CN111349642A

CN111349642A - Gene expression cassette and use thereof

Info

Publication number: CN111349642A
Application number: CN202010180841.0A
Authority: CN
Inventors: 涂桂洪; 邓惠平
Original assignee: Guangzhou Jinyinyuan Biotechnology Co ltd
Current assignee: Guangzhou Jinyinyuan Biotechnology Co ltd
Priority date: 2020-03-16
Filing date: 2020-03-16
Publication date: 2020-06-30

Abstract

The invention relates to the field of molecular biology, in particular to a gene expression cassette and application thereof. The gene expression cassette comprises: a. a first reporter gene lacking a promoter; a fragment located at the 5' end of a, comprising at least two different cleavage sites in its sequence. The 5' fragment can form a "birdcage" structure which can capture constitutive promoters in high flux, if the inserted fragment in the "birdcage" can express the first reporter gene, the inserted fragment contains a promoter suitable for host cells, and therefore high-flux promoter screening can be carried out.

Description

Gene expression cassette and use thereof

Technical Field

The invention relates to the field of molecular biology, in particular to a gene expression cassette and application thereof.

Background

The promoter is a key element for the effective expression of genes and the industrialization of genetic engineering, and determines the high and low yield of a gene product and the level of production process technology.

The recombinant protein is produced by using genetic engineering technology, and an inducible expression system taking host cells, particularly escherichia coli (e.coli), as host bacteria of foreign genes is generally adopted at present. The defects of the inducible expression system are described below by taking the most common host cell, E.coli, as an example. The expression system is widely used with various promoters (including trc, lac, tac, lacUV5-T7, etc.) modified based on the promoter of the lactose operon (lac operon). The advantages of using the escherichia coli expression system to produce the recombinant protein are as follows: the Escherichia coli is easy to culture, the fermentation period is short, the yield per unit time is higher than that of yeast and mammalian cells, and the cost of the culture medium is low. Therefore, most of the current methods for realizing the scale production of recombinant proteins still use an inducible Escherichia coli expression system.

However, the disadvantages of inducible expression systems are also very pronounced: 1, the expression system requires the addition of isopropyl thiogalactoside (IPTG) as an inducer. Because IPTG is expensive and toxic, and is not beneficial to the production of medicinal recombinant protein, the medicinal recombinant protein can not be used in clear text; 2, the exogenous gene expressed by the escherichia coli is induced by an Inducer (IPTG) or a physical method (temperature sensitivity), and the induction time and the induction strength are important for the expression of the exogenous gene and are not easy to master; 3, after induction, the growth of the thalli is stopped, high-density culture cannot be carried out, and the expression quantity of biomass and exogenous protein is not very high generally; 4, the Escherichia coli has no complete secretion mechanism, and most of exogenous genes tend to form insoluble inclusion bodies to be left in the cells when high expression is induced. The method brings great troubles to the subsequent extraction process, the denaturation and renaturation processes are complicated and time-consuming, the mismatching often occurs, and the recovery rate of the recombinant protein is generally not more than 30%.

This is the biggest technical hurdle always faced by inducible expression systems. The establishment of a constitutive secretory expression system of E.coli is the most effective way to overcome this technical obstacle. Tianlingqi et al (J.Bioengineering., 2010,30(3): 61-66) cloned the E.coli S-adenosylmethionine synthetase (SAMS) gene and the entire DNA fragment including the constitutive promoter sequence of the 5' -end of the gene on the E.coli pBR322 plasmid and transformed E.coli, achieving constitutive expression of the S-adenosylmethionine synthetase (SAMS) gene. In the introduction of the present inventors, bases at several positions between +5 and +17 of the transcription initiation site of the lactose operon in the pUC19 vector were mutated to become a constitutive promoter, thereby realizing constitutive expression of aspartate aminotransferase AspAT (proceedings of Process engineering,

volume

7, 3 rd, month 6 2007).

