KR101634275B1 - Transgenic silkworms producing blue fluorescent cocoons - Google Patents

Abstract

The present invention relates to a transgenic silk producing a blue fluorescent silk, and more particularly, to a transgenic silk producing a blue fluorescent silk, in which a marker gene-regulated promoter, a marker gene, a silkworm-derived fibroin promoter and a blue fluorescent gene derived from a jellyfish (Aequorea macrodactyla) A transformant silk producing blue fluorescent silk can be produced by preparing a recombinant expression vector containing a linked gene construct and transforming silkworm with the recombinant expression vector. The blue fluorescent silk produced by the transgenic silkworm It shows light blue color even in natural light and it does not need any additional dyeing. It is eco-friendly and economical. When light of specific wavelength is shot, it shows blue color sparkling in darkness. It is useful for high fashion clothing and wallpaper materials with much higher added value than general silk. Lt; / RTI >

Description

TRANSGENIC SILKWORMS PRODUCING BLUE FLUORESCENT COCOONS <br> <br> <br> Patents - stay tuned to the technology TRANSGENIC SILKWORMS PRODUCING BLUE FLUORESCENT COCOONS

The present invention relates to a transgenic silk producing blue fluorescent silk and a method of producing blue fluorescent silk using the transgenic silk.

The silkworm belongs to the taxonomic insecta, lepidoptera, Bombyxidae, Bombyx, and moth species. The silkworm is a complete transformational insect, which develops larvae hatching from eggs, becomes a pupa, becomes an adult (moth), gives birth to an egg, and finishes its life. The life of the silkworm is relatively short, on average 60 days, and it has an advantage as an experimental animal. Eggs that have been scattered are colored when left untreated, and hatched and hatch without coloring until the following spring. The number of hatchings per year is determined by the amount of dormant hormone produced in the ganglion below the esophagus by each gene action. In silkworm eggs, fertilized nuclei divide several times to form cleavage nuclei, surrounded by protoplasts around the nuclei, and they migrate toward the edges of eggs. For example, after 12 hours of spawning, ants silkworms form a syncytial blastoderm, and 20 hours later, it is possible to carry out pickling, one of the artificial incubation methods. At 30 hours after spawning, it becomes full yolk cells and hatches into ants silkworm after about 10 days.

Various studies have been conducted to produce silkworm transgenic silkworms due to their industrial value as well as research use. The development of transgenic silkworms was carried out by the Japanese Tamura et al. Transgenic transgenic vectors were constructed using the piggyBac gene derived from ni and microinjection into transgenic silkworm cultivars was succeeded in producing transgenic silkworms for the first time. Recently, transgenic silkworms producing various biopharmaceuticals have been reported. On the other hand, it has been reported that the transfection vector is injected into the silkworm eggs by the microinjection method used by Tamura et al. In 2000, and the injection efficiency can be improved by injecting the microinjection position in the middle part between the main part and the posterior part of the embryo have.

Silkworms produce a silk protein composed of heavy-chain fibroin, light-chain fibroin, and P25 protein. Raw protein expression, especially fibroin, produces a strongly expressed protein in the posterior silk gland of the fifth instar larva, producing a phytoene protein that is approximately 20% or more of the total body weight. It is expected that clarifying the powerful and tissue-specific expression control mechanism of fibroin can provide important clues to gene expression control research, and this regulatory mechanism can be used for the mass production of useful substances in eukaryotes.

Using the specificity of amino acid sequences with large molecular weights, the study of fibroin genes was first carried out by Suzuki and Brown from the posterior silk glands at the end of the fifth instar in 1972, followed by the isolation of mRNA from the genomic DNA of silkworms in 1976 Gene was cloned. Later, the H chain and the L chain in the silkworm, and the H chain in the knuckle were cloned, and the structure and the control of the mutation were actively studied.

