CN112322656B - System and method for interfering target gene - Google Patents
System and method for interfering target gene Download PDFInfo
- Publication number
- CN112322656B CN112322656B CN202011249720.3A CN202011249720A CN112322656B CN 112322656 B CN112322656 B CN 112322656B CN 202011249720 A CN202011249720 A CN 202011249720A CN 112322656 B CN112322656 B CN 112322656B
- Authority
- CN
- China
- Prior art keywords
- target gene
- gene
- sequence
- seq
- dcpf1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/90—Vectors containing a transposable element
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of biology, and particularly provides a system and a method for interfering a target gene. The system for interfering the target gene provided by the invention comprises dCpf1-PS fusion protein, a Donor vector with a PS transposase recognition sequence pair, and guide RNA. Can realize the precise integration of the transgene sequence and the insertion of the exogenous gene or the interference of the target gene.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a system and a method for interfering a target gene.
Background
A transposon is a DNA sequence that can move or jump freely in the host genome, and the process of transposon movement or jumping is called transposition. The high-efficiency transposition characteristic of the transposon enables the transposon to show great application potential in the fields of transgenosis, gene therapy, gene function research and the like. One of the important applications of transposon technology is the efficient mediation of transgenesis in somatic and germ cells. The transposon mediated transgene technology has the advantages of high integration efficiency, large bearing capacity, capability of simultaneously carrying a plurality of genes, single copy form integration of transgenes, stable expression of transferred genes, easy determination of true and false sites and the like. The disadvantage of transposon-mediated transgenic technology is that the integration site of transposition is random and may be inserted into the functional gene of host to affect the expression of functional gene.
The Cpf1 protein is a new member discovered in CRISPR system research, compared with the CRISPR/Cas9 system, the CRISPR/Cpf1 has similar functions but simpler and more accurate structure, and can overcome some limitations of the CRISPR/Cas9 system in application, compared with Cas9, the guide RNA of Cpf1 is shorter, but the guide sequence (namely a DNA target site) is longer (-24 nt). Therefore, the CRISPR/Cpf1 system has wide application prospect in the field of gene editing. However, the efficiency of CRISPR/Cpf1 mediated site-directed integration is still to be further improved.
In view of the above, the present invention is particularly proposed.
Disclosure of Invention
The first purpose of the invention is to provide a system for interfering with a target gene.
A second object of the invention is to provide an application of the system described above.
The third purpose of the invention is to provide a method for interfering the target gene.
In order to achieve the above purpose of the present invention, the following technical solutions are adopted:
a system for interfering with a target gene, comprising a dCpf1-PS fusion protein, a Donor vector having a PS transposase recognition sequence pair, and a guide RNA.
Further, the Donor vector contains a splicing receptor sequence, a reporter gene or other foreign gene, and a transcription termination sequence between the PS transposase recognition sequence pair;
preferably, the reporter gene is an enhanced green fluorescent protein coding sequence and a neomycin resistance gene coding sequence;
preferably, the transcription termination sequence comprises the SV40 terminator or the BGH terminator;
preferably, the sequences of the PS transposase recognition sequence pair are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively:
CCGTATTTTCCGCACTATAAGGCGCACC(SEQ ID NO.1)；
GGTGCGCCTTATAGTGCGGAAAATACGG(SEQ ID NO.2)；
preferably, the PS transposase recognition sequence pair sequentially comprises a splicing acceptor sequence, an enhanced green fluorescent protein coding sequence, a T2A self-splicing peptide coding sequence, a neomycin resistance gene coding sequence and an SV40 terminator.
Preferably, the transgene sequence of the Donor vector is shown as SEQ ID NO. 3.
Furthermore, the Donor vector contains homologous arm sequences of target genes on two sides of a PS transposase recognition sequence pair respectively;
preferably, the homology arm sequence is located in an intron region of the target gene.
Further, the target gene is a porcine ROSA26 gene;
preferably, the guide RNA sequence is shown as SEQ ID NO. 4:
AATTTCTACTAAGTGTAGATGCCCTGGCTTAACCTGATTCTTGG(SEQ ID NO.4)。
the system is applied to the site-specific integration of target genes or the interference of the expression of the target genes.
A method for interfering the target gene, which adopts the system to edit the target gene.
Further, the method comprises introducing (a), (b) and (c) into the biological cell, and editing the target gene:
(a) a guide RNA targeting a target gene or a biological material that can express a guide RNA;
(b) a Donor vector;
(c) dCpf1-PS fusion protein or a biological material which can express dCpf1-PS fusion protein.
Further, the biological cell comprises a swine-derived cell or a swine-derived embryo;
preferably, the target gene is porcine ROSA26 gene, more preferably porcine ROSA26 gene intron 1.