Both cases use the constitutive promoter of the E.coli gene itself or artificial mutation to realize the constitutive expression of the E.coli gene.

Poo et al (Biotechnol. Lett.24(2002) 1185-1189) cloned the D-amino acid aminotransferase gene of Geobacillus (Geobacillus toebi) and identified the promoter sequence located at the upstream 5' -end of the gene. Poo et al achieved constitutive expression of recombinant human tumor necrosis factor (rhTNF) in E.coli (E.coli) using the heterologous promoter. Ki Jun Jeong et al (Protein Expression and Purification 36(2004) 150-156) used the heterologous constitutive promoter to express the human leptin (leptin) gene in E.coli (E.coli), and 2.1g/L leptin was obtained without any inducer and with the addition of feed. No suggestion of soluble secretory expression of the target protein is found in the literature, presumably intracellular expression.

Disclosure of Invention

The invention aims to provide a method and a system for screening a constitutive promoter at high throughput so as to simplify the industrial production process of medicinal recombinant protein.

The present invention relates to a gene expression cassette comprising:

1, which is a tetracycline resistance gene lacking a promoter, and the 5' end fragment of the tetracycline resistance gene comprises BglII, NdeI and EcoRI enzyme cutting sites;

penicillin resistance gene possessed by pT7-7 plasmid; and the penicillin resistance gene is capable of being expressed under non-inducible conditions.

The 5' fragment can form a birdcage structure for capturing a constitutive promoter in a high-throughput manner, if the inserted fragment in the birdcage can enable the tetracycline resistance gene under the condition of no inducer, the inserted fragment contains the constitutive promoter, and if only the penicillin resistance gene is expressed and the tetracycline gene is not expressed, the inserted promoter is not the constitutive promoter.

The invention also relates to a gene expression cassette capable of expressing a reporter gene, which is obtained by inserting a constitutive promoter between BglII and NdeI/EcoRI enzyme cutting sites in the gene expression cassette and inserting a target gene after the constitutive promoter.

According to a further aspect of the invention, there are provided a vector and a host cell comprising a gene expression cassette as described above, or a gene expression cassette capable of expressing a reporter gene as described above.

According to one aspect of the invention, the invention also relates to the use of a gene expression cassette as described above in the screening of constitutive promoters in host cells.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a schematic diagram showing the reaction principle of three rounds of PCR reactions using pBR322 plasmid DNA as a template and primers (T6/T3; T5/T3; T4/T3) in one embodiment of the present invention;

FIG. 2 is an electropherogram of the PCR reaction product T3 according to an embodiment of the present invention;

FIG. 3 is a schematic diagram of the insertion of T3 into the T7 plasmid in one embodiment of the present invention; the dotted line is the core structural region of the birdcage constructed by the invention and is used for cloning the fragment of the promoter, Tet^RIs a reporter gene;

FIG. 4 is an electrophoretogram of T3/T7 shown by the enzyme digestion identification result in one embodiment of the present invention;

FIG. 5 shows the result of the electrophoresis of Hpro1 isolated in one embodiment of the present invention;

FIG. 6 is a schematic diagram of the structure of Hpro1 inserted into T3/T7 according to an embodiment of the present invention;

FIG. 7 is a schematic diagram of the expression cassettes for the E.coli outer membrane protein A leader peptide (ompA) and hEGF genes in one embodiment of the present invention;

FIG. 8 shows the electrophoresis result of hEGF in the supernatant of the culture medium of HE5/BL21 in one embodiment of the present invention;

FIG. 9 shows the results of electrophoresis of hEGF remaining in the cells of the culture medium in example HE5/BL 21;

FIG. 10 shows the results of the electrophoresis of hEGF in example HE5/TG1 in accordance with an embodiment of the present invention.

Detailed Description

Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as part of one embodiment, can be used on another embodiment to yield a still further embodiment.