The H chain of the silkworm consists of two exons with a length of 16 to 17 kb, and the L chain consists of 7 exons with a length of 13472 bp. The transcription of fibroin H chain gene is activated at 25 stages of embryogenesis and repeatedly switch on and off at the posterior silk line at the larval stage. Transcriptional regulation studies using the nuclear run-on assay revealed that the transcription was localized in the first half of the posterior silk gland of the fifth instar larva. At this time, it was found that L chain was transcribed as H chain. The fibroin gene has been shown to undergo no structural changes such as gene amplification or methylation during cell differentiation, which means that the expression of the fibroin gene is largely regulated by transcription.

A transgenic animal is an animal in which an exogenous gene has been inserted into the genome of a host and a part of its trait has changed, and the foreign gene at that time is called a transgene. In the mid 1970's, we started to import foreign genes by using recombinant viruses in somatic cells or germ cells. In 1980, Gordon produced super-mice by microinjection.

Techniques for introducing a foreign gene include calcium phosphate, electroporation, DEAE-dextran, liposome, microinjection, and bombardment. Among these methods, the DEAE-dextran method and the electroporation method allow the cells to enter the cytoplasm directly through the open hole of the DNA, which may damage the DNA. The method using liposomes is widely used as a method of directly transferring DNA into a cell by fusing the DNA with a liposome, an artificial lipid vesicle, into the cell membrane. The microinjection method is a method of directly injecting DNA with a micro needle to such an extent that it does not damage the eggs by using a micro manipulator in the first embryo transfer embryo. Outpatient gene transfer technology at the practical stage will have infinite benefits to human beings if introduced foreign genes are related to growth rate control, tolerance in extreme environments, gene therapy.

In Korea, sleeping business was the best agricultural product exported $ 500 million per year in the 70s (the world's fifth largest country), but the domestic sleeping business has been affected by rapid growth of wages, labor shortage, , The price of Chinese cocoons dropped sharply due to the increase in imports of cocoons, and there was almost no production of silkworm cocoons in Korea.

Therefore, it is required to develop high value-added transgenic silkworms for the expansion of the domestic silkworm industry and the epoch-making income of the silkworm farmers.

As related prior arts, Korean Patent No. 10-0267742 (filed Jul. 7, 2000, entitled: Fluorescent silkworms using recombinant baculovirus inserted with green fluorescent protein gene and preparation method) and Korea Patent No. 10 -0323550 (registered on Jan. 24, 2002, titled: Transgenic silkworm transfection method and transgenic silkworm).

It is an object of the present invention to provide a mutant gene for a silkworm which is codon optimized to optimize silkworm mutants of a blue fluorescent gene (TagBFP2) derived from jellyfish (Aequorea macrodactyla) for the development of high value added transgenic silkworms, (PFibH) of a Fibroin protein, and producing a transgenic silkworm producing blue fluorescent silk which is transformed with silkworm silkworm transformed with the recombinant expression vector.

Another object of the present invention is to provide a method for mass production of blue fluorescent silk using the transgenic silkworm according to the present invention.

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory and are not intended to limit the invention to the particular embodiments that are described. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory and are not restrictive of the invention, There will be.

In order to achieve the above object, the present invention provides a recombinant expression vector comprising a marker gene-regulated promoter, a marker gene, a silkworm-derived fibroin promoter, and a gene construct operably linked to a blue fluorescent gene derived from jellyfish (Aequorea macrodactyla) Lt; / RTI &gt;

The blue fluorescent gene is a TagBFP2co gene that has mutated the TagBFP2 gene through codon optimization.

The marker gene-regulated promoter is a 3xP3 promoter.

The marker gene is characterized by being a fluorescent protein (EGFP, Enhanced green fluorescent protein).

The gene construct is characterized in that it has the structure of FIG.

The recombinant expression vector is characterized in that the gene construct is introduced into a piggyBac transfer vector.

Wherein the expression vector comprises a piggyBac transition vector.

The present invention provides a transformed silkworm producing a blue fluorescent silk, which is produced by transforming silkworm eggs with the recombinant expression vector according to the present invention.