Compared with the prior art, the invention has the beneficial effects that:
the system for interfering the target gene provided by the invention comprises dCpf1-PS fusion protein, a Donor vector with a PS transposase recognition sequence pair and a guide RNA. In order to realize high-efficiency exogenous gene site-specific integration and gene interference, the invention establishes a system which is used by matching with dCpf1-PS transposase fusion protein and can integrate and interfere with a specific site of a target gene. The dCpf1-PS fusion protein in the system has the target gene targeting capacity of Cpf1 protein and the transposition activity of PS transposase at the same time, wherein the dCpf1 protein of the dCpf1-PS fusion protein is guided to target genes through guide RNA, and then the PS transposase of the dCpf1-PS fusion protein is used for identifying a PS transposase identification sequence pair on a Donor vector, so that the fixed-point integration of a transgenic sequence containing the PS transposase identification sequence pair on the Donor vector to a specific position of the target gene is realized. The invention successfully realizes gene interference by taking a specific site of a pig target gene as a test example.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the embodiments or the prior art descriptions will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.
FIG. 1 is a diagram showing a structure of a transgene sequence of a Donor vector of the present invention;
FIG. 2 shows the results of the detection of the cleavage activity of gRNA targeting the first intron of the porcine ROSA26 gene in example 1;
FIG. 3 shows the results of PCR identification of primer pair 3 in example 3;
FIG. 4 shows the results of PCR identification of primer set 2 of example 3;
FIG. 5 shows the expression level of ROSA26 gene in the wild-type cells (WT) and positive PEF cells (KI) after site-directed integration of the Donor fragment in example 3.
Detailed Description
Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were carried out according to conventional conditions or conditions recommended by the manufacturer.
Unless otherwise defined, technical and scientific terms used herein have the same meaning as is familiar to those skilled in the art. In addition, any methods or materials similar or equivalent to those described herein can also be used in the present invention.
The invention provides a system for interfering a target gene, which comprises dCpf1-PS fusion protein, a Donor vector with a PS transposase recognition sequence pair, and guide RNA.
The dCpf1-PS fusion protein in the system has the target gene targeting capacity of Cpf1 protein and the transposition activity of PS transposase at the same time, wherein the dCpf1 protein of the dCpf1-PS fusion protein is guided to target genes through guide RNA, and then the PS transposase of the dCpf1-PS fusion protein is used for identifying PS transposase identification sequence pairs on a Donor vector, so that the fixed-point integration of a transgenic sequence containing the PS transposase identification sequence pairs on the Donor vector to a specific position of the target genes is realized.
The dCpf1 protein is a mutant protein obtained by mutating the functional structure domain of the Cpf1 protein to lose the function of endonuclease but retain the capability of targeting a target gene and the function of processing pre-cr RNA. The dCpf1-PS fusion protein can keep the respective functions of the dCpf1 protein and the PS transposase and does not influence each other, so that the dCpf1-PS fusion protein plays a role in a system and realizes precise recognition and integration.
In preferred embodiments, the pair of PS transposase recognition sequences can include a splice acceptor sequence, a reporter gene or other foreign gene, and a transcription termination sequence, among others; wherein, the reporter gene is, for example, an enhanced green fluorescent protein coding sequence, a neomycin resistance gene coding sequence and the like; transcription termination sequences are for example the SV40 terminator or the BGH terminator, preferably the SV40 terminator; the PS transposase recognition sequence pair is shown as SEQ ID NO.1 and SEQ ID NO. 2:
CCGTATTTTCCGCACTATAAGGCGCACC (SEQ ID NO.1), designated ZB-PS;
GGTGCGCCTTATAGTGCGGAAAATACGG (SEQ ID NO.2), and is named PS-ZB.
In a preferred embodiment, the pair of PS transposase recognition sequences and the sequence therebetween together comprise a transgene sequence in a Donor vector, and the specific structure is shown in fig. 1: inverted repeat (ZB-PS) -cleavage acceptor Sequence (SA) -enhanced green fluorescent protein coding sequence (EGFP) -T2A self-cleavage peptide coding sequence-neomycin resistance gene coding sequence (NeoR) -SV40 transcription termination sequence (polyA signal) -inverted repeat (PS-ZB); the sequence is shown as SEQ ID NO. 3.
