CN102286514A - Transposition carrier and construction method thereof - Google Patents
Transposition carrier and construction method thereof Download PDFInfo
- Publication number
- CN102286514A CN102286514A CN 201110203354 CN201110203354A CN102286514A CN 102286514 A CN102286514 A CN 102286514A CN 201110203354 CN201110203354 CN 201110203354 CN 201110203354 A CN201110203354 A CN 201110203354A CN 102286514 A CN102286514 A CN 102286514A
- Authority
- CN
- China
- Prior art keywords
- gene
- sequence
- site
- transposon
- sbl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a transposition carrier and a preparation method of the transposition carrier, which relate to the technical field of biology. The transposition carrier combines the characteristics of PB and SB deoxyribose nucleic acid (DNA) transposons, the transposition can be carried out under the conditions of PB transposase and SB transposase, simultaneously, fusion genes and a gene capture reading frame are integrated, the fusion genes comprise acceptor splicing sites, reporter genes and eucaryon resistance genes, and the gene capture reading frame has polyadenylic acid tailing sequences of SV40, so the gene insertion mutation is realized in the transposition process, and the transposition carrier can be widely applied to the building of gene mutation models of mammals such as mice, rats, pigs and the like and the large-scale gene function sieving in the gene group. The transposition carrier also comprises loxp site and Frt site sequences, can realize the conditional knockout of short-range DNA segments behind the transposition and is applied to conditional deficiency model building of klenow-fragment DNA sequences of mammals such as mice, rats, pigs and the like.
Description
Technical field
The present invention relates to biological technical field, relate to a kind of transposon vector and construction process thereof specifically.
Background technology
Transposon, claiming transposable element again, is a kind of in the transposable element, has the functional character of complete transposable element, and external source genomic fragment (single-gene or polygene) in carrying, in genome, move or between life entity, propagate also and can express the phenotype that makes new advances.The swivel base of transposon can make on genome structure and the changing function and change to some extent, thereby plays an important role in evolution.From Mc Clintock found first transposon in corn since, along with to deepening continuously of transposon research and becoming better and approaching perfection day by day of technology, transposon was used for the genome functions and the genetic analysis of many species as a kind of important function of gene engineering tools.
(Human Genome Project HGP) discloses in the human genome nearly 45% and comes from transposon the Human Genome Project, it serves to show the influence of transposon in the human genome evolutionary process.Yet for a long time, owing to lack transposon efficiently, its genetic manipulation aspect is very limited in the Mammals.That finds at present can have at the element of Mammals transfer block response: hAT sample Tol
2Transposon, Tc1 sample transposon and PB (PiggyBac) transposon family, wherein Tc1 sample transposon comprises SB (Sleeping Beauty) and FP (Frog Prince).Wherein SB and PB are two kinds of DNA transposons that are most widely used Mammals at present for these.
SB be by with Tc1 family transposon sequence alignment, and from salmon (salmanoid) gene element from a kind of Tcl/mariner sample transposon that reconstructs, it be first can be in mammalian cell the DNA transposable element of swivel base.The SB transposon system mainly comprises a transposase synthetic gene and the transposable element with inverted repeats that can be discerned by transposase.Must exist simultaneously by 2 integral parts when swivel base takes place SB.PB is located away from wild cabbage earwig degree geometrid moth (Cabbage looper moth Trichoplusia ni), and each side obviously is different from the transposon type of having found, belongs to a new transposon family.Initial PB find can be in fruit bat and insect swivel base, by sequence alignment and reconstruction, find that PB can also be at mammalian cell and sexual cell swivel base.The swivel base of PB transposon system also needs transposon sequence and transposase to exist simultaneously.
SB and PB have similar swivel base mechanism as the DNA transposon, but because the source is different and the characteristic difference of itself, also have many-sided difference between the two.Compare with PB, separating of SB transposase and swivel base recognition sequence makes up binary transposon system, the security that has improved swivel base.Simultaneously SB has the integration preference of transposon, is inserted near the position donor easilier, and it is bigger to be inserted in the 8kb zone that donor closes on frequency as discovery SB swivel bases such as Kokubu; Specific activity by SB and PB such as Liang, the site of reintegrating of finding SB25% is positioned at hypoxanthine-guanine phosphoribosyl transferase (hypoxanthine-guanine phosphoribosyl transferase, Hprt) in the 4Mb of donor position, PB then fails to show this preference.And compare with SB, PB has higher transposition activity, and any footprint is not stayed in the donor position behind the swivel base, can not cause the change of donor place genetic material.
Summary of the invention
In view of this, the object of the invention provides a kind of SB and two kinds of DNA transposons of PB novel transposon vector and construction process thereof characteristic, that be used for transgenations such as Mammals mouse, rat, pig of having merged.
For realizing purpose of the present invention, the present invention adopts following technical scheme:
A kind of transposon vector comprises following element:
A) PB transposase recognition sequence PBL and PBR;
B) prokaryotic organism resistant gene;
C) replication origin sequence;
D) SB transposase recognition sequence SBL and SBR;
E) gene trap frame, described gene trap frame comprise the fusion gene of acceptor splicing site, reporter gene and eukaryote resistant gene and the polyadenylic acid signal sequence of SV40; Described resistant gene with the reporter gene fusion is different with the contained resistant gene of described transposon vector.
Wherein, described PB transposase recognition sequence PBL and PBR lay respectively at the two ends of transposon; Be followed successively by the fusion gene of prokaryotic organism resistant gene, replication origin sequence, SB transposase recognition sequence SBL, acceptor splicing site, reporter gene and eukaryote resistant gene, polyadenylic acid signal sequence and the SB transposase recognition sequence SBR of SV40 between PB transposase recognition sequence PBL and the PBR.