It is therefore intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents. Other objects, features and aspects of the present invention are disclosed in or are apparent from the following detailed description. It is to be understood by one of ordinary skill in the art that the present discussion is a description of exemplary embodiments only, and is not intended as limiting the broader aspects of the present invention.

The present invention relates to a gene expression cassette comprising:

The penicillin resistance gene can be expressed on the premise that the tetracycline resistance gene cannot be expressed, so that host cells can be conveniently screened.

In the present invention, the host cell refers to a cell that can be used for introducing a vector, and includes, but is not limited to, prokaryotic cells such as Escherichia coli or Bacillus subtilis, fungal cells such as yeast cells or Aspergillus, insect cells such as S2 Drosophila cells or Sf9, or animal cells such as fibroblast, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, HEK 293 cells, or human cells. The host cell is preferably a prokaryotic cell, more preferably E.coli.

In the present invention, the inducing condition of the inducible promoter may be various inducing agents (e.g., IPTG) or physical conditions (e.g., temperature).

In some embodiments, the tetracycline resistance gene has at least one terminator at the 3' end.

In some embodiments, the terminator is rrnBT₁T₂。

In some embodiments, the constitutive promoter sequence is set forth as SEQ ID NO 2.

In some embodiments, the gene of interest is hEGF, and further comprising upstream of the hEGF, downstream of the constitutive promoter, a signal peptide gene useful for secretory expression.

In some embodiments, the signal peptide is an outer membrane protein gene.

In some embodiments, the outer membrane protein gene is ompA.

In a specific embodiment of the present invention, the expression frame is composed of a constitutive promoter sequence cloned from a soil metagenome, an E.coli outer membrane protein A secretion leader peptide (ompA) sequence, a human epidermal growth factor (hEGF) gene and a transcription terminator (rrnBT1T 2). The invention demonstrates that the cloned constitutive promoter is used in the case of not adding any inducerUnder the condition, the recombinant hEGF has strong activity of expressing foreign genes, and realizes the soluble secretion expression and transmembrane transport of hEGF under the action of escherichia coli outer membrane protein A secretion leader peptide (ompA). The engineering bacteria constructed according to the invention have the thallus density OD under the condition of continuous flow feeding₆₀₀As high as 100, 90% or more of the expressed human epidermal growth factor (hEGF) is secreted into the culture medium, and less than 10% of the human epidermal growth factor (hEGF) remains in the cells. The fermentation liquor is separated and purified by gel chromatography after membrane filtration, and the human epidermal growth factor with the purity of more than 99 percent can be obtained, and the yield is 200mg/L fermentation liquor.

The invention also relates to a vector comprising a gene expression cassette as described above, or comprising a gene expression cassette capable of expressing a reporter gene as described above.

The term "vector" refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector is capable of expressing a protein encoded by an inserted polynucleotide, the vector is referred to as an expression vector. The vector may be introduced into a host cell by transformation, transduction, or transfection, and the genetic material elements carried thereby are expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to: a plasmid; phagemid; a cosmid; artificial chromosomes such as Yeast Artificial Chromosomes (YACs), Bacterial Artificial Chromosomes (BACs), or artificial chromosomes (PACs) derived from P1; bacteriophage such as lambda phage or M13 phage, animal virus, etc. The vector is preferably derived from a virus. The vector preferably contains the essential sequences required for packaging and delivery to the cell. It is desirable that the vector be composed in part of enveloped or non-enveloped viruses. Animal viruses that may be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papilloma viruses, papilloma polyoma vacuolatum viruses (e.g., SV 40). Preferred Escherichia coli vectors of the present invention; in some embodiments, the vector does not contain BglII, NdeI, and EcoRI cleavage sites other than a); in some embodiments, the vector is constructed by inserting the gene expression cassette described above into the BglII/PstI site of the T7 plasmid.

The invention also relates to a host cell comprising in its genome a gene expression cassette as described above, or a gene expression cassette capable of expressing a reporter gene as described above.

