WO2017143894A1 - Immunodeficient mouse, preparation method therefor, and application thereof - Google Patents

Abstract

Provided are an immunodeficient mouse, a preparation method therefor, and an application thereof. The preparation method relates to knocking out the Foxnl gene or Fah gene of a NOD-Scid IL2rg-/- immunodeficient mouse (NSI mouse). By knocking out the Fah gene of an NSI mouse, an NSIF mouse is obtained. The NSIF mouse can be used for efficiently building a novel humanized mouse model which can be used for the physiological and pathological studies of the liver. By knocking out the Foxnl gene of an NSI mouse, an NSIN mouse is obtained. The NSIN mouse is hairless and is further deficient in its immune system.

Description

[Name of invention established by ISA according to Rule 37.2] Immunodeficient mice, preparation method and application thereof Technical field

The invention belongs to the technical field of animal genetic engineering, and particularly relates to an immunodeficient mouse, a preparation method thereof and application thereof.

Background technique

The liver plays a strategic role in the body's function of detoxification and metabolism of foreign compounds. Due to the low cost of breeding, rapid reproduction, short experimental period, clear genetic background, and high experimental repeatability, the researchers used mice to construct various mouse liver disease models, such as liver injury, viral hepatitis, and liver fiber. Liver disease, liver cancer, etc., for liver disease research. However, these models are difficult to compensate for the large species differences between humans and mice (for example, many liver metabolic enzymes are species-specific, and some human liver viruses such as HBV, HCV, etc. cannot infect mouse liver cells). Outcomes or therapeutic drugs cannot reproduce the same effect on the human body. The in vitro culture of human liver cells is limited to the survival of human primary cells in vitro, cryopreservation techniques, and the inability to reproduce organ coordination in vivo.

So, the researchers conducted a liver-humanized mouse study. A humanized mouse model of the liver, which transplants and reconstructs human liver tissue or organs in immunodeficient mice that can induce liver damage. The higher the degree of immunodeficiency of the recipient mice used in the liver humanization model, the smaller the rejection of xenogeneic and allografts; and the immune cells participate in the inflammatory response caused by liver damage, and if the immune system is perfect, the liver is induced Injury and human liver tissue or organs are not reconstituted while accelerating liver failure and increasing mortality in mice. In addition, controlled inducible mouse liver cell damage provides sufficient space for the survival, proliferation and development of transplanted human liver cells.

Optimal immunodeficient mice that can induce liver damage in the prior art: TK-NOG (Thymidine Kinase, thymidine kinase-deficient NOD-Scid IL2rg-/-) immunodeficient mice (Masami) Hasegawa et al., 2013), uPA-SCID (urokinase-type Plasminogen Activator), immunodeficient mice (Mercer et al., 2001), FRG (Fah-/- Rag2-/-il2γc-/-) and FRGN (Fah-/-Rag2-/-il2γc-/-NOD) immunodeficient mice (Hisaya Azuma et al., 2007; Elizabeth M. Wilson et al., 2014). However, TK transgenic male mice are infertile and can only pass heterozygous female and wild-type male mice without homozygous mouse strains, while uPA mice have very high requirements for donor liver cells, and uPA gene deletion can cause Rapid and severe liver damage with uncontrollable selectivity. Liver-induced injury mice based on Fah knockout, such as FRG and FRGN, are the most widely used, controllable, and highly portable liver model tools, and can be used to protect liver drugs NTBC (2-nitro-4). -Trifluorotoluene-1,3 cyclohexanedione) controls Fah deletion-induced liver damage (Grompe et al., 1995;).

However, the immune gene defect backgrounds of FRG and FRGN mice, Rag2-/-IL2rg-/- and NOD Rag2-/-IL2rg-/-, are not the most immunocomposed in the prior art, in the construction of a humanized mouse model of liver. It will affect the transplantation efficiency by causing certain rejection of foreign heterogeneous (human) and allogeneic cells. Wei Ye et al., Journal of Hematology & Oncology 2015 reported that NOD-scid IL2rg-/- mice had the highest degree of immunodeficiency, and the humanized mouse model was the best. Fah knockout mice based on the NOD-scid IL2rg-/- immunodeficiency background will be the best humanized mouse model tool for liver disease. However, researchers have encountered a series of difficulties in exploring the development of this genotype mouse. Due to the complex genetic background of NOD (non-obese diabetic) mice and spontaneous non-obese diabetes, gene knockout in NOD mice may induce lethal or diabetic disease (Baxter AG et al., 1995; Nichols J et Al., 2009;). Furthermore, scid (Severe Combined Immunodeficiency Disease) mice have defects in Prkdc gene, partial loss of DNA repair ability, affecting gene repair after off-targeting of gene knockout tools, and increasing mortality in knockout mice. And some researchers found that NOD-scid Fah-/- mice died rapidly after NTBC (liver protection drug) discontinuation, and mice died (Blunt, T. et al., 1996). NOD-scid IL2rg has a higher genetic background defect than NOD and NOD-scid mice.

In addition, all current highly immunodeficient mice (with missing immune cells such as B, T, NK, etc.) include NOD-Scid IL2rg-/-, Rag2-/-IL2rg-/-, Rag1-/-IL2rg-/-, etc. They are extremely efficient in constructing tumor models. However, these mice have hair. When detecting growth and distribution of tumor cells with fluorescent markers (especially fluorescent proteins) in vivo using techniques such as in vivo imaging, hair is tested for results. Both have serious interference.

Summary of the invention

In view of the deficiencies and practical needs of the prior art, the present invention provides an immunodeficient mouse, which is better than the existing NSI or other third generation immunodeficient mice, and a preparation method and application thereof. Effect.

To this end, the present invention employs the following technical solutions:

In a first aspect, the present invention provides a method of gene knockout using NOD-Scid IL2rg-/- immunodeficient mice (NSI mice), which knocks out the Fah gene or the Foxn1 gene.

In the present invention, sustainable breeding NSIF (NOD-scid IL2rg-/-Fah-/-) is obtained by performing Fah gene knockout in the background of immunodeficient mouse NOD-Scid IL2rg-/-, which is currently recognized as having the highest degree of immunodeficiency. a mouse strain, and a novel hepatic humanized mouse model with high chimerism and high success rate (humanized mouse model transplanted with organ cells or tissues such as human liver) was constructed using NSIF mice. The model can be used for the evaluation of the efficacy of scientific research and treatment methods (such as chemical drugs, biological agents, etc.) of human liver diseases (such as fatty liver, liver damage, hepatitis, liver cancer, etc.), as well as for drug catabolism and toxicity assessment.