Transposon vector of the present invention comprises PB transposase recognition sequence PBL and PBR and SB transposase recognition sequence SBL and SBR, merged the characteristic of PB and two kinds of DNA transposons of SB, had closely swivel base preference of the high transposition activity of PB and SB concurrently, guarantee transposon vector can be under PB transposase and SB transposase condition swivel base.Wherein, described PB transposase recognition sequence PBL has nucleotide sequence shown in the SEQ ID NO:1, described PB transposase recognition sequence PBR has nucleotide sequence shown in the SEQ ID NO:2, described SB transposase recognition sequence SBL has nucleotide sequence shown in the SEQ ID NO:3, and described SB transposase recognition sequence SBR has nucleotide sequence shown in the SEQ ID NO:4.
The replication initiation sequence is the replication origin of prokaryotic gene plasmid, is the forward tumor-necrosis factor glycoproteins of the 19bp composition of four high conservatives, comprises the replication initiation sequence in the transposon vector of the present invention, is used for the interior amplification of prokaryotic organism of function carrier.Wherein, described replication initiation sequence has nucleotide sequence shown in the SEQ IDNO:5.
Resistant gene can be given the resistance of host cell to some material, is directly used in the selection transformant.Prokaryotic organism resistant gene of the present invention is used for the screening of transformant, can be any one resistant gene well known to those skilled in the art, described resistant gene can be antibiotics resistance gene, heavy metal resistance gene or metabolic resistance gene, wherein, use the most extensive with antibiotics resistance gene.Therefore, prokaryotic organism resistant gene of the present invention.Be preferably antibiotics resistance gene.
Antibiotics resistance gene is usually given host cell microbiotic is produced resistance, and microbiotic is lethal to host cell often.Antibiotics resistance gene comprises ampicillin resistance gene (Ampr) in the prokaryotic organism, tetracycline resistance gene (Tcr), chloramphenicol resistance gene (Cmr), kalamycin resistance gene (Kanr) etc.In embodiment, described prokaryotic organism resistant gene is the ampicillin resistance gene with nucleotide sequence shown in the SEQ ID NO:6.In certain embodiments, ampicillin resistance gene also can be other resistant genes such as chloramphenicol resistance gene replaces.In certain embodiments, ampicillin resistance gene also can be other gene fragments with the characteristics of can screening and replaces, as copper resistant gene (Cur), and thymidine kinase gene (TK).
Also integrated the gene trap frame of the polyadenylic acid signal sequence of the fusion gene that comprises acceptor splicing site, reporter gene and resistant gene and SV40 in the transposon vector of the present invention, can be implemented in high-efficiency transposon, and in the swivel base process, insert gene inside, realize the insertion sudden change of gene.
The eukaryote resistant gene that merges with reporter gene of the present invention can be used for inserting the screening of sudden change and inserts the expression that gene promoter drives reporter gene, guarantee that carrier inserts cell clone screened reservation in the presence of G418 of host gene inside, can be any one eukaryote resistant gene well known to those skilled in the art, as hygromycin gene (Hygr), neomycin resistance gene (Neor) etc.In embodiment, the eukaryote resistant gene that merges with reporter gene of the present invention is a neomycin resistance gene.In certain embodiments, neomycin resistance gene also can be hygromycin gene and replaces.
Reporter gene (reporter gene) is the protein that a kind of coding can be detected or the gene of enzyme, is that its expression product is very easy to certified gene.Sequence is regulated in its encoding sequence and genetic expression merge the formation mosaic gene mutually, or merge mutually, under regulating and controlling sequence control, express with other goal gene, thus the expression that utilizes its expression product to demarcate goal gene, and screening obtains transformant.Reporter gene has been widely used in the research of animal and plant gene expression regulation.In the animal genetic engineering research field, reporter gene commonly used has beta-galactosidase gene (LacZ), chloramphenicol acetyl transferasegene (cat), dihydrofolate reductase gene, fluorescent enzyme gene etc. at present.In embodiment, reporter gene of the present invention is described beta-galactosidase gene, beta-galactosidase gene and neomycin resistance gene merge the β-geo gene that obtains having nucleotide sequence shown in the SEQ ID NO:7, express the fusion rotein of beta-galactosidase gene and neomycin resistance gene, have two kinds of proteinic characteristics simultaneously, available G418 screens, and positive colony is identified in also available X-gal dyeing.
(splice acceptor SA), is meant in the RNA montage process acceptor splicing site, in the splice site sequence of cut-out and reclosing site introne 3 ' end.In embodiment, acceptor splicing site of the present invention has nucleotide sequence shown in the SEQ ID NO:8.
Polyadenylic acid adds tailer sequence, and (polyA pA), is usually located at 150-200 adenylic acid (AMP) residue on the mRNA, is called special tail structure again.In eukaryote, polyadenylic acidization is a kind of mechanism, make the mRNA molecule in their 3 ' end interrupts.Poly-A tail (or poly-A tail) protection mRNA avoids exonuclease and attacks, and to transcribing termination, mRNA being exported and translates very important from nucleus.In the gene trap process, when reporter gene is incorporated into the endogenous gene intron, pass through the montage of mRNA precursor, reporter gene can be expressed under active promotor effect, adds tailer sequence by collaborative polyadenylic acid, and trapping genetic expression stops.In embodiment, the polyadenylic acid of described SV40 adds tailer sequence and has nucleotide sequence shown in the SEQ ID NO:9.
