAGATGTTCTCATCTGAGG(SEQ ID NO:6)

intron 21 sequence is as follows:

CCCACCCCACAGAGTGATGCTCCACTCGGTTTAGCCACGCCCCCCATTGTTCTGGCTCCATCCTCCTTGACCAGTCTGCAAAGCCCGTCACAGGTCTCTTTTCTAGCTCCGTCCCTCCGCAGGGCCCTGCCTTTCACGCTCTATGGGGTC

sgRNA recognizes the target sequence as follows:

Jak3-21sgRNA-1：TTCTAGCTCCGTCCCTCCGCAGG(SEQ ID NO:7)

Jak3-21sgRNA-2：TCTAGCTCCGTCCCTCCGCAGGG(SEQ ID NO:8)

3. in vitro transcription

(1) In vitro transcription is carried out to obtain the corresponding sgRNA mRNA, and the specific method is as follows:

transcription of sgrnas was performed using the T7-ShortScript in vitro transcription kit (AM 1354): PCR was performed using primertstar Max system (table 1), sgRNA-F, sgRNA-R as primers, and the correctly sequenced puc57-sgRNA plasmid (diluted 30 in 1) as a template, and the PCR product was purified to prepare a sgRNA transcription template. Obtaining an in vitro transcription product; the sgRNA mRNA was recovered from the band using Ambion RNA purification kit (Ambion, AM 1909) according to the instructions.

Table 1: PCR reaction system

Reagent (TakaraR 045)	Volume (mu 1)	Specification of
			Prime STARMaxPremix(2x)	12	/
ddH ₂ O	10	/
			Primer	1	10μM
Primer
		1	10μM
Template
		1

(2) Obtaining mRNA for Cas9 nuclease

In vitro transcription to obtain mRNA for Cas9 nuclease: after obtaining in vitro transcription products following the protocol of the invitrogen kit (invitrogen, AMB 1345-5) of the in vitro transcription kit, cas9mRNA was recovered using the Ambion RNA purification kit (Ambion, AM 1909).

4. Establishment of RAG1 and JAK3 gene deletion NOD mouse model

The obtained sgRNA mRNA and Cas9mRNA were injected into fertilized egg cells of mice within NOD by a microinjection system, and the fertilized eggs were implanted into the uterus of pseudopregnant females. Postnatal offspring were F0 offspring of RAG1/JAK3 double gene knock-out mice. And (3) hybridizing a RAG1/JAK3 double-gene knockout positive F0 generation mice and NOD mice to obtain RAG1/JAK3 double-gene knockout heterozygous F1 generation mice. And mating the F1 generation of mice to obtain RAG1/JAK3 double-gene knockout positive F2 generation of mice.

5. RAG1 and JAK3 gene deletion NOD mouse genome identification

The specific steps of gene identification comprise the following steps:

(1) Rat tail cleavage and preparation of genomic DNA templates

Mu.l of lysate A (500 mM NaOH) was added to rat tail and incubated at 95 ℃ for 30 minutes. Then adding lysis solution B (50 mM Tris-HCl, pH 8.2), evenly mixing, centrifuging at 10000rpm for 1 minute, and obtaining supernatant as the gene identification PCR template.

(2) The gene identification PCR primer sequences and product sizes are shown in table 2 below:

table 2:

rag1 forward primer	5'CTGGGAAGCATGGGTGAGC 3'(SEQ ID NO:11)
		Rag1 reverse primer	5'TTGGGCAGTAAGAAAATGTGGAC 3'(SEQ ID NO:12)
Length of product	Wild type: 5.6Kb; knock-out mutants: 1.8Kb
		Jak3 forward primer	5'GGAGCCCGCCAAAGTCAGAACC3'(SEQ ID NO:13)
Jak3 reverse primer	5'CAGGCCCCATCATGCTCAGGAACT 3'(SEQ ID NO:14)
		Length of product	Wild type: 2.9Kb; knock-out mutant: 1.4Kb

The gene identification PCR system and conditions are shown in tables 3 and 4:

table 3:

table 4:

(3) The PCR products were separated by electrophoresis on a 1% agarose gel and recorded by photography.

The F0 mouse gene identification results are shown in FIG. 3, wherein the 9 and 64 mice are RAG1/JAK3 double gene knockout positive NOD mice.