In some embodiments, the host cell is e.

In some embodiments, the application comprises:

1) respectively arranging BglII and NdeI/EcoRI enzyme cutting sites at two ends of nucleic acid to be screened;

2) connecting the sequence in the step 1) into the gene expression cassette;

3) expressing the product obtained in step 2) in a host cell under non-inducing conditions;

4) if the first reporter gene in the host cell in step 3) is capable of being expressed, the nucleic acid sequence to be screened comprises a constitutive promoter that is useful for the host cell.

In some embodiments, the nucleic acid to be screened is a natural nucleic acid derived from an animal, a plant, a microorganism, or an artificially synthesized nucleic acid.

In some embodiments, the animal is a mammal, e.g., a human, rat, mouse, rabbit, monkey, pig, horse, cat, dog, and the like.

In some embodiments, the animal is an insect, such as caenorhabditis elegans.

In some embodiments, the animal is a fish, such as zebrafish.

In some embodiments, the plant is arabidopsis thaliana.

In some embodiments, the microorganism is a bacterium, such as a bacterium of the order enterobacteriales.

In some embodiments, the nucleic acid to be screened is less than 200bp in length, e.g., 190bp, 180bp, 170bp, 160bp, 150bp, 130bp, 110bp, 90bp or shorter.

Embodiments of the present invention will be described in detail with reference to examples.

Example 1 Tet without promoter^RCloning and modification of Reporter gene (Reporter)

1.Tet^RThe 5' -terminal pro sequence of the gene was modified as follows: the TGT before ATG is changed to CAT, NdeI and EcoRI cut points are added on two sides of ATG, and the original EcoRI cut point is changed to BglII.

Tetracycline resistance gene (Tet)^R) 5' -terminal prosequences

Modified sequences of the invention

Design of PCR primers

T4:5’-ATAGATCTCA TGTTTGACAG CTTATCATCG ATAAGCTTTA ATGCGG-3’

T5:5’-GCTTTAATGC GGTAGTTTAT CACAGTTAAA TTGCTAACGC AG-3’

T6:5’-TTGCTAACGC AGTCAGGCAC CGCATATGGA ATTCAAATCT AACAAT-3’

Tet3:5’-AGTTCTGCAGAAGAATTGATTGGCTC-3’

2. Three PCR cycles (FIG. 1) were carried out using pBR322 plasmid DNA as template and primers (T6/T3; T5/T3; T4/T3) added thereto (30 cycles each), 1. mu.l of which was used as template for the next PCR reaction, and the product of the last PCR reaction was designated as T3.

The PCR electropherogram of T3 is shown in FIG. 2.

The sequence of the tetracycline resistance gene contained in T3 and not containing a promoter is shown in SEQ ID NO: 1:

the BglII/PstI fragment of the PCR product was cloned at the BglII/PstI site of the T7-7 plasmid (FIG. 3), the T7-7 plasmid had a penicillin resistance gene, and the T3 gene fragment lacked the promoter and failed to express tetracycline resistance. The phenotype of the transformant obtained after E.coli is transformed by the recombinant plasmid (T3) is (Amp)^R/Tet^S) And is resistant to penicillin and sensitive to tetracycline. Ligation transformation, the transformation products were directly plated on penicillin (+ Ap, 20. mu.l/ml) containing LB plates and selected for penicillin resistance and tetracycline sensitivity (Amp)^R/Tet^S) The colony of (4) was used to prepare a plasmid (T3/T7).

T3/T7 were separately identified by digestion with (BglII, NdeI, BglII/NdeI) and the BglII/NdeI fragment was recovered for further use. The enzyme digestion identification result of T3/T7 is shown in FIG. 4, and the enzyme digestion identification result shows that the T3/T7 structure is correct. Example 2 cloning of constitutive promoter DNA sequences from soil metagenome

1. Taking about 1g of soil with the depth of 10cm of the compost, adding 5ml of sterile water, shaking up, boiling for 10 minutes at 100 ℃, standing for a moment, taking 1ml of supernatant, adding 1ml of 2xLB culture medium, and shaking and culturing overnight at 37 ℃.

