CN110117617A - A kind of method preparing the lethal silkworm strain of female embryo and in-between strain and construct - Google Patents

A kind of method preparing the lethal silkworm strain of female embryo and in-between strain and construct Download PDF

Info

Publication number
CN110117617A
CN110117617A CN201810111406.5A CN201810111406A CN110117617A CN 110117617 A CN110117617 A CN 110117617A CN 201810111406 A CN201810111406 A CN 201810111406A CN 110117617 A CN110117617 A CN 110117617A
Authority
CN
China
Prior art keywords
silkworm
sequence
cas9
sgrna
talens
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201810111406.5A
Other languages
Chinese (zh)
Inventor
黄勇平
张忠杰
许军
李恺
谭安江
牛宝龙
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Center for Excellence in Molecular Plant Sciences of CAS
Original Assignee
Shanghai Institutes for Biological Sciences SIBS of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Institutes for Biological Sciences SIBS of CAS filed Critical Shanghai Institutes for Biological Sciences SIBS of CAS
Priority to CN201810111406.5A priority Critical patent/CN110117617A/en
Publication of CN110117617A publication Critical patent/CN110117617A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/033—Rearing or breeding invertebrates; New breeds of invertebrates
    • A01K67/0333—Genetically modified invertebrates, e.g. transgenic, polyploid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/89—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microinjection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00—Modified animals
    • A01K2207/15—Humanized animals
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/70—Invertebrates
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/02—Animal zootechnically ameliorated
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Environmental Sciences (AREA)
  • Mycology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a kind of method for preparing the lethal silkworm strain of female embryo and in-between strains and construct.Silkworm strain W-Cas9 and silkworm strain Tra2-sgRNA is mated, G2 generation, the i.e. lethal silkworm strain of female embryo are obtained.The method of W-Cas9 is prepared the following steps are included: 1) preparing TALEN double-mass model, wherein left side TALEN identifies that sequence is SEQ ID NO:1 in sequence table, and the right TALEN identifies that sequence is SEQ ID NO:2 in sequence table, is transcribed in vitro and obtains TALENs mRNA；2) ligand plasmid is constructed comprising the element that the following operability from 5 ' ends to 3 ' ends connects: TALENs target spot, left homology arm, Cas9 expression casette, right homology arm and TALENs target spot；3) the fresh ovum of corotation silkworm obtains G0 generation, G0 generation be selfed G1 generation to get.The present invention pinpoints the necessary gene of targeting embryonic development using TALENs and CRISPR/Cas9 technology in silkworm, causes embryonic development period all females lethal, so that establishing Male Silkworm specially supports strain, can greatly improve silkworm raw silk quality.