In the present invention, a highly immunodeficient mouse NSEN having a hair development defect (almost no body hair) is obtained by performing Foxn1 gene knockout in the background of immunodeficient mouse NOD-Scid IL2rg-/- which is currently considered to have the highest degree of immunodeficiency. (NOD-Scid IL2rg-/-Foxn1-/-). In the absence of body hair, swollen Tumor receptor mice or recipient mice with fluorescently labeled cells are more likely to observe the cell growth, development, and migration of mice, and are easy to observe and size the solid tumor; due to the development of Foxn1 gene in the thymic epithelial cells and lymph The production has an important role, and the Foxn1 gene defect will not only prevent the probabilistic thymic re-growth event of NOD-Scid IL2rg-/- highly immunodeficient mice with age, but also due to Foxn1 gene deletion and primary immunodeficiency The extent is related, and the construction of solid tumor models in nude mice is better than other generations of immunodeficient mice.

Preferably, the nucleotide target sequence of the Fah gene is represented by SEQ ID NO. 1, and the nucleotide target sequence of the Foxn1 gene is represented by SEQ ID NO.

The nucleotide sequence is as follows:

Fah: aagctgcatggaagg (SEQ ID NO. 1);

Foxn1: ggaagtgcctcttgtagggg (SEQ ID NO. 2).

In a second aspect, the invention provides a method of knocking out a Fah gene according to the first aspect, comprising the steps of:

(1) Construction of TALEN plasmid to obtain TALEN mRNA;

(2) Obtaining the fertilized eggs of NSI mice, and injecting the TALEN mRNA obtained in step (1) into the cytoplasm of the fertilized egg of NSI mice, and after 24 hours of culture, transplanted into the uterus of pseudopregnant mice to obtain chimeric or hybrid NSIF (NOD). -scid IL2rg-/-Fah-/-) immunodeficient mice;

(3) The chimeric or hybrid NSIF immunodeficient mice obtained in step (4) are crossed with NSI mice to obtain more hybrid NSIF immunodeficient mice, and hybrid NSIF immunodeficient mice are crossed to obtain NSIF homozygous immunity. Defective mice.

Preferably, the construction of the TALEN plasmid described in the step (1) comprises the steps of: obtaining a TALEN left arm recognition binding sequence and a TALEN right arm recognition binding sequence according to a target sequence of the Fah gene, respectively, designing a coding TALEN left arm and a right Arm repeats, then ligating repeats to TALEN expression On the vector, pCAG-TALEN L (left arm)-X-pA and pCAG-TALEN R (right arm)-X-pA plasmids were obtained.

Preferably, the TALEN left arm recognition binding sequence is SEQ ID NO. 3, and the TALEN right arm recognition binding sequence is SEQ ID NO. 4;

TALEN left arm recognition binding sequence: 5-aacttcatgggtctgggtc-3 (SEQ ID NO. 3);

TALEN right arm recognizes the binding sequence: 5-aaggatgctcttgcct-3 (SEQ ID NO. 4).

Preferably, the TALEN mRNA is obtained according to the procedures of the kits M MESSAGE SP6 (Ambion) and E. coli Poly (A) Polymerase (NEB).

Preferably, the concentration of TALEN mRNA injected into the cytoplasm of the fertilized egg of the NSI mouse according to the step (2) is 10-200 ng/μL, for example, 10 ng/μL, 11 ng/μL, 12 ng/μL, 13 ng/μL, 15 ng. /μL, 18ng/μL, 20ng/μL, 25ng/μL, 30ng/μL, 35ng/μL, 40ng/μL, 45ng/μL, 50ng/μL, 55ng/μL, 60ng/μL, 65ng/μL, 70ng/μL 75ng/μL, 80ng/μL, 85ng/μL, 90ng/μL, 100ng/μL, 110ng/μL, 120ng/μL, 130ng/μL, 140ng/μL, 150ng/μL, 160ng/μL, 170ng/μL, 180ng / μL, 190 ng / μL or 200 ng / μL, preferably 12-100 ng / μL, further preferably 20 ng / μL.

Preferably, the medium for the embryonic operation of the fertilized egg of the NSI mouse knocking out the Fah gene is 10-40 mmol/L of HEPES, pH 7.0-8, the non-essential amino acid is 0.05-1 mmol/L, and the essential amino acid is 0.1- 2 mmol/L, preferably 20 mmol/L of HEPES, pH 7.4-7.8, 0.1 mmol/L of non-essential amino acids, and 0.1-0.6 mmol/L of essential amino acids.

Preferably, the medium for the mouse embryo culture in which the Fah gene is knocked out is a pyruvic acid concentration of 0.1 to 2 mmol/L, a glutamine concentration of 0.5 to 3 mmol/L, a glucose concentration of 0.01 to 1 mmol/L, preferably a pyruvic acid concentration. 0.35 mmol/L, glutamine concentration 1 mmol/L, glucose concentration 0.1 mmol/L.

Preferably, the number of fertilized eggs transplanted into the uterus of the pseudopregnant mouse according to the step (2) is 10-20 pieces. For example, it may be 10, 11, 12, 13, 14, 14, 15, 16, 17, 18, 19 or 20, preferably 10-15.

Preferably, the pseudopregnant mouse is any one of a NOD mouse, a NOD-SCID mouse or an NSI mouse.

Preferably, the method of knocking out the Foxn1 gene further comprises selecting a surrogate mouse for lactating newborn mice.

Preferably, the surrogate mouse is an ICR mouse.

In a third aspect, the present invention provides the NSIF mouse obtained by knocking out the Fah gene by the method of gene knockout according to the second aspect.

In a fourth aspect, the present invention provides an immunodeficient mouse model further genetically engineered based on the NSIF mouse of the third aspect.

In a fifth aspect, the present invention provides the use of a mouse model according to the third aspect or the fourth aspect as a model mouse for pathological and physiological studies of the human body, preferably as a model mouse for liver disease research and/or The use of liver-humanized model mice.

In a sixth aspect, the present invention provides a method of knocking out the Foxn1 gene, comprising the steps of:

(1) constructing a Foxn1 knockout recombinant vector, in vitro transcription of gRNA;

(2) in vitro transcription of Cas9 mRNA;

(3) Obtaining the fertilized eggs of NSI mice, and injecting the gRNA obtained in the step (1) and the Cas9 mRNA obtained in the step (2) into the cytoplasm of the fertilized egg of the NSI mouse, and culturing for 24 hours, transplanting into the uterus of the pseudopregnant mouse to obtain the miscellaneous NSIN (NOD-scid IL2rg-/-Foxn1-/-) immunodeficient mice;

(4) The chimeric or hybrid NSIN immunodeficient mice obtained in step (3) were crossed with NSI mice to obtain more hybrid NSIN immunodeficient mice, and hybrid NSIN immunodeficient mice were crossed to obtain NSIN homozygous immunity. Defective mice.