tacagcggggaaaataagtatttgacacatcagcatttttatcagtaaggggatttctaagtgggctactgacacaaaattcctaccagatgtagccatcaagccaaatattgaattcatacaaagaaatcagaacatttaagtatacaagttgagtcataataaataaagtgaaatgacacagggaataagtattgaacacataccgtattttccgcactataaggcgcacctctagagcggccgcctcgaggaagactagggcgcagtagtccagggtttccttgatgatgtcatacttatcctgtcccttttttttccacagctcgcggttgaggacaaactcttcgcggtctttccagtggggatcgacggtatcgataagcttggtaccgcgggcccgggatccaccggtcgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaaggagggccgcggcagcctgctgacctgcggcgacgtggaggaaaaccccggccccatgggatcggccattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgatgatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgatgcagcgtggtacgcgtgaattcactcctcaggtgcaggctgcctatcagaaggtggtggctggtgtggccaatgccctggctcacaaataccactgagatctttttccctctgccaaaaattatggggacatcatgaagccccttgagcatctgacttctggctaataaaggaaatttattttcattgcaatagtgtgttggaattttttgtgtctctcactcggaaggacatatgggagggcaaatcatttaaaacatcagaatgagtatttggtttagagtttggcaacatatgcccatatgctggctgccatgaacaaaggttggctataaagaggtcatcagtatatgaaacagccccctgctgtccattccttattccatagaaaagccttgacttgaggttagattttttttatattttgttttgtgttatttttttctttaacatccctaaaattttccttacatgttttactagccagatttttcctcctctcctgactactcccagtcatagctgtccctcttctcttatggagatccctcgaccgGGTGcgccttatagtgcggaaaatacggtatgtgttcaatacttattccctgtgtcatttcactttatttattatgactcaacttgtatacttaaatgttctgatttctttgtatgaattcaatatttggcttgatggctacatctggtaggaattttgtgtcagtagcccacttagaaatccccttactgataaaaatgctgatgtgtcaaatacttattttccccgctgta(SEQ ID NO.3)。
In a more preferred embodiment, the pair of PS transposase recognition sequences each flank a homology arm sequence of the target gene. For example, when the target gene is the porcine ROSA26 gene, in order to enhance the interference to the gene, the sequence of the homologous arm of the first intron of the porcine ROSA26 gene (the left homologous arm is shown as SEQ ID NO.5, and the right homologous arm is shown as SEQ ID NO.6) is connected to both sides of the transgenic sequence shown as SEQ ID NO. 3.
Left homology arm sequence:
ctcctgtcagttacagcctcgggagtgcgcagcctcccaggaactctcgcattgccccctgggtgggtaggtaggtggggtggagagagctgcacaggcgggcgctgtcggcctcctgcggggggaggggagggtcagtgaaagtggctcccgcgcgggcgtcctgccaccctcccctccgggggagtcggtttacccgccgcctgctcggctttggtatctgattggctgctgaagtcctgggaacggccccttgttattggcttgggtcccaaatgagcgaaaccactacgcgagtcggcagggaggcggtctttggtacggccctccccgaggccagcgccgcagtgtctggcccctcgcccctgcgcaacgtggcaggaagcgcgcgcaggaggcgggggcgggctgccgggccgaggcttctgggtggtggtgactgcggctccgccctgggcgtccgccgcctgaaggacgagactagctctctacctgctctcggacccgtgggggtggggggtggaggaaggagtggggggtcggtcctgctggcttgtgggtgggaggcgcatgttctccaaaaacccgcgcgagctgcaatcctgagggagctgcagtggaggaggcggagagaaggccgcacccttctccgcagggggaggggagtgccgcaatacctttatgggagttctctgctgcctccttttcctaaggaccgccctgggcctagaaaaatccctccctcccccgcgatctcgtcatcgcctccatgtcagtttgctccttctcgattatgggcg(SEQ ID NO.5)。
right homology arm sequence:
gcgttgtcctgcaggggattgagcaggtgtacgaggacgagcccaatttctctatattcccacagtcttgagtttgtgtcacaaaataattatagtggggtggagatgggaaatgagtccaggcaacacctaagcctgattttatgcattgagactgcgtgttattactaaagatctttgtgtcgcaatttcctgatgaagggagataggttaaaaagcacggatctactgagttttacagtcatcccatttgtagacttttgctacaccaccaaagtatagcatctgagattaaatattaatctccaaaccttaggccccctcacttgcatccttacggtcagataactctcactcatactttaagcccattttgtttgttgtacttgctcatccagtcccagtcccattggctttctcctcacctgttttaggtagccagcaagtcatgaaatcagataagttccaccaccaattaacactacccatcttgagcataggcccaacagtgcatttattcctcatttactgatgttcgtgaatatttaccttgattttcatttttttctttttcttaagctgggattttactcctgaccctattcacagtcagatgatcttgactaccactgcgattggacctgaggttcagcaatactcccctttatgtcttttgaatacttttcaataaatctgtttgtattttcattagttagtaactgagctcagttgccgtaatgctaatagcttccaaactagtgtctctgtctccagtatctgataaatcttaggtgttgctg(SEQ ID NO.6)。
the system provided by the invention can realize site-specific integration and interference on the target gene, and the interference method is to simultaneously introduce the guide RNA, the Donor vector and the dCpf1-PS fusion protein into biological cells to edit the target gene.