Description

A kind of method preparing the lethal silkworm strain of female embryo and in-between strain and structure Build body
Technical field
The invention belongs to field of biotechnology, it is related to a kind of method for preparing the lethal silkworm strain of female embryo and among it Strain and construct.
Background technique
Silkworm is a kind of Silk-producing insects with very high economic value, while being also lepidopterous insects model insects, at me There is critical role in state's economical production and cultural and historical.The male and female of silkworm pupa have different features, compare from resemblance Compared with female pupa is larger, and abdomen end is relatively round；Male pupa is smaller, and abdomen end is sharper.Compare from property feature, female the 8th link outside of belly of pupa There is " X " shape ordinate in center from front end to rear end；There is a recess dot in the center of male the 9th link outside of belly of pupa.It is retouched according to above-mentioned The feature stated, in traditional silkworm genetic breeding work, breeder by identify the male and female specific characteristics of silkworm pupa from And identify male and female, but this work is the link taken time and effort very much, significantly limits the work effect of silkworm breeding Rate.Moreover, the gender of silkworm can not be distinguished during silkworm larva development, and the Cocoon layer ratio of Male Silkworm silk cocoon wants significantly high In female silk cocoon, this specially supports for male and brings puzzlement.
In silkworm, the expression of foreign gene depends on transgenic technology.Transgenic technology is to utilize molecular biosciences Means make foreign gene in chromosomal gene by the channel genes of artificial separation and modified into organism genome Stable integration in group, and offspring can be hereditary to.The research of transgenic insect originate in earliest nineteen eighty-two Rubin and Foreign gene is transferred to drosophila germ cell line and obtained by Spradling using P transposons stablizes hereditary transgenic fly, this nothing By still application is all a far-reaching turning point for basic research, one is opened for the research work of transgenic insect Fan door.2000, for Tamura for the first time using two carriers are constructed based on PiggyBac transposons, one was with A3 promoter The transgene carrier that GFP is reporter gene is controlled, the other is the assistant carrier of expression transposase, two kinds of carriers are with one to one Microinjection is measured into silkworm seed, to obtain the transgenic bombyx mori for stablizing heredity in G1 generation, this mark transgenic bombyx mori epoch is arrived Come.However, using Piggybac transposons as the insertion point of the transgenosis of carrier be it is random, be likely to occur and turn in offspring It moves, these are all a kind of challenges for the heredity of stablizing of target gene.There is presently no obtained by the method for molecular genetic breeding Obtain the silkworm strain that stable male is specially supported.
Summary of the invention
The present invention provides that a kind of to prepare female embryo lethal for the deficiency for lacking the special feeding silkworm strain of stable male The method of silkworm strain and in-between strain and construct.
For this purpose, technical scheme is as follows:
The present invention provides a kind of silkworm strain W- for preparing female specific expressed green fluorescent protein and Cas9 albumen The method of Cas9, comprising the following steps:
1) TALEN double-mass model is prepared, wherein left side TALEN identifies that sequence is the right in sequence table shown in SEQ ID NO:1 TALEN identifies that sequence is to be transcribed in vitro in sequence table shown in SEQ ID NO:2 and obtain its TALENs mRNA；
2) ligand plasmid is constructed, the ligand plasmid includes the member that the following operability from 5 ' ends to 3 ' ends connects Part: TALENs target spot, left homology arm, Cas9 expression casette, right homology arm and TALENs target spot, the TALENs target spot packet The element connected containing the following operability from 5 ' ends to 3 ' ends: the described left side TALEN identification sequence, intervening sequence and described The right TALEN identify sequence, the left side sequence of TALENs target spot in the sequence of left homology arm and the genome of silkworm It is identical, the right flanks of TALENs target spot in the sequence of right homology arm and the genome of silkworm；
3) by the ligand plasmid and the fresh ovum of TALENs mRNA corotation silkworm, hatch, raising is changed moth, obtained In G0 generation, makes G0 generation selfing, obtains G1 generation, i.e., the silkworm strain W- of female specific expressed green fluorescent protein and Cas9 albumen Cas9。
Preferably, the Cas9 expression casette includes the element that the following operability from 5 ' ends to 3 ' ends connects: Nos promoter, Cas9 albumen coded sequence and SV40 terminator.It is furthermore preferred that the Nos promoter sequence is referring to patent " the specifically expressed promoter of silkworm gonad and its catching method " (number of patent application 201610360601.2, Chen Rongmei etc., 2016).It is furthermore preferred that the sequence of Cas9 gene is as shown in SEQ ID NO:6.It is furthermore preferred that SV40 terminator sequence such as SEQ Shown in ID NO:7.
Preferably, the ligand plasmid further include positioned at the left homology arm and the Cas9 expression casette it Between, or the first riddled basins expression cassette between the Cas9 expression casette and the right homology arm. It is furthermore preferred that first riddled basins are green fluorescence protein genes.
The intervening sequence be it is conventional, preferably as shown in SEQ ID NO:5.
Preferably, the corotation is by the ligand plasmid and the PHA3PIG matter that can express Piggybac transposase The resulting fresh ovum of mixed liquor microinjection silkworm after grain mixing.
The present invention also provides the method for silkworm strain Tra2-sgRNA for preparing expression Tra2 specificity sgRNA a kind of, packets Include following steps:
1) transgenosis plasmid is constructed, the transgenosis plasmid includes that the first sgRNA expression cassette and the 2nd sgRNA are expressed Box, the first sgRNA expression cassette include the element that the following operability from 5 ' ends to 3 ' ends connects: the first U6 starting Son, the first Tra2 gene target and the first sgRNA conserved sequence, the 2nd sgRNA expression cassette include from 5 ' ends to 3 ' ends Following operability connection element: the 2nd U6 promoter, the 2nd Tra2 gene target and the 2nd sgRNA conserved sequence,