In the present invention, the obtained mRNA is injected into the mouse fertilized egg cells by pronuclear injection, and the various embryo culture mediums during the pronuclear injection process are adapted to the NSI embryos, thereby improving the efficiency of the embryonic pronucleus injection and the recovery of the embryo after injection.

Preferably, the step of constructing a Foxn1 gene knockout recombinant vector comprises: obtaining a linearized guide DNA (L-gDNA) by a primer, and then ligating the linearized L-pT7 vector by a DNA ligase to obtain a pT7-gDNA integrity. Carrier.

Preferably, the nucleotide sequence of the primer is shown in SEQ ID NO. 5-6;

The nucleotide sequence is as follows:

SEQ ID NO. 5: 5'-ATAGGN ggaagtgcctcttgtagggg GT-3';

SEQ ID NO. 6: 5'-TAAAACN cccctacaagaggcacttccG-3';

Wherein, the N may represent any one of A, T, G or C.

Preferably, the in vitro transcription of the gRNA comprises the steps of: amplifying a gDNA gene fragment by a primer using a pT7-gDNA intact vector as a template, and performing in vitro transcription to obtain a gRNA.

Preferably, the nucleotide sequence of the primer is shown in SEQ ID NO. 7-8;

SEQ ID NO. 7: 5'-GAAATTAATACGACTCACTATA-3';

SEQ ID NO. 8: 5'-AAAAAAAGCACCGACTCGGTGCCAC-3'.

Preferably, the in vitro transcription of Cas9 mRNA according to step (2) comprises the steps of linearizing the pcDNA3.3-hCas9 vector, recovering the linearized pcDNA3.3-hCas9 vector as a template for in vitro transcription, and using the SP6 polymerase promoter at Cas9 mRNA was transfected in vitro, and capped Cas9 mRNA was recovered by Licl method, and polyA was added, and purified and stored.

Preferably, the concentration of gRNA and Cas9 mRNA injected into the cytoplasm of the fertilized egg of the NSI mouse according to the step (3) is 10-200 ng/μL, for example, 10 ng/μL, 11 ng/μL, 12 ng/μL, 13 ng/μL, 15 ng/μL, 18 ng/μL, 20 ng/μL, 25 ng/μL, 30 ng/μL, 35 ng/μL, 40 Ng/μL, 45 ng/μL, 50 ng/μL, 55 ng/μL, 60 ng/μL, 65 ng/μL, 70 ng/μL, 75 ng/μL, 80 ng/μL, 85 ng/μL, 90 ng/μL, 100 ng/μL, 110 ng/ μL, 120 ng/μL, 130 ng/μL, 140 ng/μL, 150 ng/μL, 160 ng/μL, 170 ng/μL, 180 ng/μL, 190 ng/μL or 200 ng/μL, preferably 12-100 ng/μL, further preferably 20 ng /μL.

Preferably, the embryo of the NSI mouse knockout Foxn1 gene is used for embryo manipulation of 10-40 mmol/L HEPES, pH 7.0-8, non-essential amino acids 0.05-1 mmol/L, and essential amino acids 0.1-2 mmol. /L, preferably 20 mmol/L of HEPES, pH 7.4-7.8, non-essential amino acid 0.1 mmol/L, and essential amino acid 0.1-0.6 mmol/L.

Preferably, the medium for culturing the mouse embryo of the Foxn1 gene has a pyruvic acid concentration of 0.1 to 2 mmol/L, a glutamine concentration of 0.5 to 3 mmol/L, a glucose concentration of 0.01 to 1 mmol/L, preferably a pyruvic acid concentration. 0.35 mmol/L, glutamine concentration 1 mmol/L, glucose concentration 0.1 mmol/L.

Preferably, the number of fertilized eggs transplanted into the uterus of the pseudopregnant mouse according to the step (3) is 10-20 pieces, for example, 10 pieces, 11 pieces, 12 pieces, 13 pieces, 14 pieces, 15 pieces, 16 pieces, and 16 pieces. 17, 17 pieces, 19 pieces, 19 pieces or 20 pieces, preferably 10-15 pieces.

Preferably, the pseudopregnant mouse is any one of a NOD mouse, a NOD-SCID mouse or an NSI mouse.

Preferably, the method of knocking out the Foxn1 gene further comprises selecting a surrogate mouse for lactating newborn mice.

Preferably, the surrogate mouse is an ICR mouse.

In the present invention, mice that have knocked out the Foxn1 and Fah genes use NSI female mice as surrogate mothers, and ICR mothers with at least one production experience are used as surrogate mothers. The use of NSI female mice as surrogate mothers is due to the growth environment of the genotype and the in vivo microenvironment, which is more suitable for the growth of the defective mice, which can improve the survival rate; and the use of ICR mothers as surrogate mothers can improve the survival rate. Breastfeeding rate.

In a seventh aspect, the present invention provides the NSIN mouse obtained by knocking out the Foxn1 gene by the method of gene knockout according to the first aspect.

In the present invention, the transplantation rate of the transplanted tumor, the survival and growth of the xenogeneic cells of the NSIN mouse are obviously superior to those of other immunodeficient mice, and the degree of immunodeficiency of the NSIN mouse is high, which can be regarded as the optimal tumor disease research. Model mice.

In an eighth aspect, the present invention provides an immunodeficient mouse model further genetically engineered based on the NSIN mouse of the seventh aspect.

In a ninth aspect, the present invention provides the use of the mouse model according to the seventh aspect or the eighth aspect as a model mouse for human pathological and physiological studies, preferably as a model mouse for tumor disease research.

In a tenth aspect, the present invention provides the mouse obtained by knocking out the Fah gene and the Foxn1 gene by the method of gene knockout according to the first aspect.

In the present invention, as a preferred technical solution, the culture medium used for the embryonic operation such as transplanting fertilized eggs in the Foxn1 and Fah gene mice is 20 mmol/L of HEPES, pH 7.4-7.8, and the non-essential amino acid is 0.1 mmol/L. The amino acid is from 0.1 to 0.6 mmol/L.

The medium used for the mouse embryo culture in the knockout Foxn1 and Fah gene mice was a pyruvic acid concentration of 0.35 mmol/L, a glutamine concentration of 1 mmol/L, and a glucose concentration of 0.1 mmol/L.