For example, when the target gene is the porcine ROSA26 gene, in order to achieve interference with the gene, the first intron of the gene can be selected as the target site and edited using the system of the present invention:
wherein, the guide RNA is preferably a sequence shown in SEQ ID NO. 4:
AATTTCTACTAAGTGTAGATGCCCTGGCTTAACCTGATTCTTGG(SEQ ID NO.4)。
the guide RNA shown in SEQ ID NO.4, the Donor vector containing SEQ ID NO.5-SEQ ID NO.3-SEQ ID NO.6 and the dCpf1-PS fusion protein are introduced into biological cells, the guide RNA guides the dCpf1 protein to target the first intron of a porcine ROSA26 gene, and meanwhile, PS transposase recognizes a PS transposase recognition sequence pair on the Donor vector, so that the fixed-point integration of a transgenic sequence on the Donor vector to a specific position of the porcine ROSA26 gene is realized.
In the system or the interference method provided by the present invention, the guide RNA may be itself, a DNA molecule encoding the guide RNA, or a biological material containing the DNA molecule encoding the guide RNA, such as a plasmid; the dCpf1-PS fusion protein can be itself, can be a nucleic acid molecule encoding the same, and can also be a biological material containing the nucleic acid molecule encoding the same, such as an expression cassette, a plasmid, etc., for example, including functional elements that interact with the nucleic acid molecule, including but not limited to a promoter, a terminator, a marker gene, a vector, etc., such as a conventional dCpf1-PS fusion protein or a dCpf1-PS fusion protein that is modified by molecular biology, as long as it has the cleavage function of the dCpf1-PS fusion protein, which is not limited by the present invention.
In a preferred embodiment, the biological cell may be a swine-derived cell or a swine-derived embryo, or the like.
The invention is further illustrated by the following specific examples, which, however, are to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.
Example 1 screening of guide RNAs (gRNAs)
1. gRNA was prepared as follows
An oligonucleotide (Oligo) DNA sequence is designed according to a gRNA targeting sequence, and is sent to Nanjing Kingsler Biotech limited for chemical synthesis, and each gRNA is synthesized into 5 nmol. The specific sequence is as follows:
the gRNA synthesized as described above was diluted to 100mol/L with RNase-free ultrapure water and stored in a-80 refrigerator.
Targeting efficiency of T7E1 enzyme digestion detection
2 gRNAs were transfected into PEF cells of swine together with pTE4398 empty vector, respectively, and cell DNAs after 48 hours of transfection were extracted, and PCR was performed using the following primers to amplify a region of intron 1 of the swine ROSA26 gene.
PCR primer pair 1 (length of amplified product 243 bp):
F1：CGCAATACCTTTATGGGAGTTC(SEQ ID NO.8)；
R1：CACAAACTCAAGACTGTGGGAA(SEQ ID NO.9)。
and (3) denaturing and annealing the PCR amplification product, adding T7E1 enzyme and buffer solution for enzyme digestion reaction, performing polyacrylamide gel electrophoresis on the enzyme digestion product, and calculating the mutation efficiency through ImageJ software.
As shown in FIG. 2, after T7E1 enzyme digestion, PCR products of the sgRNA-1 generate two bands of 160bp and 83bp, which shows that the sgRNA-1 generates sequence mutation in a targeted region, and the mutation efficiency of the sgRNA-1 is about 26.0% by calculating the band brightness through ImageJ software. Meanwhile, another sgRNA-2 targeted to ROSA26 was designed, and no mutation was detected. In the figure, M represents a 50bp DNA Marker; nd means not detected.
Example 2 construction of Donor vector and dCpf1-PS fusion protein
The transgene sequences in the Donor vector are as follows: inverted repeat (ZB-PS) -cleavage acceptor Sequence (SA) -enhanced Green fluorescent protein coding sequence (EGFP) -T2A self-cleaving peptide coding sequence-neomycin resistance gene coding sequence (NeoR) -SV40 transcription termination sequence (polyA signal) -inverted repeat (PS-ZB), the sequence is shown in SEQ ID No. 3. Furthermore, homology arms SEQ ID NO.5 and SEQ ID NO.6 are connected to the left and right of SEQ ID NO.3, respectively.
After the Donor vector was designed, it was synthesized by Jinzhi Biotechnology, Suzhou, and cloned into pUC57 to form Donor vector pUC57-pROSA 26-Donor.
Connecting the sequences of the encoded dCpf1 protein and the PS protein by using a linker to construct a recombinant vector, expressing by using a protein expression system, and purifying to obtain the dCpf1-PS fusion protein.