2) by the transgenosis plasmid and can express Piggybac transposase PHA3PIG plasmid corotation silkworm it is fresh Ovum is hatched, and raising changes moth, obtains G0 generation, is made G0 generation selfing, is obtained G1 generation, that is, express the silkworm strain of Tra2 specificity sgRNA Tra2-sgRNA。
Preferably, the nucleotide sequence of the first Tra2 gene target is as shown in SEQ ID NO:3, and described second The nucleotide sequence of Tra2 gene target is as shown in SEQ ID NO:4.
The U6 promoter be it is conventional, preferably shown in SEQ ID NO:8.
The sgRNA conserved sequence be it is conventional, preferably shown in SEQ ID NO:9.
Preferably, the transgenosis plasmid further includes the second riddled basins expression cassette.It is furthermore preferred that described Two riddled basins are red fluorescent protein genes.
The present invention also provides a kind of methods for preparing the lethal silkworm strain of female embryo, comprising the following steps: by silkworm product It is W-Cas9 and silkworm strain Tra2-sgRNA mating, obtains G2 generation, the i.e. lethal silkworm strain of female embryo.
The present invention has the advantages that the present invention pinpoints targeting embryo using TALENs and CRISPR/Cas9 technology in silkworm Fetal hair educates necessary gene, causes embryonic development period all females lethal, to achieve the effect that specially to support male silkworm.Utilize this method It establishes Male Silkworm and specially supports strain, silkworm raw silk quality can be greatly improved, there is important application value.
Detailed description of the invention
Fig. 1 is the ligand plasmid construction of silkworm W chromosome fixed point insertion GFP gene and Cas9 gene.With pGEM-T plasmid Purpose ligand plasmid is constructed, is inserted into GFP gene and Cas9 gene expression frame, homology arm, TALENs target in polyclone enzyme enzyme site Point (TS) (embodiment 2).
Fig. 2 is ligand plasmid pGEM-T_TS-L-Homo_HR5-IE1-EGFP-SV40_Nos-Cas9-SV40_R-Homo- Expression of the TS in silkworm embryonic period, embryonic phase, larval phase, pupa time and adult stage.Male and female individual is observed under white light, green fluorescence respectively Luciferase expression (embodiment 5).
Fig. 3 Junction PCR confirms that Donor is incorporated at TALENs target site.Primer S-F1 and S-R1 is located at On the outside of the homology region Donor, primer S-F2 and S-R2 are respectively positioned on the inside of EGFP gene and Cas9 gene (A).Use primer S-F1 It is~the 5 '-Junction segments of 1.4kb that length, which can be amplified, with S-R1, can amplify length using primer S-F2 and S-R2 3 '-Junction segment (B) (embodiment 6) of degree~1.4kb.
Fig. 4 is silkworm hatching rate statistics.Control group silkworm embryos can normal incubation (A), experimental group Tra2-sgRNA product (B) cannot be hatched with partial embryonic in Tra2-sgRNA incross offspring in system.Control group silkworm hatching rate is 99%；Experimental group Hatching rate is 49% (C) (embodiment 7).
Fig. 5 is silkworm female-specific lethal.Control group silkworm pupa time female-male proportion is similar, experimental group Tra2-sgRNA product System and Tra2-sgRNA incross offspring only have male pupa (embodiment 8).
Specific embodiment
Test of the present inventor by extensive research and repeatedly, by the gene site-directed insertion silkworm W chromosome of Cas9, thus Transgenic bombyx mori is obtained, transgenic bombyx mori obtained is female, and only female expresses the Cas9 gene, realizes Cas9 The sex-specific of gene is expressed, and then by the silkworm hybrid of itself and the important reproductive gene Tra2 specificity sgRNA of expression, is obtained The hybridization silkworm obtained, is that female embryo is lethal, and only male silkworm survival and normal growth have achieved the effect that specially to support hero silkworm, from And complete the present invention.
Wherein, using CRISPR/Cas9 technology, make the silkworm of autosome expression Cas9 albumen and express important reproduction base Because of the silkworm hybrid of Tra2sgRNA, the Tra2 gene of resulting offspring is knocked, no matter male and female can embryonic death.However Silkworm W chromosome fixed point is transferred to foreign gene Cas9, because Male Silkworm does not have W chromosome, obtains expression Cas9 albumen Silkworm be all female.After its male silkworm hybrid with expression Tra2sgRNA, in hybridization generation, Cas9 egg is contained on W chromosome White individual (W chromosome is female silkworm) is just dead in embryonic period, embryonic phase due to making Tra2 gene knockout, and Cas9 is free of on W chromosome The individual (no W chromosome is male) of albumen will survive.Therefore hybridization generation in survive be male.
Lepidoptera includes moth, two class insect of butterfly.Belong to Pterigota, Holo metabola.About 200,000 kinds known to the whole world, China Known about more than 8000.The mesh is the 2nd big mesh that coleoptera is only second in Insecta.Including Gelechidae；Sulfur butterfly, such as wheat Moth, pink bollworm, phthorimaea operculella and brachmia triannuella etc.；Tortricidae, such as adoxophyes moth, eating-core bean worm；Pyralidae, Such as pear fruit borer, corn borer；Geometridae, such as big bridging worm；Sulfur butterfly, such as cabbage butterfly；Noctuidae, such as powder mosquito night Moth, bollworm etc.；Lymantriidae, such as gypsymoth；Papilionidae, such as jade belt wind butterfly, golden wind butterfly；Notodontidae, such as boat-shaped caterpillar； Arctiidae, such as yellow abdomen moths attracted by lamplight, white tiger moth, fall webworms；Sphingidae, such as vine hawk moth；Bombycidae, such as silkworm；It Bombycidae, such as Philosamia cynthia；Hesperiidae, such as rice plant skipper.The distribution of lepidopterous insects is extremely wide, the richest with tropical type It is rich.The larva of most types is caused harm all kinds of cultivated plants, and bodily form the greater often eats blade or brill moth limb to the greatest extent.The bodily form is smaller Person often leaf roll, sew leaf, knot sheath, spinning netting or pierce plant tissue feeding and cause harm.Adult is mostly using nectar etc. as Replacement Battalion Feeding or mouthpart degeneration no longer feeding, does not cause generally directly to endanger.
In conclusion most of in lepidopterous insects is pest, also there is minority, such as silkworm is the elder brother for having economic value Worm.Therefore, the extensive insect sterile technique of lepidopterous insects is studied, prevention and treatment for pest and has turning for economic value Gene product will generate great realistic meaning.