6. Evaluation of immune system indexes of RAG1 and JAK3 gene-deleted NOD mice

The obtained RAG1 and JAK3 gene-deleted NOD mice have pathological phenotypes of unhealthy immune systems, can cause the disturbance of the immune systems of the mice (namely T, B cells and NK cells without developmental maturity), and are important for confirming the effectiveness of strain preparation. Detecting the immune index (mainly T/B/NK cells) of the mouse by flow cytometry and judging the immune system index of the mouse. Peripheral blood lymphocytes of wild and RAG1/JAK3 double-gene knockout positive mice are collected, and after lysis of erythrocytes and Fc receptor, the cells are stained with CD45/CD3/CD19/CD4/CD8/CD49B antibodies for flow cytometry analysis (FACS identification of peripheral blood leukocytes (all cells are CD45 +), B cells are CD3-CD19+; T cells are CD3+ CD19-; T helper is CD3+ CD4+ CD8-; T cytoxic is CD3+ CD4-CD8+; NK is CD3-CD49B +).

As shown in FIG. 4, T cells and B cells were not found in peripheral blood of RAG1/JAK3 double knockout NOD mice, and NK cells were significantly smaller than those of normal NOD mice. This indicates that the NOD mice constructed by the invention have serious physiological characteristics of immunodeficiency.

Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the protection scope of the present invention, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Sequence listing

<110> Guangzhou Xinyi Biotechnology Ltd

<120> preparation method and application of NOD genetic background double-gene defect mouse model