Compared with the prior art, the present invention has the following beneficial effects:

(1) The immunodeficient mouse with the highest degree of immunodeficiency in the present invention is subjected to Foxn1 gene knockout in the background of NOD-Scid IL2rg-/-, and a highly immunodeficient mouse NSN (NOD-Scid) having a hair development defect (almost no hair) is obtained. IL2rg-/-Foxn1-/-), the mouse has no body hair, it is easier to observe the cell growth, development and migration of the mouse, and it is easy to observe and size the solid tumor, and prevent the mice with high immunodeficiency Probabilistic thymic rebirth events that occur with ageing;

(2) The present invention performs Fah gene knockout in the context of NOD-Scid IL2rg-/- in immunodeficient mice, Obtained a sustainable breeding NSIF (NOD-scid IL2rg-/-Fah-/-) mouse strain, Fah deletion can induce liver failure, and immune cells participate in subsequent liver failure, the higher the degree of NSIF immunodeficiency, can alleviate liver failure In the controllable range, a novel liver humanized mouse model with high chimerism and high success rate was constructed using NSIF mice, which can be used for human liver diseases (such as fatty liver, liver injury, hepatitis, liver cancer, etc.). Evaluation of the efficacy of scientific research and therapeutic methods (eg, chemicals, biological agents, etc.), as well as catabolic and toxicity assessments for therapeutic methods;

(3) The present invention uses NSI mice to surrogate, and ICR mice are cultured to culture NSN and NSIF mice, thereby improving the survival rate and lactation rate of the defective mice, and the present invention will be obtained by pronuclear injection. The mRNA is injected into the fertilized egg, and the NSI embryos are adjusted by various embryo culture media in the pronuclear injection to improve the efficiency of pronuclear injection and recovery of the embryo after injection.

DRAWINGS

1 is a result of PCR digestion of the NSIN mouse gene of the present invention, wherein WT is wild type, Foxn1 +/- is heterozygous, and Foxn1-/- is homozygous;

2 is a result of PCR digestion of the NSIF mouse gene of the present invention, wherein WT is wild type, Fah+/- is heterozygous, and Fah-/- is homozygous;

Figure 3 is a result of alignment of the NSIF mouse sequencing results of the present invention on NCBI;

Figure 4 is a diagram showing the results of Western Blot of detecting Fah protein expression in NSIF mice with liver injury according to the present invention;

Fig. 5 is a liver pathological section of the NSIF mouse of the present invention, wherein Fig. 5(A) shows liver pathological sections after NSIF mice stop using NTBC drugs, and Fig. 5(B) shows liver pathology of NSIF mice after normal use of NTBC drugs. slice;

Figure 6 is a graph showing the expression levels of alanine aminotransferase and aspartate aminotransferase after cessation of NTBC drugs in NSIF mice of the present invention;

Figure 7 is a graph showing the expression level of glucose after cessation of NTBC drugs in NSIF mice of the present invention;

Figure 8 is a graph showing changes in body weight of livers of NSIF mice of the present invention after transplantation of liver transplanted/non-transplanted C57BL/6 mice, and discontinuation of NTBC drugs, wherein NISF-NTBC+liver is a NSIF mouse transplanted with liver of C57BL/6 mice. NSIF-NTBC is a non-transplanted liver NSIF mouse;

Figure 9 is a graph showing the expression levels of alanine aminotransferase and aspartate aminotransferase in the liver of the transplanted/non-transplanted C57BL/6 mouse of the NSIF mouse of the present invention after stopping the use of the NTBC drug, wherein the NISF-NTBC+liver is NSIF mice transplanted with liver of C57BL/6 mice, NSIF-NTBC were mice without transplanted liver;

Figure 10 is a graph showing the expression level of glucose in the liver of the NSIF mouse of the present invention after transplantation/non-transplantation of C57BL/6 mice, wherein the NISF-NTBC+liver is a liver transplanted with C57BL/6 mice, NSIF-NTBC a mouse that has not been transplanted with liver;

Figure 11 is a schematic view showing the structure of the Fah target site and the TALEN left and right arms;

Figure 12 is a comparison of the reconstitution efficiency of peripheral blood NALM6-GFP in mice after transplantation of 1×10 ⁴ NALM6-GFP cells into NOG, NSI and NSIN mice, respectively;

Figure 13 is a comparison of the reconstitution efficiency of peripheral blood NALM6-GFP in mice after transplantation of 1×10 ⁵ NALM6-GFP cells into NOG, NSI and NSIN mice, respectively;

Figure 14 is a comparison of the reconstitution efficiency of peripheral blood NALM6-GFP in mice after transplantation of 1×10 ⁶ NALM6-GFP cells into NOG, NSI and NSIN mice, respectively;

Figure 15 is a comparison of the weight of subcutaneous tumor tissue in mice after transplantation of 1 × 10 ⁴ A549 cells into NOG, NSI, and NSIN mice for 30 days;

Figure 16 is a comparison of the weight of subcutaneous tumor tissue in mice after transplantation of 1 × 10 ⁵ A549 cells into NOG, NSI, and NSIN mice for 30 days;

Figure 17 is a comparison of the weight of subcutaneous tumor tissue in mice after transplantation of 1 × 10 ⁶ A549 cells into NOG, NSI, and NSIN mice for 30 days.

detailed description

The technical solutions of the present invention will be further described with reference to the accompanying drawings and the embodiments of the present invention, but the present invention is not limited to the scope of the embodiments.

All animals of the present invention are raised and propagated at the SPF (Specific Pathogen Free) level experimental animal center.

The NSI mouse of the present invention, genotype: NOD-scid IL2rg-/-, authorized patent number: ZL201310229629.9.

Example 1: Construction of Cas9 Knockout System Plasmid

(1) Target selection: Using the ZiFiT Targeter Version website to design a GGN (17-18) NGG (N is an arbitrary base) sequence following the Cas9 knockout target requires a Cas9 knockout target site and pass Ensembl/NCBI The "Blast" search function of the website determines that the target site is a single site in the genome;

Target site sequence: ggaagtgcctcttgtagggg (SEQ ID NO. 1)

Target confirmation: According to the genome of the target cell, a high specific primer for amplifying the target site is designed, and a target site fragment is obtained by PCR amplification; the only restriction endonuclease of the amplified fragment is selected in the target site for enzymatic digestion. After electrophoresis identification; after the enzyme digestion is correctly identified, the PCR amplification products are sent to the sequencing identification; the specificity of the primers for identification and the feasibility of enzyme digestion and sequencing identification are confirmed by enzyme digestion and sequencing identification;

(2) Construction of targeting vector pT7-gDNA

1 Gene synthesis Two primers which are identical and complementary to the target site sequence, namely, polynucleotide single strand (Oligo), respectively, S Oligo and AS Oligo; the reaction components are added to a 1.5 mL EP tube according to the following table. After being heated in boiling water for 10 minutes, cooled to room temperature, and centrifuged instantaneously to obtain a viscous-end, linearized guide DNA sequence (ie, L-gDNA) encoding guide RNA (gRNA);