Therefore, in a preferred embodiment, lepidopterous insects of the invention are silkworms.
Lepidopterous insects transgenic technology is often carried out with the mode of transposons at present.PiggyBac transposons is a kind of source It is initially that mosquito powder exigua (Trichoplusia is infected by baculoviral (Baculovirus) in the transposons of lepidopterous insects Ni) TN-368 cell strain system, from Galleria mellonella (GmMNPV) and Autographa californica (AcMNPV) isolated for the first time in nucleopolyhedrosis virus, at pink corn earworm worm (Pectinophora gassypiella) Embryo, excision test of silkworm (Bombyx mori) egg cell etc. all demonstrate the accuracy of PiggyBac transposons excision.? Intracellular etc. the experiment of yellow typhoid fever mosquito (Aedes aegypti), mosquito powder exigua and silkworm egg also shows PiggyBac can Be well on swivel base, and the frequency of excision and swivel base is all higher.Research in silkworm starts from 1997, finds PiggyBac Transposons studies silkworm the transposition of silkworm, researcher followed by PiggyBac transposons. The further investigation of PiggyBac transposons will be for the genetic control based theoretical of pest.
The principle for the genome editing technique being commonly used is to generate DNA in genome specific site by artificial Double-strand break (Double-strand break, DSB), so that nonhomologous end company occurs for the DNA repair system induced in cell Connect (Nonhomologous end joining, NHEJ) and homologous recombination repair (Homologous recombination, HR).Pass through above-mentioned reparation approach, it is believed that the DNA double key breaking part of generation will realize that gene mutation, specific mutagenesis introduce and determine Point modification.Genome editor is divided into three classes, and wherein CRISPR/Cas9 technical costs is lower, and target spot shear efficiency is higher.
Silkworm is twice of body, and W chromosome is silkworm sex chromosome, and that with W chromosome is female silkworm (ZW).Former Document report in, riddled basins GFP was inserted into silkworm W chromosome by the method for transgenosis radom insertion；Cas9 base Because being inserted into silkworm autosome by the method for transgenosis radom insertion, silkworm male and female obtained can express Cas9, not have It is inserted into the precedent into W chromosome.
Class activating transcription factor nuclease (TALENs) technology is a kind of genome editing technique, by nonspecific Fok I Nuclease and TALE albumen composition.TALE monomer combines DNA in a manner of single base in TALENs technology, and then by I nucleic acid of Fok Enzyme carries out double-strand cutting to target sequence.Organism is to avoid mrna instability caused by DNA damage fixed, when DNA double chain occurs to break When splitting (Double strand break, DSB), body repairs DNA: the one of damage mainly by means of following two mode, non- Homologous recombination end connects (Non-homologous end joining, NHEJ) and repairs.NHEJ repair mode will cause DSB to break The position split generates the insertion or missing of small fragment.Two, homologous recombination (Homologous recombination, HR) is repaired. In the presence of having homologous donor (Donor), insertion foreign gene can be pinpointed in target site and carry out accurate edits.It is of the present invention TALEN double-mass model be this field routine, contain the sequence of target gene as left and right target sequence.
It is pinpointed in silkworm W chromosome, is pinpointed by the identification sequence of two TALEN plasmids, the choosing of the identification sequence It selects, is that W chromosome is special.Preferably, the present invention selects W-Rikishi RAPD marker genome sequence.Preferably, Middle left side TALEN identifies sequence are as follows: TGCGAATGTTTGTTAT, the right TALEN identify sequence are as follows: CCAAGTCATTTTAATTT.
In view of the teachings of the present invention and the prior art, those of ordinary skilled in the art can easily understand that, although reality of the invention The TALEN target sequence from silkworm W chromosome Rikishi RAPD marker genome is provided in example, but source In other insects of Lepidoptera, such as Ostrinia furnacalis, bollworm with the present invention there is the W of certain homology (conservative) to contaminate Colour solid gene target sequence, is intended to be included within the scope of the present invention, as long as those skilled in the art's root after having read the application The isolated target sequence and its function is verified from other insects with can be convenient according to information provided by the present application.
The present invention is accurately inserted into GFP gene and Cas9 base in silkworm W chromosome target site by way of homologous recombination Cause, only in female specifically expressing GFP gene and Cas9 gene.Egfp expression has been picked out by observing green fluorescence Silkworm seed, obtain G1 for positive transformants individual.Raising, until pupa time has different characteristic phenomenons to reflect by the female pupa of silkworm and male pupa Determine whether positive transformants individual is female.
Tra2 gene plays an important role in drosophila Sex Determination, and Tra2 albumen is by promoting drosophila Sex Differentiation double The alternative splicing of functional gene Dsx is to regulate and control drosophila Sex Differentiation.In silkworm, Tra2 knockout can lead to silkworm embryos It is lethal.Therefore, the Tra2 gene of silkworm is the suitable material studying the male of lepidopterous insects and specially supporting.
In view of the teachings of the present invention and the prior art, those of ordinary skilled in the art can easily understand that, although reality of the invention It provides in example from silkwormThe target sequence of Tra2 gene, but it is derived from other insects of Lepidoptera, such as Asia Corn borer, bollworm have the Tra2 gene target sequence of certain homology (conservative) with the present invention, are also included within the present invention In the range of, if those skilled in the art after having read the application according to information provided by the present application can be convenient from its The isolated Tra2 gene target sequence and its function is verified in its insect.