<141> 2021-05-11

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 1

taataggtac cagggacgtt ggg 23

<210> 2

<211> 23

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 2

ctaataggta ccagggacgt tgg 23

<210> 3

<211> 23

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 3

cttggagcag cggtagctgc agg 23

<210> 4

<211> 23

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 4

agcggtagct gcaggggacc agg 23

<210> 5

<211> 23

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 5

cacagactgg cgtcactgca tgg 23

<210> 6

<211> 23

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 6

cgacaagatg ttctcatctg agg 23

<210> 7

<211> 23

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 7

ttctagctcc gtccctccgc agg 23

<210> 8

<211> 23

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 8

tctagctccg tccctccgca ggg 23

<210> 9

<211> 852

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 9

cctttcaagt agtgagtaat tagtttcttt gggtttgtag ctttatcatc tctttatgac 60

ccgttcagaa gaaataaaca accaatctcc cggaagaatg ctttaaaaat ctagaaatat 120

attgtccagt tagtgtaatg aggctaatac aatgtgagaa atattacttt tctctggttt 180

agtatccagt ttatcattgc atttattcac aaacaattat tgagcaccta ataggtacca 240

gggatgcaca gagatatgtg tgtgcatgcc actgtgtgcc atgaaaattg aagccaaggc 300

tgtcaaagga cggccaagca tgctaggaaa gaaatttgtc ttgggcatgg tttttttttc 360

cacttcaatt tattatattt tgtgctgaga tctatgcagt ttttttgcca tgtcatattt 420

tttggtcata ttttatagga ctattttgta aatttcacat atgttgattt atcctacaag 480

atttaaagga gcctttgagg tttctctaac aaccctgtac atgtgtagga cgtggtggcc 540

tttccaaggg atctcagtgc attttctcgt tgctacattt atgcataaat aaattaaacc 600

aagagaggtt tcagaaaatc atccttttcc aggtttaaat ggcctcagta ttgtcacctt 660

cagtgtctag gaggtcatct ggtgtcataa atttttcaat aatgaagtta gagaatgcac 720

ctgttagcta cagctaccta ttaagtataa taaagtcatg cttgcttagt tatctagagc 780

cagctctggt tgtttatttt tactttttaa ttaagagtca tttatagcct tagtgctttt 840

ctatgtaatc tc 852

<210> 10

<211> 958

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 10

ggggggcggc aggggcggag agggtccctg agctgggtcc aggaagtttg ctggttctag 60

cagtcagcgt gaactaagac agctgctgca acaaacctaa gacccgatct gcatttgttt 120

tgcagtgtag cccaggttgg tgttttacaa tgtagcccaa actagcatct caggctggat 180

ttctccctgc ttcaccatca tgggtgctgg gatttggttt tattttgtta ttcttaaatt 240

ttgtcgacaa gatgttctca tctgagggta tccaagtcac agaccctgcc tttcacgctc 300

tatggggtcc gcccctctta gcgtcttcta cttctccgtc catcttactc tgctttcccg 360

tcgctggctc ctccccttat gacatttacg cctatctgcc caggcacttt tccagctgcc 420

tgtcatccaa tgctgaccca ctcaaagccc cgtccttaac acttagagtc cctctctcag 480

cctggccacg cccacaggtc accagacagc ctctgagtcg ccttctgggg gccgtgctag 540

taggaagtct cctgttcacg cccctttcct caccccagac tggccatact tcacattgac 600

gactccctcc ccaggccact gtttcacacc ctgcccactc tcctcactgg ccacaccaca 660

cctctgtccg gctctcaggt atgccccgga gtccctatct gacaacatct tctcccgcca 720

atctgacgtg tggagcttcg gagtggtgtt gtacgagctc ttcacctact gcgacaagag 780

ctgcagccca tccgctgtgc gtcgcctgcc ccatccctcg gtcctccctc ttgatctcca 840

aatcccctcc tgacctctag cccctatcct gaccccagcc cttcctcctg acctccagat 900

catctcctga cctcagtcct ccctccggaa tcccagccct tcctcctcat ctccagat 958

<210> 11

<211> 19

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 11

ctgggaagca tgggtgagc 19

<210> 12

<211> 23

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 12

ttgggcagta agaaaatgtg gac 23

<210> 13

<211> 22

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 13

ggagcccgcc aaagtcagaa cc 22

<210> 14

<211> 24

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 14

caggccccat catgctcagg aact 24

Claims

1. A method for preparing NOD genetic background double-gene immunodeficiency mouse model is characterized in that NOD mouse is knocked out by gene editing technologyRAG1DNA fragment of all coding region of exon 2 of gene andJAK3DNA fragments including exon sequences 18-21 in the gene; after knockoutRAG1The gene sequence is shown as SEQ ID NO 9, after knockoutJAK3The gene sequence is shown as SEQ ID NO. 10;

the gene editing technology is a CRISPR-Cas9 gene editing tool, and specifically comprises the following operation steps:

(1) Against NOD miceRAG1The No. 2 exon of the gene is designed with two sgRNA recognition sites, and the recognition sequences are as follows:

Ragl-5sgRNA -1： TAATAGGTACCAGGGACGTTGGG（SEQ ID NO:1）

Ragl-5sgRNA -2： CTAATAGGTACCAGGGACGTTGG（SEQ ID NO:2）

Ragl-3sgRNA -1：CTTGGAGCAGCGGTAGCTGCAGG（SEQ ID NO:3）

Ragl-3sgRNA -2：AGCGGTAGCTGCAGGGGACCAGG（SEQ ID NO:4）；

(2) Against NOD miceJAK3The method comprises the following steps of designing sgRNA recognition sites at two ends of exons 18 to 21 of a gene, wherein the recognition sequences are as follows:

Jak3-17sgRNA -1： CACAGACTGGCGTCACTGCATGG （SEQ ID NO:5）

Jak3-17sgRNA -2：CGACAAGATGTTCTCATCTGAGG（SEQ ID NO:6）

Jak3-21sgRNA -1 ：TTCTAGCTCCGTCCCTCCGCAGG（SEQ ID NO:7）

Jak3-21sgRNA -2 ：TCTAGCTCCGTCCCTCCGCAGGG（SEQ ID NO:8）；

(3) Obtaining corresponding sgRNA mRNA and Cas9mRNA by using an in vitro transcription technology;

(4) Co-injecting the sgRNA mRNA and the Cas9mRNA into a fertilized egg cell of an NOD mouse, transplanting the fertilized egg into the uterus of a pseudopregnant female mouse, hybridizing the F0-generation mice and the NOD mouse to obtain a double-gene knockout heterozygous F1-generation mice, and self-mating the F1-generation mice to obtain the SgRNA mRNA and the Cas9mRNARAG1/JAK3Double knockout positive F2 generation mice.

2. The method of claim 1, further comprising the step of genotyping F0-generation NOD mice using primers.

3. The method of claim 2, wherein the F0 NOD mouse genotype is identified using the following primers:

rag1 forward primer: 5 'CTGGGAAGCATGGGTGAGC' (SEQ ID NO: 11)

Rag1 reverse primer: 5 'TTGGGCAGTAAGAAAATGTGGAC' (SEQ ID NO: 12)

Jak3 forward primer: 5 'GGAGCCCGCCAAAGTCAGAACC' (SEQ ID NO: 13)

Jak3 reverse primer: 5'CAGGCCCCATCATGCTCAGGAACT 3' (SEQ ID NO: 14).

4. The method of claim 1, further comprising the steps of examining an index of the immune system of the F0-generation NOD mice and examining pathological tissues.

5. The method of claim 4, wherein the index for examining the immune system of F2 mice in F0 NOD mice is determined by flow cytometry.

6. Use of the method of any one of claims 1~5 in the preparation of an immunodeficient mouse model.

7. The NOD targeted knockout mouse of the DNA fragment of SEQ ID NO 1~8 as set forth in claim 1RAG1Genes andJAK3application in gene, DNA fragment shown in SEQ ID NO 1~4 is sgRNA specific recognitionRAG1The target sequence of the exon No. 2 of the gene, and the DNA fragment shown in SEQ ID NO:5~8 are sgRNA specific recognitionJAK3Target sequences of exons 18 to 21 of the gene.