Transposon vector of the present invention also comprises the loxp site sequence of two Cre-loxP assemblies and the Frt site sequence of two Flp-Frt assemblies, after being used for PB and carrying out swivel base and SB secondary swivel base, under Cre and the effect of Flp recombinase, the conditionality of large fragment DNA sequence knocks out between contiguous swivel base site, to realize behind the swivel base that closely the conditionality of dna fragmentation knocks out research.Wherein, a described loxp site sequence and a Frt site sequence are between replication origin sequence and SBL, and a loxp site sequence is positioned at the upstream of a Frt site sequence; Described the 2nd loxp site is between SBL and gene trap frame; Described the 2nd Frt site sequence is between gene trap frame and SB transposase recognition sequence SBR, and the 2nd a Frt site sequence and a Frt site sequence reverse complemental.
LoxP (locus of X-over P1) site sequence derives from the P1 phage, is made up of jointly the 8bp sequence of two 13bp inverted repeats and midfeather, and the intervening sequence of 8bp has also been determined the direction of LoxP simultaneously.The Cre recombinase in catalytic dna chain exchange process with the DNA covalent attachment, the inverted repeats of 13bp be the Cre recombinase in conjunction with the territory.The Cre recombinase can mediate the specificity reorganization between two LoxP sites (sequence), makes the deleted or reorganization of gene order between the LoxP site.In embodiment, a LoxP site of the present invention is identical with the 2nd loxp site sequence direction, have nucleotide sequence shown in the SEQ IDNO:10, the Cre recombinase can effectively excise two sequences between the LoxP site, causes two sequence deletions between the loxp site.
Frt (Flp recognition target) site sequence is similar to the loxP site, and the core sequence that is 8bp by two length inverted repeats that is 13bp and length constitutes.Similar to the Cre-LoxP recombinase system.In embodiment, Frt of the present invention site has nucleotide sequence shown in the SEQ ID NO:11, but a Frt site and the 2nd Frt site sequence reverse complemental, when inserting in order to the contiguous inversion that realizes secondary swivel base dna sequence dna, Flp recombinase recombinase can be discerned two sequences between the Frt site, causes two sequence deletions between the Frt site.
The invention provides the transposon vector of nucleotide sequence shown in having shown in the SEQ ID NO:12 concrete enforcement in the embodiment.
Transposon vector of the present invention has merged the characteristic of PB and two kinds of DNA transposons of SB; can be under PB transposase and SB transposase condition swivel base; the polyadenylic acid of having integrated the fusion gene that comprises acceptor splicing site, reporter gene and resistant gene and SV40 simultaneously adds the gene trap of tailer sequence and reads frame; in order in the swivel base process, to realize the insertion sudden change of gene, can be widely used in the foundation and the interior extensive gene function screening of genome of mammiferous transgenation models such as mouse, rat, pig.Transposon vector of the present invention also comprises loxp site and Frt site sequence, can realize behind the swivel base that closely the conditionality of dna fragmentation knocks out, and is applied to the conditionality disappearance modelling of mammiferous large fragment DNA sequences such as mouse, rat, pig.
The method of utilizing genetic engineering technique to obtain dna fragmentation at present has a variety of, comprises utilizing digestion with restriction enzyme to have the carrier of molecules of interest or being the template pcr amplification with the carrier with molecules of interest, also has chemical synthesis process in addition.
The present invention also provides a kind of preparation method of transposon vector, comprising:
Step 2: transformed host cell, with the antibiotic-screening of prokaryotic organism resistant gene correspondence, digestion with restriction enzyme checking positive colony;
Wherein, described PBL and PBR lay respectively at the two ends of transposon; Be followed successively by the fusion gene of prokaryotic organism resistant gene, replication origin sequence, SBL, acceptor splicing site, reporter gene and eukaryote resistant gene between PBL and the PBR, the polyadenylic acid of SV40 adds tailer sequence and SBR; A described loxp site sequence and a Frt site sequence are between replication origin sequence and SBL, and a loxp site sequence is positioned at the upstream of a Frt site sequence; Described the 2nd loxp site adds between the tailer sequence at the polyadenylic acid of SBL and SV40; Described the 2nd Frt site sequence is between the polyadenylic acid tailing and SBR of SV40, and the 2nd a Frt site sequence and a Frt site sequence reverse complemental.
In specific embodiments, preparation method of the present invention, step 1 will be for will have the XhoI-BglII fragment of nucleotide sequence shown in SEQ ID NO:13～16 with ligase enzyme, the BglII-ClaI fragment, Cla I-SphI fragment is connected with Sph I-Xho I fragment, wherein said XhoI-BglII fragment comprises PB transposase recognition sequence PBL and PBR, the prokaryotic organism resistant gene, the replication origin sequence, SB transposase recognition sequence SBL and SBR, two loxp site sequences, two Frt site sequences and acceptor splicing site, described BglII-ClaI fragment comprises reporter gene lacZ fore portion sequence, described Cla I-SphI fragment comprises reporter gene lacZ sequence, and described SphI-Xho I fragment comprises that the end of fusion gene of reporter gene lacZ and neomycin resistance gene and the polyadenylic acid of SV40 add tailer sequence.
In specific embodiments, the segmental method of XhoI-BglII that preparation of the present invention has nucleotide sequence shown in the SEQ ID NO:13 is the dna fragmentation that first chemosynthesis comprises PB transposase recognition sequence PBL and PBR, prokaryotic organism resistant gene, replication origin sequence, SB transposase recognition sequence SBL and SBR, two loxp site sequences and two Frt site sequences, is connected after the sequence verification with the shearing receptor fragments of HindIII/BglII restriction enzymes double zyme cutting from carrier EGFP β geo.