In addition,

1) preparing the recombinant expression vector according to the present invention;

2) injecting the recombinant expression vector of step 1) into silkworm eggs and transforming the transformed silkworm eggs to produce transformed silkworm eggs; And

3) hatching the transformed silkworm in step 2) to produce a transgenic silkworm. The present invention also provides a method for producing a transgenic silkworm comprising the steps of:

The transformation of step 2) is characterized by using microinjection.

In step 3), a method of confirming the expression of the above-mentioned marker gene in a transformed silkworm after i) introducing the marker gene into the expression vector or ii) a method of confirming the expression of the blue fluorescent gene in the transformed silkworm The method comprising the step of selecting a transgenic silkworm.

In addition,

1) preparing the recombinant expression vector according to the present invention;

2) transforming silkworm eggs with the recombinant expression vector of step 1) to produce transformed silkworms; And

3) culturing the transformed silkworm of step 2) to obtain silk. The present invention also provides a method for mass production of blue fluorescent silk.

The blue fluorescent silk produced by the transgenic silkworm of the present invention exhibits a pale natural blue color even in natural light, so that no additional dyeing is required, so that it is eco-friendly and very economical.

In addition, the blue fluorescent silk exhibits blue fluorescence speckled in the dark when light of a specific wavelength is shot. Thus, the blue fluorescent silk can be applied to materials such as high-fashion clothing and wallpaper which have a much higher added value than general silk. It is possible to contribute to the improvement of income by raising a transgenic silk producing blue fluorescent silk which can be utilized as a material of high quality fashion clothes different from those of general silkworms.

1 is a diagram showing a comparison of TagBFP2 and TagBFP2co gene sequences.
2 is a diagram showing the structure of a gene construct (p3xP3-EGFP-pFibH-TagBFP2co) of the present invention.
Figure 3 is a diagram showing the fluorescence of EGFP in G2-transgenic silkworms.
A is the state of fluorescence in the eyes and nervous system of the F1 7th embryo in the case of eggs.
(Arrows show the eye and nervous system)
B shows that fluorescence appears in the eyes of the F1 instar in the case of larvae.
(Arrows show eyes)
C shows that in the case of the pupa, fluorescence appears in the eye.
(Arrows show eyes)
D shows fluorescence in the eye in the case of an adult
(Arrows show eyes)
Figure 4 is a diagram showing TagBFP2co fluorescence in the cocoon of a transgenic silkworm.
A is a pair of cocoon observed in bright field conditions
(Left: normal cocoon, right: transformed cocoon)
B is a pair of cocoon observed under blue fluorescence system conditions
(Left: normal cocoon, right: transformed cocoon)

Hereinafter, the present invention will be described in detail.

The present invention provides a recombinant expression vector comprising a marker gene-regulated promoter, a marker gene, a silkworm-derived fibroin promoter, and a gene construct operably linked to a blue fluorescent gene derived from jellyfish (Aequorea macrodactyla).

In the recombinant expression vector, the blue fluorescent gene (TagBFP2) gene is preferably prepared as a TagBFP2co gene mutated through codon optimization so that it can be expressed as an excess recombinant protein in transgenic silkworms. However, It is not limited.

In the recombinant expression vector, the fibroin promoter preferably uses a promoter (pFibH) of Fibroin protein, which is a main component of silkworm, for controlling the expression of a blue fluorescent gene (TagBFP2co) optimized for silkworm.

In the recombinant expression vector, the marker gene-regulated promoter is preferably a 3xP3 promoter, but not limited thereto, and any promoter capable of expressing the marker gene can be used.

In the recombinant expression vector, the marker gene may be any gene that expresses a fluorescent protein, and it is more preferable to use an EGFP (Enhanced Green fluorescent protein) gene, but the present invention is not limited thereto.

In one embodiment of the present invention, a fluorescent protein (EGFP) was used as a marker gene for the selection of transformants, and a 3xP3 promoter specifically expressed in the eye and nervous system was used to regulate the expression of the marker gene.

In the recombinant expression vector, the gene construct preferably has a construct consisting of the structure of FIG. 2, but is not limited thereto.

In the recombinant expression vector, the expression vector into which the gene construct is introduced is preferably a piggyBac vector, but is not limited thereto.