2. The overnight culture was left to stand for a while, 1ml of the culture solution in the upper layer was collected, centrifuged at 6000rpm for 1 minute, the supernatant was discarded, 1ml of sterile water was added for washing, centrifuged at 6000rpm for 1 minute again, the supernatant was discarded, 0.2ml of sterile water was added to the precipitate, shaken well, boiled in a 100 ℃ water bath for 10 minutes, centrifuged at 12000rpm for 10 minutes, and the supernatant was used as a template DNA for PCR.

And 3, PCR reaction. The reaction solution had the following composition:

10 × buffer 5. mu.l

4×dNTP(0.25mM)5μl

Primer l(50nM)1μl

Primer 2(50nM)1μl

Template DNA 10. mu.l

Adding sterile double distilled water into 1 microliter of Taq enzyme to 50 microliter

The primer sequence for cloning the promoter is provided with BglII restriction enzyme cutting site at the 5 '-end and EcoRI restriction enzyme cutting site at the 3' -end:

PCR was carried out for 30 cycles of 94 ℃ for 5 minutes, 94 ℃ for 1 minute, 50 ℃ for 0.5 minute, 72 ℃ for 1 minute, 72 ℃ for 10 minutes, and 30 cycles.

4, separating and purifying PCR product by agarose gel electrophoresis paper sheet method

As a result, as shown in FIG. 5, the PCR product was recovered from the paper and digested with NdeI/BglII, and the digested fragment was recovered and used. The structure after cloning is shown in FIG. 6.

5. The plasmid DNA cut by BglII … NdeI and the NdeI/BglII cut fragment of the PCR product are mixed according to a proportion and are connected by T4DNA ligase, and the connected product is transformed into competent Escherichia coli by a conventional method. The transformed E.coli was cultured in LB medium containing penicillin and tetracycline with shaking at 37 ℃ overnight. Overnight cultures were continuously transferred to LB medium with stepwise increasing tetracycline concentration to enrich for strains resistant to high concentrations of tetracycline.

6. The liquid culture after serial passage is diluted properly and spread on LB agar plate containing penicillin and tetracycline, and single colony is separated. Dual resistance to tetracycline and penicillin occurs (Amp)^R/Tet^R) The transformant of (2) shows that the cloned fragment has a constitutive promoter activity. The selected protein has tetracycline and penicillin double resistance (Amp)^R/Tet^R) The sequencing of the transformant of (1) was carried out, wherein the sequencing result (about 200bp) of one transformant (designated as Hpro1) was as follows:

AGTGCAAGCTTGCATGCCTGGAGGTCGACTCTAGAAGATCTGATCTCTCCTTCACAGATTCCCAATCTCTTGTTAAATAACGAAAAAGCATCAATCAAAACGGCGGCATGTCTTTCTATATTCCAGCAATGTTTTATAGGGGACATATTGATGAAGATGGGTATCACCTTAGTAAAAAAAGAATTGCTATAAGCTGCTCTTTTTTGTTCGTGATATACTGATAATAAATTGAATTTTCACACTTCTGGAAAAAGGAGATATCATATGGAATTC(SEQ ID NO:2)

example 3 construction of EGF constitutive secretory expression framework

1. According to the amino acid composition of human epidermal growth factor (hEGF), the DNA sequence of human epidermal growth factor gene is designed by using codon computer preferred by colibacillus, and the DNA sequence is synthesized by means of segmented PCR. The 5 '-end is provided with an enzyme cutting site EcoRI, and the 3' -end is provided with an enzyme cutting site PstI.