In one embodiment, preparation of the present invention has the segmental method of BglII-ClaI of nucleotide sequence shown in the SEQ ID NO:14 for being template with the pU21 plasmid, with upstream primer with the nucleotide sequence shown in the SEQ ID NO:17 and the downstream primer amplification with the nucleotide sequence shown in the SEQ ID NO:18.
In one embodiment, preparation of the present invention has the segmental method of Cla I-SphI of nucleotide sequence shown in the SEQ ID NO:15 for extracting the pU21 plasmid, and with Cla I/Sph I digestion with restriction enzyme, reclaiming size is the 2800bp fragment.
In one embodiment, preparation of the present invention has the segmental method of SphI-Xho I of nucleotide sequence shown in the SEQ ID NO:16 for being template with the pU21 plasmid, with upstream primer with the nucleotide sequence shown in the SEQ ID NO:19 and the downstream primer amplification with the nucleotide sequence shown in the SEQ ID NO:20.
Any one host cell that the described host cell of preparation method's step 2 of the present invention can be known for those skilled in the art technician, as intestinal bacteria series bacterial strain, comprise growths such as DH5 α, W3110, HB101, JM83, JM101 and JM109 rapidly, cultivate simply the bacterial strain that recon is stable.In a preferred embodiment, host cell is an Eco.li JM109 bacterial strain.
The described digestion with restriction enzyme checking of preparation method's step 2 of the present invention positive colony is for cutting checking by restriction enzyme Sal I, BglII/Cla I, Hind III/Xho I, Hind III/BglII and SphI enzyme respectively.Wherein, the theoretical size after described restriction enzyme is cut is respectively: Sal I enzyme is cut and is produced the 9398bp fragment; The BglII/ClaI enzyme is cut and is produced 829bp and two fragments of 8569bp; Hind III/Xho I enzyme is cut and is produced 3303bp and two fragments of 6095bp; Hind III/BglII enzyme is cut and is produced 1721bp and two fragments of 7677bp; The SphI enzyme is cut and is produced 1503bp and two fragments of 7895bp.
Description of drawings
Fig. 1 shows the agarose gel electrophoresis figure after each fragment enzyme is cut among the embodiment 1～4, swimming lane 1 is the DL15000DNA molecular weight marker, swimming lane 2 is the fragment after embodiment 1 enzyme is cut, swimming lane 3 is the fragment after embodiment 2 enzymes are cut, swimming lane 4 is the fragment after embodiment 3 enzymes are cut, swimming lane 5 is the fragment after embodiment 4 enzymes are cut, and swimming lane 6 is the DL2000DNA molecular weight marker;
Fig. 2 shows the agarose gel electrophoresis figure behind the different digestion with restriction enzyme of embodiment 5, swimming lane 1 is the DL15000DNA molecular weight marker, swimming lane 2 is contrast, swimming lane 3 is the fragment after restriction enzyme Sal I enzyme is cut, swimming lane 4 is the fragment after restriction enzyme Bgl II/Cla I enzyme is cut, swimming lane 5 is the fragment after restriction enzyme HindIII/Xho I enzyme is cut, swimming lane 6 is the fragment after restriction enzyme HindIII/BglII enzyme is cut, swimming lane 7 is the fragment after restriction enzyme SphI enzyme is cut, and swimming lane 8 is the DL2000DNA molecular weight marker;
Fig. 3 shows the plasmid spectrogram of transposon vector of the present invention;
Fig. 4 show embodiment 6 transposon vectors of the present invention respectively with PB and two kinds of transposase cotransfections of SB HepG2 cell after, catch the statistics figure that native gene drives reporter gene expression, wherein X-coordinate is the experiment group, ordinate zou is a blue spot quantity.
Embodiment
The embodiment of the invention discloses a kind of transposon vector and construction process thereof.Those skilled in the art can use for reference this paper content, suitably improve processing parameter and realize.Special needs to be pointed out is that all similarly replace and change apparent to those skilled in the art, they all are regarded as being included in the present invention.Method of the present invention is described by preferred embodiment, and the related personnel obviously can change or suitably change and combination method as herein described in not breaking away from content of the present invention, spirit and scope, realizes and use the technology of the present invention.
In order further to understand the present invention, the present invention is described in detail below in conjunction with embodiment.
Embodiment 1: the segmental preparation of XhoI-Bgl II in the transposon vector of the present invention
Do not contain the Hind III-XhoI fragment of shearing receptor fragments by the calm and peaceful Bioisystech Co., Ltd of Sino-U.S. synthetic, clip size 3327bp, the transposase recognition sequence that comprises PB and SB, replication origin, ampicillin resistance gene, two loxP site sequences and two Frt site sequences, and sequence verification.
Extract EGFP β geo plasmid, with the fragment of HindIII and Xho I restriction enzymes double zyme cutting EGFP β geo plasmid and chemosynthesis, reaction system is as follows:
Add following composition in the A pipe:
Add following composition in the B pipe:
With A, B two pipes are put into 37 ℃ of water bath with thermostatic control 2h and are carried out enzyme and cut digestion, then enzyme is cut product and carried out gel electrophoresis and carry out the dna gel recovery by glue recovery test kit (QIAGEN), reclaiming length is the shearing receptor fragments of 6905bp and the chemosynthesis fragment that length is 3303bp.Reclaim fragment at T
4The following 4 ℃ of connections of the effect of dna ligase (available from Takara company) spend the night (8～12h).