S Oligo sequence: 5'-ATAGGN ggaagtgcctcttgtagggg GT-3' (SEQ ID NO. 3)

AS Oligo sequence: 5'-TAAAACN cccctacaagaggcacttccG-3' (SEQ ID NO. 4)

2 cleavage of the empty vector pMD18-T Simple (ie pT7 vector with ampicillin resistance) by restriction endonuclease BbsI, to obtain linearized empty vector pMD18-T Simple containing sticky end, ie L-pT7;

3 L-pT7 and L-gDNA are ligated into the complete vector pT7-gDNA by DNA ligase (such as Takara Solution I), transformed, plated, picked monoclonal, shaken, plasmid DNA extracted, restriction enzyme identification, plasmid Sequencing, screening and sequencing the correct plasmid for use;

(3) gRNA in vitro transcription

1 Sequencing the correct pT7-gDNA plasmid (1-30 ng) as a template, using T7-S and Tracr-Rev as primers to amplify the gDNA gene fragment, electrophoresis, gel recovery, and dissolving in 30 μL of (RNA)-free enzyme water for use;

T7-S primer sequence: 5'-GAAATTAATACGACTCACTATA-3' (SEQ ID NO. 5)

Tracr-Rev primer sequence: 5'-AAAAAAAGCACCGACTCGGTGCCAC-3' (SEQ ID NO. 6)

2 by in vitro transcription kit

T7Kit (Ambion) transcribes the gDNA gene fragment amplified by PCR into gRNA in vitro, and recovers the in vitro transcribed gRNA from the transcription system using the mirVana ^TM miRNA Isolation Kit (Ambion), and dissolves it with 20 μL of enzyme-free water. Store at 80 ° C for later use.

(4) Cas9 in vitro transcription

1 Configure the digestion reaction solution according to the following system: pcDNA3.3-hCas9 (Cas9 vector, Addgene NO.MLM3613) was cleaved with PmeI restriction endonuclease to linearize the vector, electrophoresis, running, recovery, and 20 μL of enzyme-free Water is dissolved for use;

2 The capped Cas9 mRNA was transcribed in vitro with mMESSAGE mMACHINE T7Kit according to the following system and procedure, electrophoresis, running gel, and capped Cas9 mRNA.

3 The reaction system was configured according to the following system, and polyA was added to the capped Cas9 mRNA to obtain a stable and more efficient RNA;

④ using mirVana ^TM miRNA Isolation Kit Kit (Ambion, Inc.) recovering purified vitro transcription from the transcription system Cas9mRNA, dissolved in water with no enzyme 10-20μL, -80 ℃ stored for use.

Example 2: Construction and validation of NSIN mice

(1) Over-discharge of NSI mice: age of male rats: 10-11 weeks, female rats: 8 weeks. The mother rats were injected with PMSG (7.5 IU/only) at 13:00 on the first day, HCG (7.5 IU/only) at 13:00 on the third day, and 2 male rats at the 17:00 on the third day. On the fourth day, the female vaginal suppository was examined from 8:00 to 9:00, and the fertilized eggs of NSI mice were obtained from the uterus of the female.

Note on the production of NSI male and female sperm that provide sperm: NSI maternal and parental mice (the mother and father of the NSI male and female rats that provide sperm) are caged and the parental mouse is divided. Out, put in ICR mother rats with at least one production experience to ensure adequate feeding of NSI maternal rats;

(2) Prokaryotic injection of 20ng/μL gRNA and Cas9 mRNA into NSI mouse fertilized egg cytoplasm (Embedded operation of all medium is 20mmol/L HEPES, pH 7.4-7.8, non-essential amino acid 0.1mmol/L, essential amino acid is 0.1-0.6 mmol/L), cultured in mouse embryo culture medium for 24 hours (medium adjustment: pyruvate concentration increased to 0.35 mmol/L, glutamine concentration was adjusted to 1 mmol/L, glucose concentration was adjusted to 0.1 mmol) /L), transplanted into 0.5dpc (two-cell stage embryo) pseudo-pregnancy NSI mother mouse tubal ampulla, the number of fertilized eggs per mouse transplanted 15;

Note on the feeding of surrogate NSI rats: After the NSI maternal and maternal rats of the surrogate mother are seen in the cage, the father rats are separated and placed in an ICR mother with at least one production experience. The surrogate mother is out. 7 days after birth, the same litter males were taken out to ensure sufficient supply of nutrients during the lactation period of the surrogate mothers;

(3) The mother rats after the fertilized eggs were co-cage with the ICR mother rats that had been produced more than once (1 surrogate NSI female and 1 ICR female);

After the surrogate mother is born, the mouse genotype is identified by genotyping (PCR amplification and sequencing) to obtain hybrid NSIN (NOD-scid IL2rg-/-Foxn1-/-) immunodeficient mice, which is further reduced by NSI. The NSIN homozygote was obtained by hybridization of the mouse, and the PCR results are shown in Figure 1.

Note: Due to the lack of Foxn1 in the homozygous NSIN mother, the mammary gland development is incomplete, and the NSIN pups are not able to be well fed. The breeding of the NSIN strain is mainly through the homozygous NSIN male and the heterozygous NSIN female to breed the offspring; homozygous NSIN has no body hair, and hybrid NSIN has body hair;

As can be seen from Figure 1, the homozygous NSIN mouse is defective in the Foxn1 gene.

Example 3: Construction of TALEN plasmid

(1) Using the TELAN Targeter software to analyze the Fah gene CDS sequence (NOD-scid IL2rg-/- mouse background), and screen the highest specific gene locus from the Fah gene CDS sequence as the TALEN target;

TALEN target sequence: 5-aagctgcatggaagg-3;

TALEN left arm recognition binding sequence: 5-aacttcatgggtctgggtc-3;

TALEN right arm recognition binding sequence: 5-aaggatgctcttgcct-3;

(2) According to the sequence of TALE gene recognition of the left and right arm of the Fah gene, and the TALE recognition coding principle, the left and right arm sequences of TALEN are designed, as shown in Figure 11:

TALEN left arm: AACTTCATGGGTCTGGGTCAAG;

TALEN right arm: AAGGATGCTCTTGCCTCCT;

(3) Gene synthesis TALEN left arm and right arm repeat sequences containing BsmBI (ie Esp3I, Thermo Scientific, model FD0454) restriction enzyme sites on both sides, and digested and ligated by BsmBI TALEN expression vector pCAG-TALEN-X-pA (Addgene), obtaining pCAG-TALEN L (left arm)-X-pA and pCAG-TALEN L (right arm)-X-pA plasmid;