Artificially synthesizing the DNA sequence of the human epidermal growth factor gene:

2. synthesis of DNA fragment containing E.coli secretion leader peptide sequence (ompA) and hEGF gene. Two primers were synthesized based on the DNA sequence of the outer membrane protein of escherichia coli (ompA) recorded in the GenBank library:

the 3 '-end of ompA1 overlaps with the 5' -end of ompA2 by 12 bases, and the 3 '-end of ompA2 overlaps with the 5' -end of the hEGF gene by 9 bases. In addition, a primer which is complementary with the 3' -terminal sequence of the human epidermal growth factor (hEGF) gene is synthesized, and the restriction enzyme cutting site PstI is designed in the primer:

3. artificially synthesized human epidermal growth factor (hEGF) DNA is taken as a template, primers ompA1, ompA2 and E3 are added for PCR reaction, the reaction product is taken as ompA-hEGF, restriction enzymes NdeI and PstI are used for enzyme digestion, and fragments are recovered by a paper sheet method. The expression frame containing the constitutive promoter (Hpro1), E.coli outer membrane protein A leader peptide (ompA) and hEGF gene is shown in FIG. 7, which is constructed by ligating the ompA-hEGF fragment to the NdeI and PstI cleavage sites of T3/T7, replacing the original tetracycline structural gene. The phenotype of the transformant after replacing the tetracycline structural gene by any exogenous gene is selected from penicillin resistance and tetracycline resistance (Amp)^R/Tet^R) Becomes penicillin-resistant, tetracycline-sensitive (Amp)^R/Tet^S) The expression frame constructed by the invention is easy to realizeConstitutive soluble secretory expression of histone genes.

4. Constitutive secretory expression assay for human epidermal growth factor (hEGF)

The recombinant plasmid containing constitutive promoter (Hpro1), escherichia coli outer membrane protein A leader peptide (ompA) and expression frame of hEGF gene constructed by the invention is respectively transformed into E.coli BL21(DE3) and E.coli TG 1. The transformants were designated HE5/BL21 and HE5/TG1, respectively, and were subjected to aeration culture at 37 ℃ for 16 hours in LB medium containing penicillin, respectively, and the cells and supernatant were collected by centrifugation. The results of polyacrylamide gel electrophoresis of the cells and the supernatant showed that the expression was stable in HE5/BL21, 90% of hEGF was secreted into the culture medium supernatant (fig. 8), and the amount of hEGF remaining in the cells was less than 10% (fig. 9); hEGF expression was unstable in case of HE5/TG1 (FIG. 10).

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Guangzhou city Jinyin Biotechnology Ltd