Therefore, the present invention includes having with preferred Tra2 gene target sequence 1 or 2 (SEQ ID NO:3 or 4) of the invention 50% or more (preferably 60% or more, 70% or more, 80% or more, more preferable 90% or more, more preferable 95% or more, it is optimal 98% or more is selected, such as 99%) nucleic acid of homology, the nucleic acid also have in CRISPR/Cas9 technology as target sequence Tra2 gene is knocked out, to obtain the function of sterile mutant." homology " refers to according to the identical percentage in position, two or Similar level (i.e. sequence similarity or identity) between a plurality of nucleic acid.
In the present invention, it is preferred that the Tra2 gene mutation target spot are as follows:
Target spot 1:5 '-GGCTGTGACTATGACTGCGG-3 '；
Target spot 2:5 '-GGTTTTCCCATGTAGATGCC-3 '.
The present invention has the advantages that fixed point insertion foreign gene (marker gene GFP and the Cas9 base in silkworm W chromosome Cause), so that specific expressed foreign gene in female individuals, breaks through traditional transgenic bombyx mori foreign gene radom insertion Problem successfully realizes sex-specific expression.The successful application of W chromosome fixed point insertion exogenous gene expression frame, can be with The efficiency for greatly improving silkworm pupa time Sex judging keeps the sustainable development of sericulture.The present invention utilizes TALENs and CRISPR/ Cas9 technology pinpoints the necessary gene of targeting embryonic development in silkworm, causes embryonic development period all females lethal, to reach To the effect for specially supporting male silkworm.Male Silkworm is established using this method and specially supports strain, can greatly improve silkworm raw silk quality.This hair The bright method by molecular genetic breeding, is at the genomic level transformed domestic silkworm gene group, thus can in larval phase The effective gender for identifying silkworm or specificity kill female individuals, have important application value.
The building of embodiment 1TALENs carrier
(a) silkworm W-Rikishi RAPD marker genome sequence has been downloaded from ncbi database, and has been designed TALENs target spot.Left side TALE identifies that sequence is that 5 '-TGCGAATGTTTG TTA T-3 ', the right TALE identify that sequence is 5 '- CCAAGTC ATT TTAATTT-3 ', midfeather 17bp (5 '-AAAAAATGCACCTGACA-3 ').It is closed in only Shang Lide company At the TALEN plasmid of target spot and right side target spot on the left of targeting W-Rikishi RAPD marker TALENs respectively, it is named as PTD-peas-C (TALEN-L) and pTD-perr-C (TALEN-R).
(b) synthesis of TALENs mRNA:
It is carried using Not I restriction enzyme single endonuclease digestion pTD-peas-C (TALEN-L) and pTD-perr-C (TALEN-R) Body linearizes respectively, and linearized vector becomes the template that mRNA is transcribed in vitro, and uses mMESSAGE mMACHINE T7 kit In-vitro transcription mRNA is carried out, TALENs mRNA is obtained.
The building of 2 ligand plasmid of embodiment
Referring to Fig. 1, with pGEM-T plasmid construction purpose ligand plasmid pGEM-T_TS-L-Homo_HR5-IE1-EGFP- SV40_Nos-Cas9-SV40_R-Homo-TS is inserted into GFP gene and Cas9 gene expression frame, homologous in polyclone enzyme enzyme site Arm, TALENs target spot.
PXL-HR5-IE1-EGFP-SV40 plasmid is based on the PiggyBac swivel base for being widely used in insecticidal transgenic research Son (Piggybac transposons see Fraser et al., Insect Moecular Biology, 1996)) completion is transformed 's.It is as follows: imported in PiggyBac transposon vector first by IE1 promoter (Kojima et al, VirusResearch, 2008) the green fluorescent protein EGFP of driving, terminator SV40 are configured to PXL-HR5-IE1- EGFP-SV40 transgene carrier (Zeng et al., 2017).After being successfully transferred to this carrier, transgenic positive individual is after embryo Phase can be with whole body expression green fluorescence, convenient for screening.
(a) with PXL-HR5-IE1-EGFP-SV40 plasmid (Zeng et al., 2017) for template, with HR-F (5 '- GCTAGCCATTGCTTGTCATTTATTAATTTGGATG-3 ') and HR-R (5 '-TCTTAATTAACTCGCGTTAAGATACAT- 3 ') primer obtains HR5-IE1-EGFP-SV40 expression cassette segment, which is cloned into pGEM-T by PCR amplification (Takara), sequence verification.The carrier of building is named into pGEM-T_HR5-IE1-EGFP-SV40.
(b) using domestic silkworm gene group DNA as template, with 3 '-F1 of specific primer (5 '-AATAT CAT TAATAGGG AGACTGGG-3 ') and 3 '-R1 (5 '-ACGAACGATGTATGTAGT ATGTTA-3 '), by PCR amplification, obtain W- The TALENs target site 3 ' of Rikishi RAPD flag sequence holds the homologous sequence (R-Homo) of 1K, which is cloned into PGEM-T (Takara), sequence verification.The carrier of building is named into pGEM-T_R-Homo.
(c) using pGEM-T_R-Homo as template, with the 3 '-F2 of specific primer (5 '-containing TALENs target sequenceGCGAGTTAATTAAGAAATCAAATATCAT TAATAGGGAGA CTGGG-3 ') and 3 '-R2 (5 '-TGCAGGCGGCCGCGAATTCAAGTAGT TATTAGATACCTAAATATATATTCTAAGGTAATGGCATTGC ATCC ACG AACG ATGTATG TAGTAT G TTA-3 '), by PCR amplification, obtain the homologous sequence containing TALENs target sequence (TS-R-Homo).With I digestion pGEM-T_HR5-IE1-EGFP-SV40 of Spe, by R-Homo-TS homologous clone to linearisation On pGEM-T_HR5-IE1-EGFP-SV40, sequence verification.The carrier of building is named into pGEM-T_HR5-IE1-EGFP-SV40_ R-Homo-TS。
(d) using domestic silkworm gene group DNA as template, with 5 '-F1 of specific primer (5 '- (5 '-ATTTTTGC CAAAACTTTACCTCT-3 ', are expanded by PCR by AACACGTTTTTGAACTTGTTGACTAG-3 ' and 5 '-R1 Increase, the TALENs target site 5 ' for obtaining W-Rikishi RAPD flag sequence holds the homologous sequence (L-Homo) of 1K, by the piece Section is cloned into pGEM-T (Takara), sequence verification.The carrier of building is named into pGEM-T_L-Homo.
(e) using pGEM-T_L-Homo as template, with the special 5 '-F2 of specific primer containing TALENs target sequence (5’-ACTATAGGGCGAATTGGGCCTGCGAATG TTTGT TATAAAAAATGCACCTGACAAAATTAAAATGACTTGGAACACGTTTTTGAACTTGT TGACTAG-3 ' and 5 '-R2 (5 '- GAGCATGCGACGTCGGGCCCA TTTTTGC CAAAACTTTACCTCT-3 ' is obtained by PCR amplification containing TALENs target The homologous sequence (TS-L-Homo) of point sequence.It, will with I digestion pGEM-T_HR5-IE1-EGFP-SV40_TS_R-Homo of Apa On TS-L-Homo homologous clone to the pGEM-T_HR5-IE1-EGFP-SV40_TS_R-Homo of linearisation, sequence verification.By structure The carrier name pGEM-T_TS-L-Homo_HR5-IE1-EGFP-SV40_R-Homo-TS built.
(f) PXL-HR5-IE1-EGFP-SV40-Nos-Cas9-SV40 plasmid is based on PXL-HR5-IE1-EGFP-SV40 Completion is transformed in plasmid.It is as follows: to have imported in PXL-HR5-IE1-EGFP-SV40 driven by Nos promoter first Cas9, terminator SV40 are configured to PXL-HR5-IE1-EGFP-SV40-Nos-Cas9-SV40 transgene carrier (Xu et al.,2017).Using PXL-HR5-IE1-EGFP-SV40-Nos-Cas9-SV40 as template, with containing, Apa I and Nhe I is restricted The specific primer Cas9-F (5 '-ATCGGGGCCCATACATTGATGAGTTTGGACAAAC-3 ') of inscribe restriction enzyme site and Cas9-R (5 '-CTAGCTAGCTGGTTGTAATGTAGGTATTGGTACAAATAT-3 ') obtains Nos-Cas9- by PCR amplification SV40 segment, glue are connected on pGEM-T carrier after receiving and are sequenced, and pGEM-T_Nos-Cas9-SV40 is named as after sequence verification.