Further, the present invention provides a transformed silkworm producing blue fluorescent silk, which is produced by transforming silkworm eggs with the recombinant expression vector.

Long repeated sequences of the fibroin H-chain form a crystal structure by hydrophobic interaction. Two factors are necessary to form such a structure. First, the N-terminal and C-terminal of the H-chain should have a signal sequence to secrete the fibroin molecule into the silk. Second, the 20th cysteine residue of the H-chain C-terminal and 172 The cysteine residue must form a disulfide bond. Therefore, in the present invention, a silkworm transformant expressing a blue fluorescent protein gene as a recombinant protein in the fibroin H-chain was prepared based on such a system.

In addition,

1) preparing the recombinant expression vector according to the present invention;

2) injecting the recombinant expression vector of step 1) into silkworm eggs and transforming the transformed silkworm eggs to produce transformed silkworm eggs; And

3) hatching the transformed silkworm in step 2) to produce a transgenic silkworm. The present invention also provides a method for producing a transgenic silkworm comprising the steps of:

In the above method, the transformation in step 2) is preferably performed using microinjection, but not limited thereto, and all known transformation methods can be used.

In the method, in the step 3), the step of selecting a transgenic silkworm may be further included by one of the following methods.

i) a method of inserting a marker gene into an expression vector and then confirming the expression of the marker gene in the transformed silkworm; or,

ii) a method for confirming expression of a blue fluorescent protein gene in a transgenic silkworm.

In one embodiment of the present invention, silkworm eggs were transformed with the recombinant expression vector using a known microinjection method and then hatched with larvae. The moths of some adult moths were crossed with each other to produce silkworm eggs of F1 generation . Then, the transformants of the F1 generation were selected by observing the expression of the marker gene in the eyes and neural tissues, larvae, pupa, or adults of the silkworms at the early stage of the silkworm after laying eggs of these F1 generations. Then, the F2 generation transformants were obtained by crossing the larvae, pupae, and adults having green fluorescent eyes in the finally selected transformants of the F1 generation (see Table 1 and FIG. 2).

In addition, the obtained cocoon-transformed cocoons of the F2 generation were observed with a fluorescence microscope, and blue fluorescence was observed, thereby confirming that TagBFP2co recombinant protein was normally expressed in fibroin (see FIG. 3).

In addition,

1) preparing the recombinant expression vector according to the present invention;

2) transforming silkworm eggs with the recombinant expression vector of step 1) to produce transformed silkworms; And

3) culturing the transformed silkworm of step 2) to obtain silk. The present invention also provides a method for mass production of blue fluorescent silk.

Hereinafter, the present invention will be described in detail by the following examples.

However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

< Example  1> Construction of transformation vector for transformation

In order to produce transgenic silkworms expressing blue fluorescent protein in silkworm silk, the fibroin promoter and TagBFP2co gene were introduced into piggyBac vector.

First, to obtain the fibroin promoter, the fragment containing the 1,124 bp promoter sequence and the intron (972 bp) of the fibroin H gene (nt 61, 312 - 63, 870 nt) at the 1,430 bp N-terminus contained genomic DNA isolated from silkworm Primers (pFibHN-F: 5'-GGCGCGCCGTGCGTGATCAGGAAAAAT-3 '(27mer) and pFibHN-R: 5'-TGCACCGACTGCAGCACTAGTGCTGAA-3' (27 mer) Madison WI). The completed plasmid was named 'pGEMT-pFibH-NTD'.

Fragments containing the 300 bp 3 'region of the 180 bp 3' end of the H-chain gene ORF and the fibroin H gene (nt 79,021 - 80,009 of AF226688) -AGCGTCAGTTACGGAGCTGGCAGGGGA-3 '(27 mer) and pFibHC-R: 5'-TATAGTATTCTTAGTTGAGAAGGCATA-3' (27 mer) and cloned into pGEM-T Easy Vector System (Promega, USA) The plasmid was designated pGEMT-CTD.