<120> gene expression cassette and use thereof

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>1275

<212>DNA

<213>artificial sequence

<400>1

atagatctca tgtttgacag cttatcatcg ataagcttta atgcggtagt ttatcacagt 60

taaattgcta acgcagtcag gcaccgcata tggaattcaa atctacaatg cgccctcggc 120

accgtcaccc tggatgctgt aggcataggc ttggttatgc cggtactgcc gggcctcttg 180

cgggatatcg tccattccga cagcatcgcc agtcactatg gcgtgctgct agcgctatat 240

gcgttgatgc aatttctatg cgcacccgtt ctcggagcac tgtccgaccg ctttggccgc 300

cgcccagtcc tgctcgcttc gctacttgga gccactatcg actacgcgat catggcgacc 360

acacccgtcc tgtggatcct ctacgccgga cgcatcgtgg ccggcatcac cggcgccaca 420

ggtgcggttg ctggcgccta tatcgccgac atcaccgatg gggaagatcg ggctcgccac 480

ttcgggctca tgagcgcttg tttcggcgtg ggtatggtgg caggccccgt ggccggggga 540

ctgttgggcg ccatctcctt gcatgcacca ttccttgcgg cggcggtgct caacggcctc 600

aacctactac tgggctgctt cctaatgcag gagtcgcata agggagagcg tcgaccgatg 660

cccttgagag ccttcaaccc agtcagctcc ttccggtggg cgcggggcat gactatcgtc 720

gccgcactta tgactgtctt ctttatcatg caactcgtag gacaggtgcc ggcagcgctc 780

tgggtcattt tcggcgagga ccgctttcgc tggagcgcga cgatgatcgg cctgtcgctt 840

gcggtattcg gaatcttgca cgccctcgct caagccttcg tcactggtcc cgccaccaaa 900

cgtttcggcg agaagcaggc cattatcgcc ggcatggcgg ccgacgcgct gggctacgtc 960

ttgctggcgt tcgcgacgcg aggctggatg gccttcccca ttatgattct tctcgcttcc 1020

ggcggcatcg ggatgcccgc gttgcaggcc atgctgtcca ggcaggtaga tgacgaccat 1080

cagggacagc ttcaaggatc gctcgcggct cttaccagcc taacttcgat cactggaccg 1140

ctgatcgtca cggcgattta tgccgcctcg gcgagcacat ggaacgggtt ggcatggatt 1200

gtaggcgccg ccctatacct tgtctgcctc cccgcgttgc gtcgcggtgc atggagccgg 1260

gccacctcga cctga 1275

<210>2

<211>273

<212>DNA

<213>artificial sequence

<400>2

agtgcaagct tgcatgcctg gaggtcgact ctagaagatc tgatctctcc ttcacagatt 60

cccaatctct tgttaaataa cgaaaaagca tcaatcaaaa cggcggcatg tctttctata 120

ttccagcaat gttttatagg ggacatattg atgaagatgg gtatcacctt agtaaaaaaa 180

gaattgctat aagctgctct tttttgttcg tgatatactg ataataaatt gaattttcac 240

acttctggaa aaaggagata tcatatggaa ttc 273

<210>3

<211>247

<212>DNA

<213>artificial sequence

<400>3

gaattcatga aaaagacagc tatcgcgatt gcagtggcac tggctggttt cgctaccgta 60

gcgcaggccg ctagaattaa ttccgactct gaatgcccgc tgtctcacga cggttactgc 120

ctacacgatg gtgtttgcat gtatatcgaa gctctggaca aatacgcgtg caactgtgtt 180

gttggttaca tcggtgaacg ttgccagtac cgtgacctga aatggtggga actggttaat 240

actgcag 247

Claims

1. A gene expression cassette comprising:

2. The gene expression cassette according to claim 1, wherein the tetracycline resistance gene has at least one terminator at the 3' end.

3. The gene expression cassette of claim 2, wherein the terminator is rrnBT₁T₂。

4. A gene expression cassette capable of expressing a reporter gene, which is obtained by inserting a constitutive promoter between BglII and NdeI/EcoRI cleavage sites in the gene expression cassette of any one of claims 1 to 3, and then inserting a target gene after the constitutive promoter.

5. The gene expression cassette capable of expressing a reporter gene according to claim 4, wherein the constitutive promoter has the sequence shown in SEQ ID NO. 2.

6. The gene expression cassette capable of expressing a reporter gene according to claim 5, wherein the gene of interest is hEGF and further comprising a signal peptide gene for secretory expression upstream of the hEGF and downstream of the constitutive promoter.

7. A gene expression cassette capable of expressing a reporter gene according to claim 6 wherein said signal peptide is an outer membrane protein gene.

8. A vector comprising the gene expression cassette according to any one of claims 1 to 3, or the gene expression cassette according to any one of claims 4 to 7, which is capable of expressing a reporter gene.

9. A host cell comprising in its genome the gene expression cassette of any one of claims 1 to 3, or the gene expression cassette of any one of claims 4 to 7 capable of expressing a reporter gene.

10. The host cell of claim 9, which is e.

11. Use of a gene expression cassette according to any one of claims 1 to 3 in the screening of constitutive promoters.

12. The use according to claim 11, wherein the nucleic acid to be screened is derived from natural nucleic acids of animals, plants, microorganisms, or artificially synthesized nucleic acids.