With Apa I and Nhe I double digestion pGEM-T_Nos-Cas9-SV40 and pGEM-T_TS-L-Homo_HR5-IE1- EGFP-SV40_R-Homo-TS, glue connect after receiving target fragment, obtain ligand plasmid pGEM-T_TS-L-Homo_HR5-IE1- EGFP-SV40_Nos-Cas9-SV40_R-Homo-TS, it is spare after sequence verification.
The building of embodiment 3Tra2-sgRNA transgenosis plasmid
(a) using domestic silkworm gene group DNA as template, with primer HR-F (5 '- CTCACTATAGGGCGAATTGGAGGTTATGTAGTACACATTGTTGTA-3 ') and U6-R1 (CCGCAGTCATAGTCACAGCCACTTGTAGAGC ACGATATT T TG-3 ') is obtained first U6 and is opened by PCR amplification Promoter sequences.With primer Tra2-sgRNA-1F (5 '-GGCTGTGACTATGACTGCGGG TTTT AGAG CTAG AAAT AGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT-3 ') and overlap-R1 (CCGCGGAGTCAATGGCT AGCAAAAAAGCAC CGACTCGGTGCCACTTTTTCAAGTTGATAACGG-3 ') annealing obtains Tra2-sgRNA1 sequence.With Primer Overlap-F (GCTAGCCATTG ACTCCGCGG AGGTTATGTAGTACACATTGTTGTA) and U6-R2 (GGCATCTACATGGGA AAACCACTTGTAGAGCACGATATTTTG-3 '), using domestic silkworm gene group DNA as template, passes through PCR amplification obtains second U6 promoter sequence.With primer Tra2-sgRNA-2F (GGTTTTCCCATGTAGATGCC GTTTTAGAGCTAG AAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT-3 ') and HR-R (TTT TCTTGTTATAGATATCAAAAAAAGCACCGACTCGGTGCCACTTTT TCAAGTT GATAACGG-3 ') annealing obtains U6- Tra2-sgRNA2 sequence.
(b) Kpn I and Hind III restriction enzymes double zyme cutting PXL-HR5-IE1-DsRed2-SV40 carrier are used (Tan et al., 2014) linearisation, using Vazyme multiple clips homologous clone kit by first U6 promoter sequence, Tra2-sgRNA1 sequence, second U6 promoter sequence and Tra2-sgRNA2 are cloned into the PXL-HR5-IE1- of linearisation Transgenosis plasmid PXL-HR5-IE1-DsRed2-SV40-U6-Tra2-sgRNAs is obtained in DsRed2-SV40 carrier.
The acquisition of embodiment 4Tra2-sgRNA transgenic bombyx mori
PHA3PIG is used as helper plasmid generation transposase in this experiment, uses the Plasmid Midi of Qiagen company The resulting transgenosis plasmid of kit kits embodiment 3.It, will be real using microinjection instrument after silkworm seed is given birth in 2-4 hours 3 resulting transgenosis plasmid (400ng/ μ l) of example and PHA3PIG (400ng/ μ l) hybrid injection are applied into the silkworm in silkworm seed, after injection Ovum prevents from polluting using nontoxic glue sealing, under the conditions of 25 DEG C, hastens the hatching of silkworms until hatching, raising hatches the ant come The silkworm moth of contemporary (G0) is selfed by silkworm, obtains G1 for silkworm seed, the individual that expression red fluorescence is chosen under fluorescence microscope carries out Raising, that is, screen the strain (Tra2-sgRNA) of specific expressed Tra2 specificity sgRNA.
The W chromosome site-directed integration that embodiment 5TALENs is mediated
Use the resulting ligand plasmid of Plasmid Midi kit kits embodiment 2 of Qiagen company.In silkworm Ovum is given birth in 2-4 hours latter, using microinjection instrument by 2 resulting ligand plasmid (200ng/ μ l) of embodiment and 1 institute of embodiment TALENs mRNA (200ng/ μ l) hybrid injection into silkworm seed, the silkworm seed after injection is using nontoxic glue sealing to prevent Pollution hastens the hatching of silkworms until hatching under the conditions of 25 DEG C, raises the newly-hatched silkworm for hatching and, the silkworm moth of contemporary (G0) is selfed, is obtained 58 G1 are obtained for moth circle, the positive moth circle of 2 expressing green fluorescent proteins is screened under fluorescence microscope, amount to 18.It will Positive individuals are raised to adult, confirm that the individual of all expressing green fluorescent proteins is female (Fig. 2) by morphological observation, The strain (W-Cas9) of the female specific expressed green fluorescent protein and Cas9 albumen that screen.
Embodiment 6W-Cas9 strain specificity expressing green fluorescent protein and Cas9 Protein Detection
In order to confirm that GFP gene and Cas9 gene are accurately inserted into W chromosome, widely used Junction is used PCR method: a primer is located at (S-F1:5 '-TGGATA GTCGCGGTAATTAG and S-R2:5 '-on the outside of homology arm ACCTAGGTTA TGCCTCTGTC-3 '), another primer is located at (S-F2:5 '-on the inside of GFP gene and Cas9 gene CATGGACG AGCTGTACAAGTA-3 ' and S-R1:5 '-CCAAG AAGAAGAGGA AGGT GTG A-3 ')；It detects respectively 5 '-Junction (S-F1+S-R1) and 3 '-Junction (S-F2+S-R2) (Fig. 3).With 2 obtained the sun in embodiment 5 Property moth circle and the genomic DNA of wild type silkworm be template, detect expected Junction PCR item from 2 positive moth circles Band (Fig. 3).Cloning and sequencing verifying shows Donor sequence by precise integration at TALENs insertion point.
The lethal strain of silkworm embryos is established in the hybridization of embodiment 7
By the strain (Tra2-sgRNA) of the specific expressed Tra2 specificity sgRNA screened in embodiment 4 and implement The strain (W-Cas9) of the specific expressed green fluorescent protein of female and Cas9 albumen that screen in example 5 is hybridized, and is obtained 10 G2 are for moth circle, for counting female-male proportion.
Embodiment 8 counts G2 for transgenic bombyx mori egg hatching rate and pupa time female-male proportion
Egg hatching rate detection: control group is 10 wild type moth circles；Experimental group is that 10 G2 are obtained in embodiment 7 for moth Circle.Control group and the moth circle of experimental group are maintained at 25 DEG C of constant temperatures, hasten the hatching of silkworms until hatching, count hatching rate after 11 days. As a result such as Fig. 4, wild type silkworm egg hatching rate about 100%, experimental group silkworm egg hatching rate is 50% or so.By control group and reality The newly-hatched silkworm for hatching and is tested in group normally to be raised, until pupa time carries out Sex judging, control group female-male proportion is about one to one, All individuals of experimental group are male (Fig. 5).
All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.
Sequence table
<110>Shanghai Inst. of Life Science, CAS
<120>a kind of method for preparing the lethal silkworm strain of female embryo and in-between strain and construct
<130> SHS006I
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 16
<212> DNA
<213>artificial sequence ()
<220>