Then, fragments were prepared by restriction enzyme treatment of 'pGEMT-pFibH-NTD' with Asc I and BamH I and 'pGEMT-CTD' with Sal I and Fse I, respectively. These fragments were cloned together into a restriction enzyme treated pBluescriptII SK (-) vector (Stratagene, CA) with Apa I and Not I, and named as pFibHNC-null.

The TagBFP2co gene without the stop codon was constructed by codon optimization in the TagBFP2 gene to optimize the codon and was optimized using the gene synthesis procedure (performed by Bioneer). The pGEM-T easy vector (Promega Co . Data comparing the sequences of TagBFP2 and TagBFP2co genes using TagBFP2 gene and TagBFP2co gene and ClustalW program are shown in FIG.

(TagBFP2 gene: SEQ ID NO: 1

ATGAGCGAGCTGATTAAGGAGAACATGCACATGAAGCTGTACATGGAGGGCACCGTGGACAACCATCACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAGGGCACCCAGACCATGAGAATCAAGGTGGTCGAGGGCGGCCCTCTCCCCTTCGCCTTCGACATCCTGGCTACTAGCTTCCTCTACGGCAGCAAGACCTTCATCAACCACACCCAGGGCATCCCCGACTTCTTCAAGCAGTCCTTCCCTGAGGGCTTCACATGGGAGAGAGTCACCACATACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACACCAGCCTCCAGGACGGCTGCCTCATCTACAACGTCAAGATCAGAGGGGTGAACTTCACATCCAACGGCCCTGTGATGCAGAAGAAAACACTCGGCTGGGAGGCCTTCACCGAGACGCTGTACCCCGCTGACGGCGGCCTGGAAGGCAGAAACGACATGGCCCTGAAGCTCGTGGGCGGGAGCCATCTGATCGCAAACGCCAAGACCACATATAGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCTGGCGTCTACTATGTGGACTACAGACTGGAAAGAATCAAGGAGGCCAACAACGAGACCTACGTCGAGCAGCACGAGGTGGCAGTGGCCAGATACTGCGACCTCCCTAGCAAACTGGGGCACAAGCTTAATTAA)

(TagBFP2co gene: SEQ ID NO: 2

)

The plasmid was restriction enzyme treated with Not I and Bbvc I, and the isolated fragment was cloned into 'pFibHNC-nul' which was restriction enzyme treated with Not I and Bbvc I. The completed plasmid was named &quot; pFibHNC-TagBFP2co &quot;.

Finally, 'pFibHNC-TagBFP2co' was restriction enzyme treated with Asc I and Fse I, and the isolated fragment was cloned into 'pG-3xP3-EGFP' which was restriction enzyme treated with Asc I and Fse I. At this time, the EGFP gene was used as a marker gene for selecting the transformant, and the 3xP3 promoter was used as the regulatory promoter of the EGFP gene. The completed plasmid was named 'pG-3xP3-EGFP-pFibH-TagBFP2co' (Fig. 2).

< Example  2> Preparation and selection of silkworm transformants

<2-1> Preparation and breeding of silkworm

Bombyx mori used in the transgenic bee (Bombyx mori) was used as a standard of breeding standard (temperature, 24 ° C - 27 ° C, relative humidity, 70% - 90% %). In addition, silkworm eggs used for transformation were used only within 4 hours after spawning.

<2-2> Production of silkworm transformant

The silkworm transformants were prepared by microinjection method.

Specifically, the concentration ratio of the transition vector 'pG-3xP3-EGFP-pFibH-TagBFP2co' and helper plasmid pHA3PIG prepared in Example 1 was 1: 1 (200 ng / And diluted to a concentration of 0.2 μg / μl in a buffer solution for microinjection (5 mM KCl, 0.5 mM Phosphate buffer, pH 7.0). The microinjection of the silkworm early blastocyst was injected into the middle part of the middle between the main and posterior parts of the embryo. The procedure was as follows. First, a small hole is drilled in the railing of the silkworm with a tungsten needle, the tip of the microcapillary containing the DNA solution is inserted into the hole, and the DNA solution is injected into the egg using the air pressure of the microinjector Respectively. At this time, the amount of DNA solution injected into each embryo was 10-15 nl, and the hole in the railing was blocked with a cyanocrylate adhesive. A total of 600 silkworm eggs were microinjected. After microinjection, silkworm eggs were placed in a moistened patridish and protected until incubated at 25 ° C.