Example 3 application of dCpf1-PS fusion protein, gRNA and Donor vector to interference of ROSA26 gene expression in pig cells
1. Transposon-mediated site-directed integration cell screening
The plasmid of the coded dCpf1-PS fusion protein, gRNA-1 and a Donor vector are jointly transferred into a pig PEF cell by electricity, the cell is diluted to 100/mL after being transfected for 72h, the cell is paved into 30 culture dishes of 10cm for continuous culture, after a single cloning point is formed on the cell, a cloning ring and pancreatin are used for digesting the cloning point and inoculating the cloning point into a 48-hole culture dish for continuous culture, after the cell grows to be full, the cell is transferred into a 24-hole dish, and meanwhile, partial cell is collected for extracting DNA for detection.
And (3) detecting whether the monoclonal cell is a positive cell by using the cross-homologous arm primer pair 2 and the primer pair 3, continuously carrying out amplification culture on a part of the positive cell, and freezing and storing a part of the positive cell.
PCR primer pair 2 (length of amplified product 2180 bp):
F2：GCGGAAAAGCCTGGAATACG(SEQ ID NO.10)；
R2：GAACCTGCGTGCAATCCATC(SEQ ID NO.11)；
PCR primer pair 3 (length of amplified product 2013 bp):
F3：TGCCCTGGCTCACAAATACC(SEQ ID NO.12)；
R3：AACAAGAACCTGTGCCCTCAA(SEQ ID NO.13)；
finally, 2 site-specific integrated positive cells were identified in 423 single colony spots, and the partial PCR identification results are shown in FIG. 3 (primer pair 3) and FIG. 4 (primer pair 2).
Verification of ROSA26 Gene expression
Total RNA from wild-type PEF cells and site-directed integration positive cells was extracted and inverted to cDNA. The level of ROSA26 transcription was detected and compared in two cells using qPCR quantitative primers for the ROSA26 gene. The results show (FIG. 5) that the targeted integration of the Donor fragment into the first intron of the ROSA26 gene significantly inhibited the transcription of the ROSA26 gene, thereby achieving gene interference.
qPCR primer pair (amplification product length 146 bp):
ROSA26-qF：AATGCCTGTTGAATAGCTGGA(SEQ ID NO.14)；
ROSA26-qR：TTACCCCTGCCTGTCCTACTT(SEQ ID NO.15)。
while particular embodiments of the present invention have been illustrated and described, it would be obvious that various other changes and modifications can be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.
SEQUENCE LISTING
<110> Beijing animal husbandry and veterinary institute of Chinese academy of agricultural sciences
<120> a system and method for interfering with a target gene
<160> 15
<170> PatentIn version 3.5
<210> 1
<211> 28
<212> DNA
<213> Artificial sequence
<400> 1
ccgtattttc cgcactataa ggcgcacc 28
<210> 2
<211> 28
<212> DNA
<213> Artificial sequence
<400> 2
ggtgcgcctt atagtgcgga aaatacgg 28
<210> 3
<211> 2786
<212> DNA
<213> Artificial sequence
<400> 3
tacagcgggg aaaataagta tttgacacat cagcattttt atcagtaagg ggatttctaa 60
gtgggctact gacacaaaat tcctaccaga tgtagccatc aagccaaata ttgaattcat 120
acaaagaaat cagaacattt aagtatacaa gttgagtcat aataaataaa gtgaaatgac 180
acagggaata agtattgaac acataccgta ttttccgcac tataaggcgc acctctagag 240
cggccgcctc gaggaagact agggcgcagt agtccagggt ttccttgatg atgtcatact 300
tatcctgtcc cttttttttc cacagctcgc ggttgaggac aaactcttcg cggtctttcc 360
agtggggatc gacggtatcg ataagcttgg taccgcgggc ccgggatcca ccggtcgcca 420
ccatggtgag caagggcgag gagctgttca ccggggtggt gcccatcctg gtcgagctgg 480
acggcgacgt aaacggccac aagttcagcg tgtccggcga gggcgagggc gatgccacct 540