(4) Evaluation of TALEN activity: The single-strand annealing (SSA) method was used for the TALEN activity in vitro. The reporter gene in the SSA reporter vector was the luciferase gene, and the promoter was CMV. The method was to transfect 200 ng TALENs expression plasmid, 50 ng SSA reporter plasmid and 10 ng Renilla plasmid into 24-well plate 293T cells. After 1 day, the transfected cells were collected and treated with Luciferase Cell Lysis Buffer (NEB) to detect luciferase activity and predict TALEN. Cutting activity;

(5) TALEN mRNA acquisition: TALENs plasmid requires embryonic cytoplasmic injection after in vitro transcription synthesis of TARNA encoding TALEN and poly(A) at the end. The in vitro transcription and polyadenylation of TALEN m RNA was carried out according to the procedures of the kits M MESSAGE SP6 (Ambion) and E. coli Poly (A) Polymerase (NEB). The method is as follows:

1Not I restriction enzyme linearization of TALENs plasmid: 15 μg of each of L-TALENs and R-TALENs plasmids obtained by extracting the plasmid, and after digestion at 37 °C overnight, 0.2 μL of the digested product was loaded into a 1% agarose gel well. The original plasmid was used as a control, and the linearization was determined by electrophoresis. The digested product was recovered by DNA recovery kit (DP214), and the concentration was determined.

2 In vitro transcription: The reagent in the SP6m MESSAGE m MACHINE Kit (Ambion, AM1340) kit was melted on ice and centrifuged briefly. After Bufferr melted, the solution was allowed to stand at room temperature, and the rest of the solution was placed on ice. The total system was set to 10 μL. The sample was thoroughly mixed and incubated at 37 ° C for 3 h;

3 Add 0.5 μL TURBO DNase, mix well and incubate at 37 ° C for 15 min;

4RNA plus PolyA tail modified on the ice to thaw E.coil poly (A) polymerase kit related reagents, the total system is set to 50μL, according to the system of the sample, add the sample, mix the sample thoroughly, incubate at 37 ° C for 45min.

5 TALEN m RNA was precipitated and recovered, and the in vitro transcribed Cas9 RNA was recovered from the transcription system by using the mirVana ^TM miRNA Isolation Kit kit (Ambion), dissolved in 10-20 μL of enzyme-free water, and stored at -80 ° C until use.

Example 4: Construction and validation of NSIF mice

(1) Over-discharge of NSI mice: age of male rats: 10-11 weeks, female rats: 8 weeks. The mother rats were injected with PMSG (7.5 IU/only) at 13:00 on the first day, HCG (7.5 IU/only) at 13:00 on the third day, and 2 male rats at the 17:00 on the third day. On the fourth day, the female vaginal suppository was examined from 8:00 to 9:00, and the fertilized eggs of NSI mice were obtained from the uterus of the female.

Note on the production of NSI male and female sperm that provide sperm: NSI maternal and parental mice (the mother and father of the NSI male and female rats that provide sperm) are caged and the parental mouse is divided. Out, put ICR mothers with at least one production experience to ensure adequate feeding of NSI maternal rats.

(2) The 20 ng/μL TALEN left arm and right arm mRNA pronucleus was injected into the cytoplasm of the fertilized egg of NSI mice. (Embedded operation was 20 mmol/L HEPES, pH 7.4-7.8, non-essential amino acid 0.1 mmol/L , essential amino acid is 0.1-0.6mmol / L), after 24 hours of culture in mouse embryo culture medium (medium adjustment: pyruvate concentration increased to 0.35mmol / L, glutamine concentration was adjusted to 1mmol / L, glucose concentration Adjusted to 0.1mmol / L), transplanted into 0.5dpc (two-cell stage embryo) pseudo-pregnancy NSI mother mouse tubal ampulla, the number of fertilized eggs per mouse is preferably 13;

Pregnancy NSI mouse feeding considerations: NSI maternal and maternal rats in the surrogate mothers were found to be tied together, and the parent mice were separated and placed in an ICR mother with at least one production experience. The surrogate mother was born. After the next 7 days, the same litter males were taken out to ensure that the lactating mothers had sufficient nutrient supply during lactation.

(3) The mother rats after the fertilized eggs were co-cage with the ICR mother rats that had been produced more than once (1 surrogate NSI female and 1 ICR female);

(4) After maternal feeding, the mouse genotype was identified by genotyping (PCR amplification and sequencing) to obtain hybrid NSIF (NOD-scid IL2rg-/-Fah-/-) immunodeficient mice, and further The NSIF homozygote was obtained by hybridization with NSI mice, and the NSIF sequencing results were compared on NCBI. The results are shown in Fig. 3, and the results of PCR electrophoresis are shown in Fig. 2;

Note: NTBC (final concentration: 7.5mg/L) is added to the drinking water of the pregnant mother (pH 3.0, autoclaving); NTBC (final concentration: 7.5mg/L) 120ul is needed one week before the mother gives birth. /only; after the mother is born, the rats less than 4 weeks old need to be injected with NTBC 10-20uL per day, and the lactating mother is injected with NTBC 120uL/only;

It can be seen from Fig. 2 and Fig. 3 that the sequencing results and the electrophoresis results after PCR amplification of the gene also reflect the defect and incompleteness of the Fah gene in the genome of NSIF mice.

The expression of Fah protein in the liver of NSIF mice was detected by Western Blot (NSI mice were used as positive control). As shown in Fig. 4, NSI expressed Fah protein, and Fah protein was not expressed in NSIF mice, which proved that Fah gene knockout was successful.

Example 5: Construction of animal model of liver injury

(1) Stop adding NTBC (and not injecting NTBC) to the daily drinking water of NSIF mice.

(2) The NTBC NSIF mice were weighed and recorded daily, and the effects of NTBC on the body weight changes of NSIF mice were removed by plotting the body weight change curve compared with NSIF mice drinking NTBC acidic water.

(3) 40 days after NTBC withdrawal, the pathological sections of the mice that stopped the drug and the liver of the normal drug were as shown in Fig. 5 (A) and Fig. 5 (B), and 300 mL of peripheral blood of the experimental group was taken and extracted. Serum samples were tested for serum alanine aminotransferase (ALT, Aspartate Aminotransferase) and glucose (Glucose) levels. The results are shown in Figure 6-7.

From the liver physical map and pathological section results in Figure 5 (A) and (B), it can be seen that NSIF mice stop showing NTBC, the liver is visible to the naked eye, tissue section staining shows hepatocyte necrosis (A); continuous administration of small In rat liver cells, no obvious liver damage and hepatocyte necrosis were observed (B). It is indicated that NSIF mice can spontaneously induce liver damage, which can be alleviated and controlled by NTBC-based drugs. Figure 6-7 also supports this result;

As can be seen in Figures 6-7, the synthesis level of alanine aminotransferase and aspartate aminotransferase in serum was significantly increased in NSIF mice after stopping the use of NTBC, and the level of glucose synthesis was significantly decreased.