<2-3> Screening of silkworm transformants

Selection of silkworm transformants was performed by fluorescence microscopy. Specifically, the silkworms were selected for each generation and period by using a LEICA MZ16FA microscope (Leica, USA) and a Microscope MZ FLIII Flourescence Filter EGFP fluorescence filter (Leica, USA). According to the previously reported documents, the 3xP3 promoter is known to act in the eyes and nervous tissues of the silkworm early stage, larvae and pupae, and adult eyes, and thus the transformants were selected based on these characteristics.

As a result, 98 larvae hatch. Among them, adult moths were crossed with each other to obtain a total of 32 broods of F1 genera. The eggs were observed under fluorescent microscope for selection of transformants. In addition, green fluorescence was observed in the eyes and nerve tissues of the silkworms from the third day after spawning, and a total of 8 transformants (Broods) were selected (Table 1). In addition, the larvae, pupae, and adults of the green fluorescent eye were selected in the selected agar (Fig. 3). Finally, the transformants of the F2 generation were selected by crossing only these genes.

Transformation ratio of construct DNA to Baekokjang embryo vector Injected embryo Hatched larva G1 brood EGFP-positive
G1 Agu Percent G1 Aggregation with EGFP Positive (%) p3xP3-EGFP-pFigH-TagBFP2co 600 grains 98 grains 32 dogs 8 grains 25%

<2-4> Blue fluorescence Silk  Selection

The blue fluorescent cocoon was selected using a LEICA Z6 APO microscope from Leica (USA) and a Filtersystem 530 LED from Leica (USA). Generally, the process of silk formation is the formation of fibroin in the rear silk gland of the silkworm, sericin coating on the middle silk gland, and all of the silk glands are eluted through the silk gland from the silk gland. Therefore, in order to confirm the expression of blue fluorescent protein in fibroin, the cocoon of F2 generation was confirmed by fluorescence microscope.

As a result, it was also confirmed that TagBFP2co recombinant protein was expressed normally in fibroin by observing blue fluorescence in the cocoon of F2 generation (Fig. 4).