acggcaagct gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg ccctggccca 600
ccctcgtgac caccctgacc tacggcgtgc agtgcttcag ccgctacccc gaccacatga 660
agcagcacga cttcttcaag tccgccatgc ccgaaggcta cgtccaggag cgcaccatct 720
tcttcaagga cgacggcaac tacaagaccc gcgccgaggt gaagttcgag ggcgacaccc 780
tggtgaaccg catcgagctg aagggcatcg acttcaagga ggacggcaac atcctggggc 840
acaagctgga gtacaactac aacagccaca acgtctatat catggccgac aagcagaaga 900
acggcatcaa ggtgaacttc aagatccgcc acaacatcga ggacggcagc gtgcagctcg 960
ccgaccacta ccagcagaac acccccatcg gcgacggccc cgtgctgctg cccgacaacc 1020
actacctgag cacccagtcc gccctgagca aagaccccaa cgagaagcgc gatcacatgg 1080
tcctgctgga gttcgtgacc gccgccggga tcactctcgg catggacgag ctgtacaagg 1140
agggccgcgg cagcctgctg acctgcggcg acgtggagga aaaccccggc cccatgggat 1200
cggccattga acaagatgga ttgcacgcag gttctccggc cgcttgggtg gagaggctat 1260
tcggctatga ctgggcacaa cagacaatcg gctgctctga tgccgccgtg ttccggctgt 1320
cagcgcaggg gcgcccggtt ctttttgtca agaccgacct gtccggtgcc ctgaatgaac 1380
tgcaggacga ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct tgcgcagctg 1440
tgctcgacgt tgtcactgaa gcgggaaggg actggctgct attgggcgaa gtgccggggc 1500
aggatctcct gtcatctcac cttgctcctg ccgagaaagt atccatcatg gctgatgcaa 1560
tgcggcggct gcatacgctt gatccggcta cctgcccatt cgaccaccaa gcgaaacatc 1620
gcatcgagcg agcacgtact cggatggaag ccggtcttgt cgatcaggat gatctggacg 1680
aagagcatca ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg cgcatgcccg 1740
acggcgatga tctcgtcgtg acccatggcg atgcctgctt gccgaatatc atggtggaaa 1800
atggccgctt ttctggattc atcgactgtg gccggctggg tgtggcggac cgctatcagg 1860
acatagcgtt ggctacccgt gatattgctg aagagcttgg cggcgaatgg gctgaccgct 1920
tcctcgtgct ttacggtatc gccgctcccg attcgcagcg catcgccttc tatcgccttc 1980
ttgacgagtt cttctgatgc agcgtggtac gcgtgaattc actcctcagg tgcaggctgc 2040
ctatcagaag gtggtggctg gtgtggccaa tgccctggct cacaaatacc actgagatct 2100
ttttccctct gccaaaaatt atggggacat catgaagccc cttgagcatc tgacttctgg 2160
ctaataaagg aaatttattt tcattgcaat agtgtgttgg aattttttgt gtctctcact 2220
cggaaggaca tatgggaggg caaatcattt aaaacatcag aatgagtatt tggtttagag 2280
tttggcaaca tatgcccata tgctggctgc catgaacaaa ggttggctat aaagaggtca 2340
tcagtatatg aaacagcccc ctgctgtcca ttccttattc catagaaaag ccttgacttg 2400
aggttagatt ttttttatat tttgttttgt gttatttttt tctttaacat ccctaaaatt 2460
ttccttacat gttttactag ccagattttt cctcctctcc tgactactcc cagtcatagc 2520
tgtccctctt ctcttatgga gatccctcga ccgggtgcgc cttatagtgc ggaaaatacg 2580
gtatgtgttc aatacttatt ccctgtgtca tttcacttta tttattatga ctcaacttgt 2640
atacttaaat gttctgattt ctttgtatga attcaatatt tggcttgatg gctacatctg 2700
gtaggaattt tgtgtcagta gcccacttag aaatcccctt actgataaaa atgctgatgt 2760
gtcaaatact tattttcccc gctgta 2786
<210> 4
<211> 44
<212> DNA
<213> Artificial sequence
<400> 4
aatttctact aagtgtagat gccctggctt aacctgattc ttgg 44
<210> 5
<211> 800
<212> DNA
<213> Artificial sequence
<400> 5
ctcctgtcag ttacagcctc gggagtgcgc agcctcccag gaactctcgc attgccccct 60
gggtgggtag gtaggtgggg tggagagagc tgcacaggcg ggcgctgtcg gcctcctgcg 120
gggggagggg agggtcagtg aaagtggctc ccgcgcgggc gtcctgccac cctcccctcc 180
gggggagtcg gtttacccgc cgcctgctcg gctttggtat ctgattggct gctgaagtcc 240
tgggaacggc cccttgttat tggcttgggt cccaaatgag cgaaaccact acgcgagtcg 300
gcagggaggc ggtctttggt acggccctcc ccgaggccag cgccgcagtg tctggcccct 360
cgcccctgcg caacgtggca ggaagcgcgc gcaggaggcg ggggcgggct gccgggccga 420
ggcttctggg tggtggtgac tgcggctccg ccctgggcgt ccgccgcctg aaggacgaga 480
ctagctctct acctgctctc ggacccgtgg gggtgggggg tggaggaagg agtggggggt 540