Claims (10)

1. a kind of method for the silkworm strain W-Cas9 for preparing the specific expressed green fluorescent protein of female and Cas9 albumen, special Sign is, comprising the following steps:
1) TALEN double-mass model is prepared, wherein left side TALEN identifies that sequence is the right in sequence table shown in SEQ ID NO:1 TALEN identifies that sequence is to be transcribed in vitro in sequence table shown in SEQ ID NO:2 and obtain its TALENs mRNA；
2) ligand plasmid is constructed, the ligand plasmid includes the element that the following operability from 5 ' ends to 3 ' ends connects: TALENs target spot, left homology arm, Cas9 expression casette, right homology arm and TALENs target spot, the TALENs target spot include The element that following operability from 5 ' ends to 3 ' ends connects: the described left side TALEN identification sequence, intervening sequence and described The right TALEN identifies sequence, the left side sequence phase of TALENs target spot in the sequence of left homology arm and the genome of silkworm Together, in the sequence of right homology arm and the genome of silkworm TALENs target spot right flanks；
3) by the ligand plasmid and the fresh ovum of TALENs mRNA corotation silkworm, hatch, raising changes moth, obtains G0 In generation, makes G0 generation selfing, obtains G1 generation, i.e., the silkworm strain W- of female specific expressed green fluorescent protein and Cas9 albumen Cas9。
2. method as described in claim 1, which is characterized in that the Cas9 expression casette include from 5 ' end to 3 ' end with The element of lower operability connection: Nos promoter, Cas9 albumen coded sequence and SV40 terminator；
Alternatively, the ligand plasmid further include between the left homology arm and the Cas9 expression casette, or First riddled basins expression cassette of the person between the Cas9 expression casette and the right homology arm；
Alternatively, the corotation is to mix the ligand plasmid with the PHA3PIG plasmid that can express Piggybac transposase The resulting fresh ovum of mixed liquor microinjection silkworm afterwards.
3. method as claimed in claim 2, which is characterized in that first riddled basins are green fluorescent protein bases Cause.
4. it is a kind of prepare expression Tra2 specificity sgRNA silkworm strain Tra2-sgRNA method, which is characterized in that including with Lower step:
1) transgenosis plasmid is constructed, the transgenosis plasmid includes the first sgRNA expression cassette and the 2nd sgRNA expression cassette, institute The first sgRNA expression cassette stated includes the element that the following operability from 5 ' ends to 3 ' ends connects: U6 promoter, the first Tra2 Gene target and sgRNA conserved sequence, the 2nd sgRNA expression cassette include that the following operability from 5 ' ends to 3 ' ends connects The element connect: U6 promoter, the 2nd Tra2 gene target and sgRNA conserved sequence；
2) it by the transgenosis plasmid and the fresh ovum of PHA3PIG plasmid corotation silkworm that Piggybac transposase can be expressed, incubates Change, raising changes moth, obtains G0 generation, makes G0 generation selfing, obtains G1 generation, that is, express the silkworm strain Tra2- of Tra2 specificity sgRNA sgRNA。
5. method as claimed in claim 4, which is characterized in that the nucleotide sequence such as SEQ of the first Tra2 gene target Shown in ID NO:3, the nucleotide sequence of the 2nd Tra2 gene target is as shown in SEQ ID NO:4；
Alternatively, the transgenosis plasmid further includes the second riddled basins expression cassette.
6. method as claimed in claim 5, which is characterized in that second riddled basins are red fluorescent protein bases Cause.
7. a kind of method for preparing the lethal silkworm strain of female embryo, which comprises the following steps: by silkworm strain W- Cas9 and silkworm strain Tra2-sgRNA mating, obtains G2 generation, the i.e. lethal silkworm strain of female embryo.
8. a kind of silkworm TALEN double-mass model, which is characterized in that wherein left side TALEN identifies that sequence is SEQ ID in sequence table NO:1, the right TALEN identify that sequence is SEQ ID NO:2 in sequence table.
9. a kind of silkworm ligand plasmid, which is characterized in that the ligand plasmid includes operating from 5 ' ends to 3 ' the following of end Property connection element: TALENs target spot, left homology arm, Cas9 expression casette, right homology arm and TALENs target spot, it is described TALENs target spot includes the element that the following operability from 5 ' ends to 3 ' ends connects: the described left side TALEN identification sequence, Sequence, TALENs target in the sequence of left homology arm and the genome of silkworm are identified every sequence and the right TALEN The left side sequence of point is identical, the right flanks of TALENs target spot in the sequence of right homology arm and the genome of silkworm.
10. a kind of silkworm transgenosis plasmid, which is characterized in that the transgenosis plasmid includes the first sgRNA expression cassette and the Two sgRNA expression cassettes, the first sgRNA expression cassette include the element that the following operability from 5 ' ends to 3 ' ends connects: U6 promoter, the first Tra2 gene target and sgRNA conserved sequence, the 2nd sgRNA expression cassette include holding from 5 ' to 3 ' The element of the following operability connection at end: U6 promoter, the 2nd Tra2 gene target and sgRNA conserved sequence.
CN201810111406.5A 2018-02-05 2018-02-05 A kind of method preparing the lethal silkworm strain of female embryo and in-between strain and construct Pending CN110117617A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810111406.5A CN110117617A (en) 2018-02-05 2018-02-05 A kind of method preparing the lethal silkworm strain of female embryo and in-between strain and construct