As described above, the blue fluorescent silk produced by the transgenic silkworm exhibits a pale natural blue color even in natural light, so that no additional dyeing is required, which is eco-friendly and very economical. In addition, the blue fluorescent silk exhibits blue fluorescence speckled in the dark when light of a specific wavelength is shot, so that the blue fluorescent silk can be applied to materials such as high-end fashion garments and wallpaper which have much higher value than general silk. In particular, the silkworm farmers can contribute to income improvement by breeding transgenic silkworms that produce blue fluorescent silk that can be used as materials of high quality fashion clothes, which are different from those of current silkworms.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments. You can implement the examples. The scope of the present invention is defined by the appended claims, and all differences within the scope of the claims are to be construed as being included in the present invention.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> TRANSGENIC SILKWORMS PRODUCING BLUE FLUORESCENT COCOONS <130> P2013-0274 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 702 <212> DNA <213> Unknown <220> <223> TagBFP2, Aequorea macrodactyla <400> 1 atgagcgagc tgattaagga gaacatgcac atgaagctgt acatggaggg caccgtggac 60 aaccatcact tcaagtgcac atccgagggc gaaggcaagc cctacgaggg cacccagacc 120 cptggctct agcttcctct acggcagcaa gaccttcatc aaccacaccc agggcatccc cgacttcttc 240 aagcagtcct tccctgaggg cttcacatgg gagagagtca ccacatacga agacgggggc 300 gtgctgaccg ctacccagga caccagcctc caggacggct gcctcatcta caacgtcaag 360 atcagagggg tgaacttcac atccaacggc cctgtgatgc agaagaaaac actcggctgg 420 gaggccttca ccgagacgct gtaccccgct gacggcggcc tggaaggcag aaacgacatg 480 gccctgaagc tcgtgggcgg gagccatctg atcgcaaacg ccaagaccac atatagatcc 540 aagaaacccg ctaagaacct caagatgcct ggcgtctact atgtggacta cagactggaa 600 agaatcaagg aggccaacaa cgagacctac gtcgagcagc acgaggtggc agtggccaga 660 tactgcgacc tccctagcaa actggggcac aagcttaatt aa 702 <210> 2 <211> 702 <212> DNA <213> Artificial Sequence <220> <223> TagBFP2co <400> 2 atgtcagagc ttattaagga aaacatgcat atgaaactgt acatggaggg caccgtggat 60 aaccatcact ttaaatgcac gtccgaggga gagggaaaac cctacgaagg cacccaaaca 120 atgcggatca aagttgttga gggtggtcct ctaccattcg cgtttgacat tctggctact 180 agttttctct acggttctaa gactttcata aaccacacac aaggtatacc cgatttcttt 240 aagcagtcct tccctgaagg cttcacgtgg gaacgagtca ctacatatga agacgggggc 300 gtattgacag ctacgcaaga caccagctta caggacggat gcttgatcta caacgtcaaa 360 attcgcgggg tgaatttcac ttcgaatgga ccggttatgc agaaaaaaac actcggttgg 420 gaagcgttca ccgagacgct gtatccggct gatggaggtc tggaaggccg taatgacatg 480 gctctgaagc tcgtgggtgg ctctcatctg atcgcaaatg ccaaaactac atatagatca 540 aagaagccag ctaagaatct gaagatgcct ggcgtctact atgttgatta ccgcttagaa 600 agaatcaagg aggccaacaa cgagacctac gtcgaacagc acgaggtggc agtagccagg 660 tactgtgacc taccaagcaa attgggacac aaacttaact aa 702

Claims (11)

A TagBFP2co gene comprising the nucleotide sequence of SEQ ID NO: 2 among the marker gene-regulated promoter, the marker gene, the silkworm-derived fibroin promoter and the blue fluorescent gene derived from the jellyfish (Aequorea macrodactyla) is operably linked to the gene cone (P3xP3-EGFP-pFibH-TagBFP2co). &Lt; / RTI &gt;

2. The recombinant expression vector according to claim 1, wherein the TagBFP2co gene comprising the nucleotide sequence of SEQ ID NO: 2 is a gene that has mutated the TagBFP2 gene comprising the nucleotide sequence of SEQ ID NO: 1 through codon optimization.
The recombinant expression vector according to claim 1, wherein the marker gene-regulated promoter is a 3xP3 promoter.
2. The recombinant expression vector according to claim 1, wherein the marker gene is EGFP (Enhanced green fluorescent protein) among the fluorescent proteins.
delete 2. The recombinant expression vector according to claim 1, wherein the recombinant expression vector is prepared by introducing the gene construct into a piggyBac transfer vector.
A transformed silkworm characterized by producing a blue fluorescent silk, which is produced by transforming silkworm eggs with the recombinant expression vector of any one of claims 1 to 4 or 6.
1) preparing a recombinant expression vector according to any one of claims 1 to 4 or 6;
2) injecting the recombinant expression vector of step 1) into silkworm eggs and transforming the transformed silkworm eggs to produce transformed silkworm eggs; And
3) hatching the transformed silkworm of step 2) to produce a transgenic silkworm producing blue fluorescent silk.
The method according to claim 8, wherein the transformation in step 2) is carried out using microinjection.
[9] The method according to claim 8, further comprising the step of selecting the transformed silkworm by one of the following methods in the step 3): [
i) a method of inserting a marker gene into an expression vector and then confirming the expression of the marker gene in the transformed silkworm; or
ii) a method for confirming expression of a blue fluorescent gene in a transgenic silkworm.
1) preparing a recombinant expression vector according to any one of claims 1 to 4 or 6;
2) transforming silkworm eggs with the recombinant expression vector of step 1) to produce transformed silkworms; And
3) culturing the transformed silkworm of step 2) to obtain silk with blue fluorescence.

Images