The ligation system:
To connect product and be transformed into Eco.li JM109 competent cell (Takara company), through containing the positive colony that the antibiotic solid culture plate screening of ammonia benzyl obtained in 14-16 hour, the upgrading grain is identified (little upgrading grain test kit, Axgen company), Hind III-XhoI enzyme is cut evaluation (detailed process is the same), obtaining 6905bp and 3303bp segmental is correct clone, and correct clone the results are shown in Figure 1 by the XhoI-BglII fragment of Bgl II/Xho I double digestion acquisition 5024bp.
Embodiment 2: the segmental preparation of Bgl II-ClaI in the transposon vector of the present invention
With the pU21 plasmid is template, with upstream primer with nucleotide sequence shown in the SEQ ID No:17 and the downstream primer with nucleotide sequence shown in the SEQ ID No:18, carries out pcr amplification, obtains the BglII-ClaI fragment.
The pcr amplification reaction system:
The PCR response procedures is:
Gained PCR product detects through 1% agarose gel electrophoresis, reclaims the purpose fragment, connects pMD 18T carrier (Takara), sequence verification (the calm and peaceful company of Sino-U.S.).The correct clone that checks order obtains purpose fragment 830bp through the BglII/ClaI double digestion from the T carrier, the results are shown in Figure 1.
Embodiment 3: the segmental preparation of Cla I-Sph I in the transposon vector of the present invention
Extract the pU21 plasmid, with Cla I and Sph I digestion with restriction enzyme, the endonuclease reaction system is as follows:
The gained enzyme is cut product and is detected through 1% agarose gel electrophoresis, reclaims the purpose fragment, connects pMD 18T carrier (Takara), sequence verification (the calm and peaceful company of Sino-U.S.).The correct clone that checks order obtains purpose fragment 2800bp through Cla I and Sph I double digestion from the T carrier, the results are shown in Figure 1.
Embodiment 4: the segmental preparation of Sph I-Xho I in the transposon of the present invention
With the pU21 plasmid is template, with upstream primer with nucleotide sequence shown in the SEQ ID No:19 and the downstream primer with nucleotide sequence shown in the SEQ ID No:20, carries out pcr amplification, obtains Sph I-Xho I fragment.
The pcr amplification reaction system:
The PCR response procedures is:
Gained PCR product detects through 1% agarose gel electrophoresis, reclaims the purpose fragment, connects pMT18T carrier (Takara), sequence verification (the calm and peaceful company of Sino-U.S.).The correct clone that checks order obtains purpose fragment 758bp through the BglII-ClaI double digestion from the T carrier, the results are shown in Figure 1.
Embodiment 5: the preparation of transposon of the present invention
After 4 dna fragmentations recovery with embodiment 1～4 acquisition, at T
4The following 4 ℃ of connections of the effect of dna ligase (available from Takara company) spend the night (8～12h).
The ligation system:
To connect product and be transformed into Eco.li JM109 competent cell (Takara company), through containing the positive colony that the antibiotic solid culture plate screening of ammonia benzyl obtained in 14～16 hours, the upgrading grain is used restriction enzyme Sal I respectively, Bgl II/Cla I, Hind III/Xho I, Hind III/Bgl II and Sph I enzyme are cut checking.Theoretical size after restriction enzyme is cut is respectively: Sal I enzyme is cut and is produced the 9398bp fragment; Bgl II/Cla I enzyme is cut and is produced 829bp and two fragments of 8569bp; Hind III/Xho I enzyme is cut and is produced 3303bp and two fragments of 6095bp; Hind III/Bgl II enzyme is cut and is produced 1721bp and two fragments of 7677bp; The SphI enzyme is cut generation 1503bp and two segmental positive colonies of 7895bp are transposon vector pPBSBD of the present invention, the results are shown in Figure 2.
Embodiment 6: the activity checking of transposon of the present invention
By respectively with PB and SB transposase cotransfection HepG
2Cell, the activity of checking transposon pPBSBD is inserted gene inside in the swivel base process, can drive reporter gene expression under the effect of catching the upstream region of gene promotor, choose lacZ as reporter gene, can obtain the reporter gene expression situation by X-gal dyeing.Concrete steps are as follows:
Cell cultures and transfection: in the DMEM substratum that contains 10% foetal calf serum, 100IU/mL penicillin, 100 μ g/mL Streptomycin sulphates in 5%CO
2Cell culture incubator in cultivate HepG
2Cell.When cell covers 70% left and right sides, culturing bottle bottom surface,, specifically divide 3 groups to carry out transfection: 1) PBSBD500ng with transposon transfection HepG2; 2) PBSBD 500ng+pCDNA3.1 (+)-PBase 1 μ g; 3) PBSBD 500ng+pCDNA3.1 (+)-SBase 1 μ g.The transfection of HepG2 cell is carried out (the reagent specification sheets is seen in concrete operations) with LipofectamineTM2000.
Gene trap colony screening: behind transposon carrier and the transposase cotransfection HepG2 cell 24h, behind 0.25% tryptic digestion, change 10 cun dishes over to, cultivated for two weeks with the nutrient solution that contains 1000 μ g/mL G418, resistance screening through G418, behind the obvious clone to be formed, go into 96 orifice plates with the careful switching of rifle head, went down to posterity by 1: 2 in the back, wherein half carries out X-gal dyeing, to express the clone of reporter gene further in six orifice plate enlarged culturing, after treating that the clone covers with, will obtain positive cell by extract highly purified genomic dna through phenol/chloroform method.