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810111406.5A CN110117617A (en) 2018-02-05 2018-02-05 A kind of method preparing the lethal silkworm strain of female embryo and in-between strain and construct

Publications (1)

Publication Number Publication Date
CN110117617A true CN110117617A (en) 2019-08-13

Family

ID=67519773

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810111406.5A Pending CN110117617A (en) 2018-02-05 2018-02-05 A kind of method preparing the lethal silkworm strain of female embryo and in-between strain and construct

Country Status (1)

Country Link
CN (1) CN110117617A (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112369376A (en) * 2020-11-27 2021-02-19 江苏科技大学 Breeding method of silkworm with densonucleosis resistance
CN112852806A (en) * 2021-01-15 2021-05-28 中国农业科学院深圳农业基因组研究所 sgRNA of female specific E3 exon of targeted spodoptera frugiperda Doublesex gene and application thereof
CN114807144A (en) * 2022-05-30 2022-07-29 河南大学 Asiatic corn borer Doublesex gene mutant and construction method and application thereof
CN117867012A (en) * 2024-03-13 2024-04-12 三亚中国农业科学院国家南繁研究院 Reporter plasmid for improving gene editing detection sensitivity, detection method and application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101421408A (en) * 2006-02-10 2009-04-29 奥西泰克有限公司 Gene expression system using alternative splicing in insects
CN107384967A (en) * 2017-03-30 2017-11-24 浙江省农业科学院 A kind of method being inserted into foreign gene fixed point in silkworm W chromosomes

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101421408A (en) * 2006-02-10 2009-04-29 奥西泰克有限公司 Gene expression system using alternative splicing in insects
CN107384967A (en) * 2017-03-30 2017-11-24 浙江省农业科学院 A kind of method being inserted into foreign gene fixed point in silkworm W chromosomes

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JUN XU ET AL.: "Bombyx mori P-element Somatic Inhibitor (BmPSI) Is a Key Auxiliary Factor for Silkworm Male Sex Determination", 《PLOS GENETICS》 *
ZHONGJIE ZHANG ET AL.: "Silkworm genetic sexing through W chromosome-linked, targeted gene integration", 《PNAS》 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112369376A (en) * 2020-11-27 2021-02-19 江苏科技大学 Breeding method of silkworm with densonucleosis resistance
CN112852806A (en) * 2021-01-15 2021-05-28 中国农业科学院深圳农业基因组研究所 sgRNA of female specific E3 exon of targeted spodoptera frugiperda Doublesex gene and application thereof
CN112852806B (en) * 2021-01-15 2022-10-14 中国农业科学院深圳农业基因组研究所 sgRNA of female specific E3 exon of targeted spodoptera frugiperda Doublesex gene and application thereof
CN114807144A (en) * 2022-05-30 2022-07-29 河南大学 Asiatic corn borer Doublesex gene mutant and construction method and application thereof
CN117867012A (en) * 2024-03-13 2024-04-12 三亚中国农业科学院国家南繁研究院 Reporter plasmid for improving gene editing detection sensitivity, detection method and application

Similar Documents

Publication Publication Date Title
US7459599B2 (en) Methods for producing proteins using silkworm middle silk gland-specific gene expression system
Choo et al. CRISPR/Cas9‐mediated mutagenesis of the white gene in the tephritid pest Bactrocera tryoni
CN110117617A (en) A kind of method preparing the lethal silkworm strain of female embryo and in-between strain and construct
CN104673815B (en) Compound piggyBac recombinant vectors and its preparation method and application
Pondeville et al. Efficient ΦC31 integrase–mediated site-specific germline transformation of Anopheles gambiae
Ferguson et al. Genetic transformation of the codling moth, Cydia pomonella L., with piggyBac EGFP
Raphael et al. Australian endemic pest tephritids: genetic, molecular and microbial tools for improved Sterile Insect Technique
CN107426986A (en) A kind of method for cultivating male sterility culex
CN110117613B (en) Method for preparing male sterile lepidoptera insect and nucleic acid construct thereof
Kontarakis et al. Transgenesis in non-model organisms: the case of Parhyale
Mansourian et al. Progress in the use of genetic methods to study insect behavior outside Drosophila
Duan et al. Cre-mediated targeted gene activation in the middle silk glands of transgenic silkworms (Bombyx mori)
Warren et al. Germline transformation of the stalk-eyed fly, Teleopsis dalmanni
Nagaraju et al. The silkworm, Bombyx mori: A model genetic system
CN110184296B (en) Method for preparing lepidopteran insects with male-female high sterility and nucleic acid construct thereof
Zabelina et al. Genome engineering and parthenocloning in the silkworm, Bombyx mori
CN112553250B (en) Method for preparing female sterile lepidopteran insects and nucleic acid construct thereof
JP4431739B2 (en) Use of DNA encoding the silkworm kynurenine oxidase gene
Heryanto et al. Efficient hyperactive piggyBac transgenesis in Plodia pantry moths
CN114317613B (en) Method for constructing lepidopteran insect female sterile line by utilizing genome editing technology
CN107384919B (en) Method for inhibiting nuclear polyhedrosis virus
JP2003088274A (en) Method for introducing polynucleotide to silkworm producing dormant egg
TRAORE et al. Developing genetic tools to control the Oriental Fruit Fly Bactrocera dorsalis [Diptera: Tephritidae]: potential strategies and molecular tools
KR102114194B1 (en) Transgenic silkworms producing silk expressed KillerRed protein
US8691564B2 (en) Female specific insect expression system

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right
TA01 Transfer of patent application right

Effective date of registration: 20200521

Address after: 200032 building 4, No. 300 Fenglin Road, Xuhui District, Shanghai

Applicant after: Center for excellence and innovation in molecular plant science, Chinese Academy of Sciences

Address before: 200032 Yueyang Road 319, Xuhui District, Shanghai

Applicant before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES

RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20190813