Example 6: Liver transplantation experiment of different strains of mice

(1) Select 6 NSIF mice whose birth dates differ by no more than one week and of the same sex (born with the same fetus), divided into two groups (3 in each group), one group being NSIF-NTBC+Liver (ie NSIF mice) After transplantation of C57BL/6 mouse liver cells, the NTBC drug was gradually stopped. One group was NSIF-NTBC (ie, NSIF mice that did not transplant C57BL/6 mouse liver cells, and NTBC gradually evolved with the NSIF-NTBC+Liver experimental group). Stop the drug);

(2) One C57BL/6 mouse was killed by carbon dioxide method. The liver of C57BL/6 mice was ground and lysed, and a single liver cell suspension (concentration of 2×107 cells/mL) was obtained.

(3) Each NSIF-NTBC+Liver mouse was injected with 100 μL of C57BL/6 mouse single liver cell suspension in step 2 by intravenous injection, that is, each mouse was injected with 2×10 6 cells;

(4) After the mouse liver cell transplantation test, the mice in both groups were stopped from taking NTBC and daily The experimental mice were weighed and recorded weight as shown in Figure 8;

(5) 40 days after transplantation of mouse liver cells, 300 ml of peripheral blood of two groups of experimental mice were taken, and serum samples were taken to detect serum alanine aminotransferase (ALT, Alanine Aminotransferase) and aspartate aminotransferase. (AST, Aspartate Aminotransferase), glucose (Glucose) levels, as shown in Figure 9-10;

As can be seen from Fig. 8, NSIF mice that did not transplant C57BL/6 mouse liver cells gradually lost weight until they died, while NSIF mice transplanted with C57BL/6 mouse liver cells gradually lost weight for 33 days. restore. It is indicated that mouse liver cells of different strains transplanted can grow in mice and replace the liver function of recipient mice.

As can be seen from Figure 9-10, the synthesis level of serum alanine aminotransferase and aspartate aminotransferase was significantly increased in NSIF mice that did not transplant C57BL/6 mouse liver cells, while glucose synthesis was observed. The level has dropped significantly.

Example 7: Construction of a solid tumor humanized mouse model using NSIN

(1) Different order of magnitude (1 × 10 ⁴ , 1 × 10 ⁵ , 1 × 10 ⁶ ) of NALM6-GFP cells (human B lymphoblastic acute leukemia BALL cell line, labeled with green fluorescent protein), respectively, injected through the tail vein manner transplanted into NSIN (NOD / SCID IL2rg - / - Foxn1 - / -), NSI (NOD / SCID IL2rg - / -), NOG (NOD.Cg-Prkdc scid IL2rg tmlSug / JicCrl, Japan CIEA / IVS company) immunization Defective mice, constructing a humanized mouse model of hematoma (B-ALL);

(2) After transplantation of NALM6-GFP cells, observe the state of tumor-transplanted mice. When the mice are sick, the peripheral blood of mice is taken. The ratio of NALM6-GFP cells in peripheral blood is detected by flow cytometry. Comparing tumor weights to different histograms, the results are shown in Figures 12-14;

(3) Through the columnar comparison chart of different orders of magnitude, Figure 12-14 shows that the in vivo environment of NSIN immunodeficient mice is more suitable for the survival and growth of xenogeneic (hematoma, normal blood) cells; When the cells are small, the transplantation efficiency of NSIN mice is significantly higher than that of NSI and NOG mice; preliminary conclusions can be drawn that the order of immunodeficiency of the three mice is NSIN>NSI>NOG.

Example 8: Construction of a solid tumor humanized mouse model using NSIN

(1) A549 cells (human lung adenocarcinoma cell line) of different orders of magnitude (1×10 ⁴ , 1×10 ⁵ , 1×10 ⁶ ) were transplanted into NSIN by subcutaneous injection (NOD/SCID IL2rg-/ -Foxn1-/-), NSI (NOD/SCID IL2rg-/-), NOG (NOD.Cg-PrkdcscidIL2rgtm1Sug/JicCrl, Japan CIEA/IVS) immunodeficient mice, construct solid tumor (lung cancer) humanized mice model;

(2) After 30 days of A549 cell transplantation, the tumor tissues of the mice were taken, the weight of the tumor tissues was weighed, and the tumor weight comparison histograms of different orders of magnitude were recorded and the results are shown in Fig. 15-17.

(3) Through the columnar comparison chart of different orders of magnitude, Figure 15-17 shows that the in vivo environment of NSIN immunodeficient mice is more suitable for the survival and growth of xenogeneic (solid tumor, non-blood normal cells) cells; especially in When the cells were few, the transplantation efficiency of NSIN mice was significantly higher than that of NSI and NOG mice. It was further verified that the order of immunodeficiency of the three mice was NSIN>NSI>NOG.

The Applicant declares that the present invention is described by the above-described embodiments, but the present invention is not limited to the above detailed methods, that is, it does not mean that the present invention must be implemented by the above detailed methods. It should be apparent to those skilled in the art that any modifications of the present invention, equivalent substitution of the various materials of the products of the present invention, addition of auxiliary components, selection of specific means, and the like, are all within the scope of the present invention.

Claims (10)

1. A method of gene knockout, which comprises knocking out a Fah gene or a Foxnl gene using NOD-Scid IL2rg-/- immunodeficient mice (NSI mice).
2. The method according to claim 1, wherein the nucleotide target sequence of the Fah gene is represented by SEQ ID NO. 1, and the nucleotide target sequence of the Foxn1 gene is SEQ ID NO. Shown.
3. The method according to claim 1 or 2, wherein said knocking out the Fah gene comprises the steps of:

   (1) Construction of TALEN plasmid to obtain TALEN mRNA;

   (2) Obtaining the fertilized eggs of NSI mice, and injecting the TALEN mRNA obtained in step (1) into the cytoplasm of the fertilized egg of NSI mice, and after 24 hours of culture, transplanted into the uterus of pseudopregnant mice to obtain chimeric or hybrid NSIF (NOD). -scid IL2rg-/-Fah-/-) immunodeficient mice;

   (3) The chimeric or hybrid NSIF immunodeficient mice obtained in step (2) were crossed with NSI mice to obtain more hybrid NSIF immunodeficient mice, and hybrid NSIF immunodeficient mice were crossed to obtain NSIF homozygous immunity. Defective mouse

   Preferably, the constructing of the TALEN plasmid according to the step (1) comprises the steps of: obtaining a TALEN left arm recognition sequence and a TALEN right arm recognition sequence according to a target sequence of the Fah gene, and designing a TALEN left arm and a right arm structure, The repeat sequence was ligated to the TALEN expression vector to obtain pCAG-TALEN L (left arm)-X-pA and pCAG-TALEN R (right arm)-X-pA plasmids;

   Preferably, the TALEN left arm recognition binding sequence is SEQ ID NO. 7, and the TALEN right arm recognition binding sequence is SEQ ID NO.