cggtcctgct ggcttgtggg tgggaggcgc atgttctcca aaaacccgcg cgagctgcaa 600
tcctgaggga gctgcagtgg aggaggcgga gagaaggccg cacccttctc cgcaggggga 660
ggggagtgcc gcaatacctt tatgggagtt ctctgctgcc tccttttcct aaggaccgcc 720
ctgggcctag aaaaatccct ccctcccccg cgatctcgtc atcgcctcca tgtcagtttg 780
ctccttctcg attatgggcg 800
<210> 6
<211> 800
<212> DNA
<213> Artificial sequence
<400> 6
gcgttgtcct gcaggggatt gagcaggtgt acgaggacga gcccaatttc tctatattcc 60
cacagtcttg agtttgtgtc acaaaataat tatagtgggg tggagatggg aaatgagtcc 120
aggcaacacc taagcctgat tttatgcatt gagactgcgt gttattacta aagatctttg 180
tgtcgcaatt tcctgatgaa gggagatagg ttaaaaagca cggatctact gagttttaca 240
gtcatcccat ttgtagactt ttgctacacc accaaagtat agcatctgag attaaatatt 300
aatctccaaa ccttaggccc cctcacttgc atccttacgg tcagataact ctcactcata 360
ctttaagccc attttgtttg ttgtacttgc tcatccagtc ccagtcccat tggctttctc 420
ctcacctgtt ttaggtagcc agcaagtcat gaaatcagat aagttccacc accaattaac 480
actacccatc ttgagcatag gcccaacagt gcatttattc ctcatttact gatgttcgtg 540
aatatttacc ttgattttca tttttttctt tttcttaagc tgggatttta ctcctgaccc 600
tattcacagt cagatgatct tgactaccac tgcgattgga cctgaggttc agcaatactc 660
ccctttatgt cttttgaata cttttcaata aatctgtttg tattttcatt agttagtaac 720
tgagctcagt tgccgtaatg ctaatagctt ccaaactagt gtctctgtct ccagtatctg 780
ataaatctta ggtgttgctg 800
<210> 7
<211> 44
<212> DNA
<213> Artificial sequence
<400> 7
aatttctact aagtgtagat ctccttctcg attatgggcg ggat 44
<210> 8
<211> 22
<212> DNA
<213> Artificial sequence
<400> 8
cgcaatacct ttatgggagt tc 22
<210> 9
<211> 22
<212> DNA
<213> Artificial sequence
<400> 9
cacaaactca agactgtggg aa 22
<210> 10
<211> 20
<212> DNA
<213> Artificial sequence
<400> 10
gcggaaaagc ctggaatacg 20
<210> 11
<211> 20
<212> DNA
<213> Artificial sequence
<400> 11
gaacctgcgt gcaatccatc 20
<210> 12
<211> 20
<212> DNA
<213> Artificial sequence
<400> 12
tgccctggct cacaaatacc 20
<210> 13
<211> 21
<212> DNA
<213> Artificial sequence
<400> 13
aacaagaacc tgtgccctca a 21
<210> 14
<211> 21
<212> DNA
<213> Artificial sequence
<400> 14
aatgcctgtt gaatagctgg a 21
<210> 15
<211> 21
<212> DNA
<213> Artificial sequence
<400> 15
ttacccctgc ctgtcctact t 21
Claims (5)
1. A system for interfering with a target gene, comprising a dCpf1-PS fusion protein, a Donor vector having a pair of PS transposase recognition sequences, and a guide RNA;
the transgenic sequence of the Donor vector is shown as SEQ ID NO. 3;
the Donor vector contains homologous arm sequences of target genes on two sides of a PS transposase recognition sequence pair respectively;
the sequence of the left homologous arm is shown as SEQ ID NO.5, and the sequence of the right homologous arm is shown as SEQ ID NO. 6; the target gene is porcine ROSA26 gene;
the guide RNA sequence is shown as SEQ ID NO. 4.
2. Use of the system of claim 1 for site-directed integration or interference with target gene expression for non-disease treatment purposes;
the target gene is porcine ROSA26 gene.
3. A method of interfering with a target gene for non-disease treatment purposes, comprising editing the target gene using the system of claim 1;
the target gene is porcine ROSA26 gene.
4. The method of claim 3, wherein the method comprises introducing (a), (b), and (c) into a biological cell, and editing a target gene:
(a) a guide RNA targeting a target gene or a biological material that can express a guide RNA;
(b) a Donor vector;
(c) dCpf1-PS fusion protein or a biological material which can express dCpf1-PS fusion protein;
the biological cell comprises a swine-derived cell or a swine-derived embryo.