X-gal dyeing: wash substratum off with 0.1M PBS earlier, use stationary liquid (PBS of 0.1M pH 7.3,5mM EGTA, 2mM MgCl again
2, 0.2% glutaraldehyde) fixedly 15min, elutriant (PBS of 0.1M pH7.3,2mM MgCl then
2) wash 2 times, each 5min adds staining fluid (PBS of 0.1MpH 7.3,2mM MgCl after outwelling elutriant
2, 5mM K
4Fe (CN)
63H
2O, 5mM K
3Fe (CN)
6) under 37 °, spend the night, before using, staining fluid adds X-gal (5-bromo-4-chloro-3-indoles-β-D-galactoside) to final concentration 1mg/mL.Next day, outwell staining fluid, with elutriant flushing twice, blue spot drives the reporter gene expression situation by endogenesis promoter after inserting gene inside, and statistics is seen Fig. 4.
By Fig. 4 result as seen, behind 3 groups of transfection HepG 2 cells, almost can not see blue spot after the X-gal dyeing that first group does not contain transposase, and a large amount of blue spot all occur after second group and the 3rd group of X-gal dyeing, and the 3rd group of blue spot quantity that contains SB transposase experimental group obviously contains PB transposase experimental group more than second group.The result shows in the presence of two kinds of transposases, can both successfully capture endogenesis promoter, drive the expression of native gene, under the identical situation of transposase amount, though the entrained dna sequence dna of the PB swivel base dna sequence dna more entrained than SB is big, but the activity of PB transposase is active higher than SB transposase, and the probability of catching endogenesis promoter in the swivel base process is higher.
Embodiment 7: catch determining of gene in the transposon swivel base process of the present invention
For a step is understood the gene situation of catching, the round pcr that we connect by joint positions the positive colony of the expression reporter gene that the cotransfection of transposon and PB transposase obtains, and determines to insert site information.Concrete operations are as follows:
The method of the phenol/chloroform of employing standard is extracted mammalian genes group cell, and isolating genomic dna (100ng) is spent the night with restriction enzyme Sau3AI digestion.Inferior daily 1% agarose gel electrophoresis detects, and reclaims the purpose fragment, and 65 ℃ of inactivation 20min are then at T
4Under the effect of dna ligase it is connected with annealed joint Spl-Top/blt (sau) and spends the night.Next day, 70 ℃ of inactivation 10min carry out the nest-type PRC reaction of the first round then with joint special primer Spl-P1 and pPBSBD transposon terminal repeat special primer T/PBA, and warm start LA Taq HS (Takara company) is used in reaction.
First round PCR response procedures is:
Get then behind the 1 μ L first round PCR by 1/100 dilution after product, use primer Spl-P2 and T/PB1 to carry out second and take turns PCR, reaction conditions is with first round nest-type PRC unanimity.The PCR product is taken turns in second of acquisition detect, reclaim the purpose fragment, check order with primer Spl-P2 and T/PB1 then with 1% agarose gel electrophoresis.Sequencing result is carried out BLAT, obtain the insertion genome interior location information of transposon, more specific location information is shown in Table 1.
Table 1 inserts site information
By table 1 as seen, transposon of the present invention can and can insert gene in the host genome at swivel base under the transposase effect in the swivel base process.
It is as follows wherein to relate to primer sequence:
Spl-Top：CGAATCGTAACCGTTCGTACGAGAATTCGTACGAGAATCGCTG
TCCTCTCCAACGAGCCAAGG；
Spl-Blt(Sau)：GATCCCTTGGCTCGTTTTTTTTTGCAAAAA；
Spl-P1：GTAACCGTTCGTACGAGAATTCG；
T/PBA：TTAATAAATAAACCTCGATATACAGACCG；
Spl-P2：AGAATCGCTGTCCTCTCCAAC；
T/PB1：CGCATGATTATCTTTAACGTACGTC。
In sum, pPBSBD transposon vector of the present invention has merged PB and two kinds of transposon swivel bases of SB characteristics, has proved that with the cotransfection experiments of transposase described transposon vector can successfully catch gene in the genome, drives reporter gene expression.By the early-stage Study of PB and SB transposon, know that these two kinds of transposons can also can have transposition activity Mammalss such as mouse, rat, pigs, transposon of the present invention can be used for mammiferous insertion sudden change, sets up the mutator gene animal model.After finishing swivel base under the effect of PB transposase, can utilize the SB transposase to finish swivel base for the second time, by location to the swivel base site, when the secondary swivel base enters the donor close position, can realize that the conditionality of the contiguous dna sequence dna in swivel base front and back knocks out by transposon entrained loxp and Frt site, therefore transposon vector of the present invention can be used for the foundation of large fragment DNA sequence deletion animal model.
The explanation of above embodiment just is used for helping to understand method of the present invention and core concept thereof.Should be pointed out that for those skilled in the art, under the prerequisite that does not break away from the principle of the invention, can also carry out some improvement and modification to the present invention, these improvement and modification also fall in the protection domain of claim of the present invention.
Claims (11)
1. a transposon vector is characterized in that, comprises following element:
A) PB transposase recognition sequence PBL and PBR;
B) prokaryotic organism resistant gene;
C) replication origin sequence;
D) SB transposase recognition sequence SBL and SBR;
E) gene trap frame, described gene trap frame comprise that the fusion gene of acceptor splicing site, reporter gene and eukaryote resistant gene and the polyadenylic acid of SV40 add tailer sequence; Described resistant gene with the reporter gene fusion is different with the contained resistant gene of described transposon vector;
Wherein, described PB transposase recognition sequence PBL and PBR lay respectively at the two ends of transposon; Be followed successively by the fusion gene of prokaryotic organism resistant gene, replication origin sequence, SB transposase recognition sequence SBL, acceptor splicing site, reporter gene and eukaryote resistant gene between PB transposase recognition sequence PBL and the PBR, the polyadenylic acid of SV40 adds tailer sequence and SB transposase recognition sequence SBR.
2. according to the described transposon vector of claim 1, it is characterized in that described prokaryotic organism resistant gene resistant gene is an ampicillin resistance gene.
3. according to the described transposon vector of claim 1, it is characterized in that the described eukaryote resistant gene that merges with reporter gene is a neomycin resistance gene.
4. according to the described transposon vector of claim 1, it is characterized in that described reporter gene is a beta-galactosidase gene.
5. according to the described transposon vector of claim 1, it is characterized in that the polyadenylic acid of described SV40 adds tailer sequence and has nucleotide sequence shown in the SEQ ID NO:9.
6. according to the described any transposon vector of claim 1～5, it is characterized in that, also comprise two loxp site sequences and two Frt site sequences, wherein, a described loxp site sequence and a Frt site sequence are between replication origin sequence and SBL, and a loxp site sequence is positioned at the upstream of a Frt site sequence; Described the 2nd loxp site is between SBL and gene trap frame; Described the 2nd Frt site sequence is between gene trap frame and SB transposase recognition sequence SBR, and the 2nd a Frt site sequence and a Frt site sequence reverse complemental.
7. according to the described transposon vector of claim 6, it is characterized in that having nucleotide sequence shown in the SEQ ID NO:12.
8. the preparation method of a transposon vector is characterized in that, comprising:
Step 1, with ligase enzyme the polyadenylic acid of the fusion gene of PB transposase recognition sequence PBL and PBR, prokaryotic organism resistant gene, replication origin sequence, SB transposase recognition sequence SBL and SBR, two loxp site sequences, two Frt site sequences, acceptor splicing site, reporter gene and eukaryote resistant gene and SV40 is added tailer sequence and be connected
Step 2: transformed host cell, with the antibiotic-screening of prokaryotic organism resistant gene correspondence, digestion with restriction enzyme checking positive colony;
Wherein, described PBL and PBR lay respectively at the two ends of transposon; Be followed successively by the fusion gene of prokaryotic organism resistant gene, replication origin sequence, SBL, acceptor splicing site, reporter gene and eukaryote resistant gene between PBL and the PBR, the polyadenylic acid of SV40 adds tailer sequence and SBR; A described loxp site sequence and a Frt site sequence are between replication origin sequence and SBL, and a loxp site sequence is positioned at the upstream of a Frt site sequence; Described the 2nd loxp site adds between the tailer sequence at the polyadenylic acid of SBL and SV40; Described the 2nd Frt site sequence is between the polyadenylic acid tailing and SBR of SV40, and the 2nd a Frt site sequence and a Frt site sequence reverse complemental.
9. described according to Claim 8 preparation method, it is characterized in that, step 1 will be for will have the XhoI-BglII fragment of nucleotide sequence shown in SEQ ID NO:13～16 with ligase enzyme, the BglII-ClaI fragment, Cla I-Sph I fragment is connected with Sph I-Xho I fragment, wherein said XhoI-BglII fragment comprises PB transposase recognition sequence PBL and PBR, the prokaryotic organism resistant gene, the replication origin sequence, SB transposase recognition sequence SBL and SBR, two loxp site sequences, two Frt site sequences and acceptor splicing site, described Bgl II-ClaI fragment comprises reporter gene beta-galactosidase gene fore portion sequence, described Cla I-Sph I fragment comprises reporter gene beta-galactosidase gene sequence, and described Sph I-Xho I fragment comprises that the end of fusion gene of reporter gene beta-galactosidase gene and neomycin resistance gene and the polyadenylic acid of SV40 add tailer sequence.
10. according to the described preparation method of claim 9, it is characterized in that the described host cell of step 2 is an Eco.li JM109 bacterial strain.
11. according to the described preparation method of claim 9, it is characterized in that the described digestion with restriction enzyme checking of step 2 positive colony is for cutting checking by restriction enzyme Sal I, Bgl II/Cla I, Hind III/Xho I, HindIII/Bgl II and Sph I enzyme respectively.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110203354 CN102286514A (en) | 2011-07-20 | 2011-07-20 | Transposition carrier and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110203354 CN102286514A (en) | 2011-07-20 | 2011-07-20 | Transposition carrier and construction method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102286514A true CN102286514A (en) | 2011-12-21 |
Family
ID=45333271
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110203354 Pending CN102286514A (en) | 2011-07-20 | 2011-07-20 | Transposition carrier and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102286514A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102816854A (en) * | 2012-08-31 | 2012-12-12 | 北京天辰空间生物医药研发有限公司 | Research method of space mutation mechanism and biogenic mutation molecule reporting model used by same |
| CN108728477A (en) * | 2017-04-24 | 2018-11-02 | 华东理工大学 | A kind of efficient Transpositional mutation system and construction method |
| TWI640628B (en) * | 2017-03-17 | 2018-11-11 | 長庚大學 | hSlu7 TRANSGENIC CELLS FOR PROMOTING INFLUENZA VIRUS REPLICATION |
| CN110592198A (en) * | 2019-09-10 | 2019-12-20 | 中山大学附属第七医院(深圳) | Method, system and kit for detecting FLT3/D835Y gene mutation with high sensitivity |
| CN112322656A (en) * | 2020-11-10 | 2021-02-05 | 中国农业科学院北京畜牧兽医研究所 | System and method for interfering target gene |
| CN116590341A (en) * | 2023-07-13 | 2023-08-15 | 山东维真生物科技有限公司 | adenovirus-PiggyBac system and preparation method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100154069A1 (en) * | 2007-03-07 | 2010-06-17 | Aarhus Universitet | Pig model |
-
2011
- 2011-07-20 CN CN 201110203354 patent/CN102286514A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100154069A1 (en) * | 2007-03-07 | 2010-06-17 | Aarhus Universitet | Pig model |
Non-Patent Citations (4)
| Title |
|---|
| 《Nature Genetics》 20090726 Kokubu C et al A transposon-based chromosomal engineering method to survey a large cis-regulatory landscape in mice 6-11 第4卷, 第18期 * |
| 《Nature methods》 20050922 Keng V.W. et al Region-specific saturation germline mutagenesis in mice using the Sleeping Beauty transposon system 6-11 第2卷, 第10期 * |
| 《PNAS》 20080625 Wei Wang et al Chromosomal transposition of PiggyBac in mouse embryonic stem cells 1-11 第105卷, 第10期 * |
| 《中国生物化学与分子生物学》 20100920 马元武 等 转座子Sleeping Beauty和PiggyBac 6-11 第26卷, 第9期 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102816854A (en) * | 2012-08-31 | 2012-12-12 | 北京天辰空间生物医药研发有限公司 | Research method of space mutation mechanism and biogenic mutation molecule reporting model used by same |
| TWI640628B (en) * | 2017-03-17 | 2018-11-11 | 長庚大學 | hSlu7 TRANSGENIC CELLS FOR PROMOTING INFLUENZA VIRUS REPLICATION |
| CN108728477A (en) * | 2017-04-24 | 2018-11-02 | 华东理工大学 | A kind of efficient Transpositional mutation system and construction method |
| CN108728477B (en) * | 2017-04-24 | 2022-02-22 | 华东理工大学 | Efficient transposition mutation system and construction method |
| CN110592198A (en) * | 2019-09-10 | 2019-12-20 | 中山大学附属第七医院(深圳) | Method, system and kit for detecting FLT3/D835Y gene mutation with high sensitivity |
| CN110592198B (en) * | 2019-09-10 | 2023-09-29 | 中山大学附属第七医院(深圳) | Method, system and kit for detecting FLT3/D835Y gene mutation with high sensitivity |
| CN112322656A (en) * | 2020-11-10 | 2021-02-05 | 中国农业科学院北京畜牧兽医研究所 | System and method for interfering target gene |
| CN112322656B (en) * | 2020-11-10 | 2022-08-19 | 中国农业科学院北京畜牧兽医研究所 | System and method for interfering target gene |
| CN116590341A (en) * | 2023-07-13 | 2023-08-15 | 山东维真生物科技有限公司 | adenovirus-PiggyBac system and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104745626B (en) | A kind of fast construction method of conditional gene knockout animal model and application | |
| CN107475300B (en) | Construction method and application of Ifit3-eKO1 gene knockout mouse animal model | |
| Carroll et al. | A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9 | |
| JP6888213B2 (en) | Simple and highly efficient method for producing genetically modified non-human mammals | |
| Sakurai et al. | A single blastocyst assay optimized for detecting CRISPR/Cas9 system-induced indel mutations in mice | |
| CN102286514A (en) | Transposition carrier and construction method thereof | |
| Wang et al. | Large genomic fragment deletion and functional gene cassette knock-in via Cas9 protein mediated genome editing in one-cell rodent embryos | |
| Prosser et al. | A resource of vectors and ES cells for targeted deletion of microRNAs in mice | |
| WO2017104404A1 (en) | Genetic modification non-human organism, egg cells, fertilized eggs, and method for modifying target genes | |
| RU2580017C2 (en) | Transgenic animals and methods of use | |
| Wu et al. | Engineering CRISPR/Cpf1 with tRNA promotes genome editing capability in mammalian systems | |
| CN102943092B (en) | General type PiggyBac transposon transgenosis carrier and preparation method thereof | |
| Carlson et al. | Insertional mutagenesis in mice: new perspectives and tools | |
| Liu et al. | ErCas12a CRISPR-MAD7 for model generation in human cells, mice, and rats | |
| CN101297031A (en) | PiggyBac used as genetic operation and analysis tool of vertebrate | |
| JP6958917B2 (en) | How to make gene knock-in cells | |
| CN109197781B (en) | Construction method of AURKA-CKO1-N conditional gene knockout mouse model | |
| CN106086031B (en) | Pig flesh chalone gene editing site and its application | |
| Yuan et al. | A transgenic core facility’s experience in genome editing revolution | |
| Su et al. | Efficient genome editing in cultured cells and embryos of Debao pig and swamp buffalo using the CRISPR/Cas9 system | |
| Zhang et al. | Targeted disruption of the sheep MSTN gene by engineered zinc-finger nucleases | |
| Boyd et al. | Molecular biology of transgenic animals | |
| Ma et al. | Building Cre knockin rat lines using CRISPR/Cas9 | |
| CN111549070B (en) | Method for editing X chromosome multicopy gene to realize animal sex control | |
| WO2020100361A1 (en) | Method for producing genome-edited cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20111221 |