   Preferably, the obtaining of the TALEN mRNA comprises the following steps:

   Preferably, the concentration of TALEN mRNA injected into the cytoplasm of the fertilized egg of the NSI mouse according to the step (2) is 10-200 ng / μL, preferably 12-100 ng / μL, further preferably 20 ng / μL;

   Preferably, the medium for the embryonic operation of the fertilized egg of the NSI mouse knocking out the Fah gene is 10-40 mmol/L of HEPES, pH 7.0-8, the non-essential amino acid is 0.05-1 mmol/L, and the essential amino acid is 0.1. -2mmol / L, preferably 20mmol / L of HEPES, pH 7.4-7.8, non-essential amino acids of 0.1mmol / L, essential amino acids of 0.1-0.6mmol / L;

   Preferably, the medium for the mouse embryo culture in which the Fah gene is knocked out is a pyruvic acid concentration of 0.1 to 2 mmol/L, a glutamine concentration of 0.5 to 3 mmol/L, a glucose concentration of 0.01 to 1 mmol/L, preferably a pyruvic acid concentration. 0.35mmol / L, glutamine concentration 1mmol / L, glucose concentration 0.1mmol / L;

   Preferably, the number of fertilized eggs transplanted into the uterus of the pseudopregnant mouse according to the step (2) is 10-20 pieces, preferably 10-15 pieces;

   Preferably, the pseudopregnant mouse is any one of a NOD mouse, a NOD-SCID mouse or an NSI mouse;

   Preferably, the method for knocking out the Fah gene further comprises selecting a surrogate mouse for breast-fed newborn mice;

   Preferably, the surrogate mouse is an ICR mouse.
4. A method of gene knockout according to claim 3, wherein the NSIF mouse obtained by knocking out the Fah gene.
5. An immunodeficient mouse model characterized in that the mouse is further genetically engineered on the basis of the NSIF mouse of claim 4.
6. Use of the mouse model according to claim 4 or 5 as a model mouse for pathological and physiological studies of the human body, preferably for use as a model mouse for liver disease research and/or for use as a model rat for liver humanization.
7. The method according to claim 1 or 2, wherein the method of knocking out the Foxnl gene comprises the steps of:

   (1) constructing a Foxnl knockout recombinant vector, in vitro transcription of gRNA;

   (2) in vitro transcription of Cas9 mRNA;

   (3) Obtaining the fertilized eggs of NSI mice, and injecting the gRNA obtained in the step (1) and the Cas9 mRNA obtained in the step (2) into the cytoplasm of the fertilized egg of the NSI mouse, and culturing for 24 hours, transplanting into the uterus of the pseudopregnant mouse to obtain the embedded Combined or heterozygous NSIN (NOD-scid IL2rg-/-Foxnl-/-) immunodeficient mice;

   (4) The chimeric or hybrid NSIN immunodeficient mice obtained in the step (3) are crossed with the NSI mouse to obtain more hybrid NSIN immunodeficient mice, and the hybrid NSIN immunodeficient mice are crossed to obtain NSIN homozygous. Immunodeficient mice;

   Preferably, the step of constructing a Foxnl gene knockout recombinant vector comprises: obtaining linearized guide DNA (L-gDNA) by a primer, and then ligating to a linearized L-pT7 vector by DNA ligase to obtain pT7-gDNA integrity. Carrier

   Preferably, the nucleotide sequence of the primer is shown in SEQ ID NO. 3-4;

   Preferably, the in vitro transcription of the gRNA comprises the steps of: using a pT7-gDNA intact vector as a template, amplifying a gDNA gene fragment by a primer, and performing in vitro transcription to obtain a gRNA;

   Preferably, the nucleotide sequence of the primer is shown in SEQ ID NO. 5-6;

   Preferably, the in vitro transcription of Cas9 mRNA according to step (2) comprises the steps of linearizing the pcDNA3.3-hCas9 vector, recovering the linearized pcDNA3.3-hCas9 vector as a template for in vitro transcription, and using the SP6 polymerase promoter at Cas9 mRNA was transfected in vitro, and Cap Cas9 mRNA was recovered by Licl method, and polyA was added, and purified after storage;

   Preferably, the concentration of gRNA and Cas9 mRNA injected into the cytoplasm of the fertilized egg of the NSI mouse according to the step (3) is 10-200 ng / μL, preferably 12-100 ng / μL, further preferably 20 ng / μL;

   Preferably, the medium for knocking out the Foxnl gene of the NSI mouse fertilized egg is used in a medium of 10-40 mmol/L HEPES, pH 7.0-8, and the non-essential amino acid is 0.05-1 mmol/L, an essential amino group. The acid is 0.1-2 mmol/L, preferably 20 mmol/L of HEPES, pH 7.4-7.8, the non-essential amino acid is 0.1 mmol/L, and the essential amino acid is 0.1-0.6 mmol/L;

   Preferably, the medium for culturing the mouse embryo of the Foxnl gene has a pyruvic acid concentration of 0.1 to 2 mmol/L, a glutamine concentration of 0.5 to 3 mmol/L, a glucose concentration of 0.01 to 1 mmol/L, preferably a pyruvic acid concentration. 0.35mmol / L, glutamine concentration 1mmol / L, glucose concentration 0.1mmol / L;

   Preferably, the number of fertilized eggs transplanted into the uterus of the pseudopregnant mouse according to the step (3) is 10-20 pieces, preferably 10-15 pieces;

   Preferably, the pseudopregnant mouse is any one of a NOD mouse, a NOD-SCID mouse or an NSI mouse;

   Preferably, the method for knocking out the Foxnl gene further comprises selecting a surrogate mouse for the lactating newborn mouse;

   Preferably, the surrogate mouse is an ICR mouse.
8. A method of gene knockout according to claim 7 wherein the NSIN mouse obtained by knocking out the Foxnl gene.
9. An immunodeficient mouse model, characterized in that the mouse model is further genetically engineered based on the NSIN mouse of claim 8;

   The use of the mouse model according to claim 8 or 9 as a model mouse for human pathological and physiological studies, preferably as a model mouse for tumor disease research.
10. A method of gene knockout according to claim 1 which is obtained by knocking out the Fah gene and the Foxnl gene.

Images