5. The method of claim 4, wherein the target gene is intron 1 of the porcine ROSA26 gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011249720.3A CN112322656B (en) | 2020-11-10 | 2020-11-10 | System and method for interfering target gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011249720.3A CN112322656B (en) | 2020-11-10 | 2020-11-10 | System and method for interfering target gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112322656A CN112322656A (en) | 2021-02-05 |
| CN112322656B true CN112322656B (en) | 2022-08-19 |
Family
ID=74317753
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011249720.3A Active CN112322656B (en) | 2020-11-10 | 2020-11-10 | System and method for interfering target gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112322656B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286514A (en) * | 2011-07-20 | 2011-12-21 | 中国医学科学院医学实验动物研究所 | Transposition carrier and construction method thereof |
| CN105646719A (en) * | 2016-02-24 | 2016-06-08 | 无锡市妇幼保健院 | Tool for efficient site-specific transposition of genes and application of tool |
| CN109136248A (en) * | 2017-08-31 | 2019-01-04 | 苏州金唯智生物科技有限公司 | Multiple target point editor carrier and its construction method and application |
| CN110257425A (en) * | 2019-05-05 | 2019-09-20 | 扬州大学 | A kind of PS Transposon System and its gene transfer method of mediation |
| CN110484538A (en) * | 2019-09-11 | 2019-11-22 | 中国农业科学院北京畜牧兽医研究所 | Identify sgRNA and its coding DNA, gene editing method, kit and the application of porcine ROSA 26 gene |
-
2020
- 2020-11-10 CN CN202011249720.3A patent/CN112322656B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286514A (en) * | 2011-07-20 | 2011-12-21 | 中国医学科学院医学实验动物研究所 | Transposition carrier and construction method thereof |
| CN105646719A (en) * | 2016-02-24 | 2016-06-08 | 无锡市妇幼保健院 | Tool for efficient site-specific transposition of genes and application of tool |
| CN109136248A (en) * | 2017-08-31 | 2019-01-04 | 苏州金唯智生物科技有限公司 | Multiple target point editor carrier and its construction method and application |
| CN110257425A (en) * | 2019-05-05 | 2019-09-20 | 扬州大学 | A kind of PS Transposon System and its gene transfer method of mediation |
| CN110484538A (en) * | 2019-09-11 | 2019-11-22 | 中国农业科学院北京畜牧兽医研究所 | Identify sgRNA and its coding DNA, gene editing method, kit and the application of porcine ROSA 26 gene |
Non-Patent Citations (3)
| Title |
|---|
| MK787297.1;Moore等;《GenBank》;20190606;全文 * |
| RNA-guided DNA insertion with CRISPR-associated transposases;Jonathan Strecker等;《Science》;20190606;第365卷(第6448期);第48-53页 * |
| 双报告基因真核表达载体的构建及其功能鉴定;赵智凝等;《现代生物医学进展》;20140831;第14卷(第23期);第4414页左栏第2-3段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112322656A (en) | 2021-02-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6888213B2 (en) | Simple and highly efficient method for producing genetically modified non-human mammals | |
| JP5735927B2 (en) | Re-engineering the primary structure of mRNA to enhance protein production | |
| JP3740134B2 (en) | Method for the modification of expression characteristics of endogenous genes of certain cell lines or microorganisms | |
| KR101311619B1 (en) | Process for chromosomal integration and DNA sequence replacement in Clostridia | |
| JP7418470B2 (en) | Integration of nucleic acid constructs into eukaryotic cells using transposase derived from Orydias | |
| KR20210149686A (en) | Polypeptides useful for gene editing and methods of use | |
| CN109136248B (en) | Multi-target editing vector and construction method and application thereof | |
| JP7418469B2 (en) | Transfer of nucleic acid constructs into eukaryotic genomes using transposase from amyelois | |
| EP0733059A1 (en) | Compounds and methods for site-directed mutations in eukaryotic cells | |
| JP5374584B2 (en) | Improved protein expression system | |
| CN111373041A (en) | CRISPR/CAS systems and methods for genome editing and regulation of transcription | |
| KR20210110826A (en) | Non-replicating transgenic particles and transduced particle-based reporter systems having one or more non-native tail fibers | |
| CN113302303A (en) | Modified filamentous fungal host cells | |
| CN112322656B (en) | System and method for interfering target gene | |
| US6376192B1 (en) | Method for screening of DNA libraries and generation of recombinant DNA constructs | |
| KR102026067B1 (en) | Shuttle vector for regulation of target gene expression in escherichia coli and corynebacterium glutamicum | |
| CN113166741A (en) | Multiple deterministic assembly of DNA libraries | |
| US20230374479A1 (en) | Technique for modifying target nucleotide sequence using crispr-type i-d system | |
| CN114540421A (en) | Controllable editing method for silkworm MSG and PSG expression genes | |
| CN111349642A (en) | Gene expression cassette and use thereof | |
| AU2010243421B2 (en) | Modification of the genome of a lytic bacteriophage by immobilizing said bacteriophage in the host bacterium thereof | |
| US20190218533A1 (en) | Genome-Scale Engineering of Cells with Single Nucleotide Precision | |
| CN113474454A (en) | Controllable genome editing system | |
| CN114891791B (en) | sgRNA of specific targeting canine Rosa26 gene and application thereof | |
| Eddy | Introns in the T-even bacteriophages |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |