CN110117613A - A kind of method preparing male sterile lepidopterous insects and its nucleic acid constructs - Google Patents

Abstract

The invention discloses a kind of method for preparing male sterile lepidopterous insects and its nucleic acid constructs.This method comprises: 1) construct Ser2 gene knockout nucleic acid constructs comprising the element that the following operability from 5 ' ends to 3 ' ends connects: U6 promoter, the first Ser2 gene target and polyA；U6 promoter, the 2nd Ser2 gene target and polyA；2) by the construction and the fresh insect ovum of PHA3PIG plasmid corotation Lepidoptera that Piggybac transposase can be expressed, G0 generation is obtained, G1 generation is selfed to obtain；With 3) in G1 generation, is mated with the transgenosis lepidopterous insects of expression Cas9 albumen G2 generation to get.The present invention successfully constructs male sterile lepidopterous insects under the premise of not influencing normal mating behavior using the CRISPR/Cas9 technology based on PiggyBac transposons, has important value in terms of lepidoptera pest is prevented and treated by malesterile technique.

Description

A kind of method preparing male sterile lepidopterous insects and its nucleic acid constructs

Technical field

The invention belongs to field of biotechnology, it is related to a kind of method for preparing male sterile lepidopterous insects and its nucleic acid Construction.

Background technique

Silkworm is a kind of typical mode economic insects, is one of the economic insects to be cocoond using mulberry leaf as foodstuff, spinning.Benefit Use silkworm as the research object of the insect pest prevention and treatment especially genetic control of lepidoptera pest, it will be in agriculture and forestry pest heredity Prevention and treatment aspect generates great influence, but also will promote and apply in other insects of Lepidoptera.The biology of pest at this stage Prevention and treatment insect sterile technique be mostly using radiation and tetracycline induce, and both insect sterile techniques take time and effort can not have it is stable Hereditary effect strain, and be to discharge sterile males to carry out control of insect, but these sterile males are relative to wild mostly For male worm, competitiveness is weaker, not can be carried out effective mating.In nature, female insect is most of in mating process Motoricity is lower, attracts male worm by release sex pheromone to mate.Therefore, a kind of stable heredity is studied and can be by releasing Effective sterile strain of the female adult of putting property information and next-generation male is extremely urgent.

Male sterility is always the research hotspot of control of insect, and in the early stage fifties in last century, the U.S. utilizes steriliation by irradiation Technology successfully eliminated screwworm (Cochliomyia hominivorax) for the first time in human history, at 1975 2 Month, Japan thoroughly does away with it successfully by being released through the sterile melonfly (Bactrocera cucuribitae) of radiation treatment. By the splicing factor using Tetracycline regulation female, female-specific lethal can be made.Although radiation and tetracycline can lure Sterile insect is led, but the target infertility worm of the two is female, cannot be male.

In insect mating reproductive process, male semen albumen is transferred to female internal, the male semen by ejaculation behavior Albumen is essential to the reproductive success of male and female.Male semen albumen can influence the success of male sperm competition With female fecundity, fertility, service life and offspring's survival rate etc..According to research reports, male sexual accessory gland albumen mates in reproduction Secretion in the process be it is plastic, can be and more more complicated than what is be considered so far in tachytelic evolution under natural selection.

Summary of the invention

The purpose of the present invention is lack male sterile lepidopterous insects strain in lepidopterous insects Sterility of inheritance technology Deficiency provides a kind of method for preparing male sterile lepidopterous insects and its nucleic acid constructs.

For this purpose, the present invention provides a kind of method for preparing male sterile lepidopterous insects comprising following steps:

1) Ser2 gene knockout nucleic acid constructs is constructed comprising the member that the following operability from 5 ' ends to 3 ' ends connects Part: the first sgRNA Expression element and the 2nd sgRNA Expression element；The first sgRNA Expression element includes holding from 5 ' to 3 ' The element of the following operability connection at end: U6 promoter, the first Ser2 gene target and polyA；The 2nd sgRNA table Up to element include from 5 ' end to 3 ' end following operability connect element: U6 promoter, the 2nd Ser2 gene target and polyA；

2) by Ser2 gene knockout nucleic acid constructs described in step 1) and the PHA3PIG that Piggybac transposase can be expressed The fresh insect ovum of plasmid corotation Lepidoptera, hatching change moth, obtain G0 generation, make G0 generation selfing, obtain G1 generation；With

3) in the generation of G1 described in step 2), is mated with the transgenosis lepidopterous insects of expression Cas9 albumen, the G2 generation of acquisition, Up to the lepidopterous insects of male and female height infertility.

Preferably, the nucleotide sequence of the first Ser2 gene target is as shown in SEQ ID NO:1, and described second The nucleotide sequence of Ser2 gene target is as shown in SEQ ID NO:2.

Preferably, the Ser2 gene knockout nucleic acid constructs further includes the first riddled basins expression cassette.

Preferably, first riddled basins are red fluorescent protein genes.

Preferably, the transgenosis lepidopterous insects of the expression Cas9 albumen contain Cas9 expression casette, described Cas9 expression casette includes the element that the following operability from 5 ' ends to 3 ' ends connects: Nos promoter, Cas9 encoding histone Sequence and SV40 terminator.

Preferably, the transgenosis lepidopterous insects of the expression Cas9 albumen further include the expression of the second riddled basins Box.Preferably, second riddled basins are green fluorescent proteins.

Preferably, the corotation is by the Ser2 gene knockout nucleic acid constructs and can to express Piggybac transposase PHA3PIG plasmid mixing after the resulting fresh insect ovum of mixed liquor microinjection.

Preferably, the lepidopterous insects are silkworms.

The present invention also provides a kind of Ser2 gene knockout nucleic acid constructs comprising operates from 5 ' ends to 3 ' the following of end Property connection element: the first sgRNA Expression element and the 2nd sgRNA Expression element；The first sgRNA Expression element includes The element that following operability from 5 ' ends to 3 ' ends connects: U6 promoter, the first Ser2 gene target and polyA；Described 2nd sgRNA Expression element includes the element that the following operability from 5 ' ends to 3 ' ends connects: U6 promoter, the 2nd Ser2 base Because of target spot and polyA.

The present invention also provides a kind of methods for preventing and treating lepidoptera pest, comprising the following steps: by method system as described above Male sterile lepidopterous insects field obtained by standby is freeed, and by mating with wild lepidopterous insects, is reduced offspring, is reduced Population quantity.

The present invention knocks out silkworm Ser2 gene using the CRISPR/Cas9 technology based on piggyBac transposon, provides Stablize effective male sterility genetic strain, solving traditional method by radiation and the sterile insect of tetracycline induction cannot Stablize the problem of being effectively hereditary to offspring.Silkworm Ser2 gene is knocked out for the first time, is successfully realized the release by mutant females, Male worm mutant infertility in its offspring, to realize the controllability of insect.The present invention is by silkworm embryos microinjection technique, fluorescence Detection is combined with molecular biosciences operation, is knocked out silkworm Ser2 gene and is obtained male sterility and stablize genetic strain.It can promote To the biological control of pest, promote the development of environmentally friendly prevention and treatment.

Detailed description of the invention

Fig. 1 silkworm Ser2 gene structure figure and plasmid construction ideograph.A: silkworm Ser2 gene structure and knockout target spot, it is red Color is PAM sequence.B:Ser2 gene transgenic plasmid construction ideograph.

Fig. 2 silkworm Ser2 gene knockout leads to male sterility.A: the ovum that wild type is female, male worm mating (WT ♂ × WT ♀) produces Can develop, wild type female adult mate with the male worm of mutation (Δ Ser2 ♂ × WT ♀) production ovum agensis, wild type male worm and mutation The ovum that produces of female adult mating (WT ♂ × Δ Ser2 ♀) can develop, female, the male worm mating (Δ Ser2 ♂ × Δ Ser2 ♀) of mutation produces Ovum agensis.B: adult post-coitum, the quantization figure of progeny size, compared with wild type and mutant females, mutant is male The rear algebra difference of property is extremely significant.

Specific embodiment

The present inventor passes through selection to gene mutation site and transgenosis plasmid by research and repetition test extensively Building by silkworm embryos microinjection technique, fluorescence detection with molecular biosciences operation combine, construct a BmSer2 base Because being mutated silkworm strain, after finding Ser2 gene mutation, the normal mating behavior of male and female mutant is unaffected, Female mutants Body is normal as the Hatching Rate of Silkworm Eggs of parent, however male mutant as parent Hatching Rate of Silkworm Eggs but close to 0, it is seen that BmSer2 gene mutation body Male Silkworm height infertility can be used for the heredity control of lepidopterous insects, prevent and treat lepidoptera pest, So as to complete the present invention.

Lepidoptera

Lepidoptera includes moth, two class insect of butterfly.Belong to Pterigota, Holo metabola.About 200,000 kinds known to the whole world, China Known about more than 8000.The mesh is the 2nd big mesh that coleoptera is only second in Insecta.Including Gelechidae；Sulfur butterfly, such as wheat Moth, pink bollworm, phthorimaea operculella and brachmia triannuella etc.；Tortricidae, such as adoxophyes moth, eating-core bean worm；Pyralidae, Such as pear fruit borer, corn borer；Geometridae, such as big bridging worm；Sulfur butterfly, such as cabbage butterfly；Noctuidae, such as powder mosquito night Moth, bollworm etc.；Lymantriidae, such as gypsymoth；Papilionidae, such as jade belt wind butterfly, golden wind butterfly；Notodontidae, such as boat-shaped caterpillar； Arctiidae, such as yellow abdomen moths attracted by lamplight, white tiger moth, fall webworms；Sphingidae, such as vine hawk moth；Bombycidae, such as silkworm；It Bombycidae, such as Philosamia cynthia；Hesperiidae, such as rice plant skipper.The distribution of lepidopterous insects is extremely wide, the richest with tropical type It is rich.The larva of most types is caused harm all kinds of cultivated plants, and bodily form the greater often eats blade or brill moth limb to the greatest extent.The bodily form is smaller Person often leaf roll, sew leaf, knot sheath, spinning netting or pierce plant tissue feeding and cause harm.Adult is mostly using nectar etc. as Replacement Battalion Feeding or mouthpart degeneration no longer feeding, does not cause generally directly to endanger.

In conclusion it is pest that lepidopterous insects week is most of, also there is minority, such as silkworm is the elder brother for having economic value Worm.Therefore, the extensive malesterile technique of lepidopterous insects is studied, prevention and treatment for pest and has economic value Transgene product will generate great realistic meaning.

Therefore, in a preferred embodiment, lepidopterous insects of the invention are silkworms.

Lepidopterous insects transgenic technology is often carried out with the mode of transposons at present.PiggyBac transposon is a kind of source It is initially that mosquito powder exigua (Trichoplusia is infected by baculoviral (Baculovirus) in the transposons of lepidopterous insects Ni) TN-368 cell strain system, from Galleria mellonella (GmMNPV) and Autographa californica (AcMNPV) isolated for the first time in nucleopolyhedrosis virus, at pink corn earworm worm (Pectinophora gassypiella) Embryo, excision test of silkworm (Bombyx mori) egg cell etc. all demonstrate the accuracy of piggyBac transposon excision.? Intracellular etc. the experiment of yellow typhoid fever mosquito (Aedes aegypti), mosquito powder exigua and silkworm egg also shows piggyBac can Be well on swivel base, and the frequency of excision and swivel base is all higher.Research in silkworm starts from 1997, finds piggyBac Transposons studies silkworm the transposition of silkworm, researcher followed by piggyBac transposon. The further investigation of piggyBac transposon will be for the genetic control based theoretical of pest.

The principle for the genome editing technique being commonly used is to generate DNA in genome specific site by artificial Double-strand break (Double-strand break, DSB), so that nonhomologous end company occurs for the DNA repair system induced in cell Connect (Nonhomologous end joining, NHEJ) and homologous recombination repair (Homologous recombination, HR).Pass through above-mentioned reparation approach, it is believed that the DNA double key breaking part of generation will realize that gene mutation, specific mutagenesis introduce and determine Point modification.Genome editor is divided into three classes, and wherein CRISPR/Cas9 technical costs is lower, and target spot shear efficiency is higher.

Ser2 (also known as serine protease 2) is a kind of serine protease, has extremely strong conservative, in animal In it is generally existing, play a significant role in reproductive development.Ser2 belongs to serine gene family in gene family, the family Gene generally include a variety of pairs of reproductive developments gene.Ser2 gene of the invention is the Ser2 gene of lepidopterous insects, excellent Select silkworm.The BmSer2 gene of silkworm is the reproduction for studying lepidopterous insects, and prevents and treats Lepidoptera evil by insect sterile technique The suitable material of worm.

The preferred Ser2 gene target sequence of the present invention knocks out Ser2 base as target sequence in CRISPR/Cas9 technology Cause, to obtain the function of malesterile mutants.According to the target site feature of CRISPR/Cas9 system, the present invention is preferred Two target spots be located at the 4th and the 5th exon of silkworm Ser2 gene (GenBank:NM_001160203.1).It is more excellent Choosing, name is TS1 (GGATGAACCCAAAATTATGAGGG) and TS2 (CCTCGAGAACCCTTTTAAAGGCC) respectively.

Therefore, the present invention includes having with preferred Ser2 gene target sequence 1 or 2 (SEQ ID NO:1 or 2) of the invention 50% or more (preferably 60% or more, 70% or more, 80% or more, more preferable 90% or more, more preferable 95% or more, it is optimal 98% or more is selected, such as 99%) nucleic acid of homology, the nucleic acid also have in CRISPR/Cas9 technology as target sequence Ser2 gene is knocked out, to obtain the function of sterile mutant." homology " refers to according to the identical percentage in position, two or Similar level (i.e. sequence similarity or identity) between a plurality of nucleic acid.

In view of the teachings of the present invention and the prior art, those of ordinary skilled in the art can easily understand that, although reality of the invention The target sequence of the Ser2 gene from silkworm is provided in example, but is derived from other insects of Lepidoptera, such as pickles Moth, prodenia litura have the Ser2 gene target sequence of certain homology (conservative) with promoter of the present invention, as long as this field Technical staff after having read the application according to information provided by the present application can be convenient from other insects it is isolated should Ser2 gene target sequence simultaneously verifies its function.

(1) BmSer2 gene knockout carrier:

BmSer2 used in the present invention knocks out plasmid PXL-BacII-IE1-DsRed2-U6-BmSer2sgRNA1-U6- BmSer2sgRNA2 is that (Piggybac transposons is shown in based on the PiggyBac transposons that insecticidal transgenic is studied is widely used in Fraser et al., Insect Moecular Biology, 1996) it) is transformed and to be completed.It is as follows:

Imported in PiggyBac transposon vector first by IE1 promoter (Kojima et al, VirusResearch, 2008) the red fluorescent protein DsRed of driving, is configured to PXL-BacII-IE1-DsRed2 transgenosis Carrier.After being successfully transferred to this carrier, transgenic positive individual can be with whole body expression red fluorescence, convenient for screening from late embryogenesis. Two insertion U6 sequence-polyA sequences are then gradually inserted into PXL-BacII-IE1-DsRed2 plasmid, and (U6 is promoter sequence Column, polyA sequence are the polyadenylation sequence of the 3 ' end mRNA), wherein U6 sequence is polyA shown in SEQ ID NO:3 Sequence are as follows: " TTTTTT ".So far, PiggyBac transposon vector is transformed into plasmid PXL-BacII-IE1-DsRed2-U6- U6。

Then, primers F 1, R1, F2 and R2 are identified using target spot by silkworm full-length genome template, target is obtained by PCR method Point segment.It is sequenced and determines target sequence.Synthesize long primer sgRNA-F1, sgRNA-R1, sgRNA-F2, sgRNA-R2, SgRNA-KnpI-F, sgRNA-HindIII-R, sgRNA-Overlap-F and sgRNA-Overlap-R.Wherein sgRNA-KnpI- F and sgRNA-R1, sgRNA-F1 and sgRNA-Overlap-R two are to primer respectively with PXL-BacII-IE1-DsRed2-U6-U6 Plasmid is template, obtains product by PCR, then product is using the volume ratio of 2:1 as template, with sgRNA-KnpI-F and sgRNA- Overlap-R is primer, obtains the BmSer2sgRNA-1 segment with restriction enzyme KnpI homology arm by PCR.Similarly, Using sgRNA-Overlap-F and sgRNA-R2, sgRNA-F2 and sgRNA-HindIII-R as first round PCR primer, product is obtained Afterwards, it is the second wheel primer with sgRNA-Overlap-F and sgRNA-HindIII-R, band restriction enzyme is obtained by PCR The BmSer2sgRNA-2 segment of HindIII homology arm.

Finally, with restriction enzyme KnpI and HindIII digestion PXL-BacII-IE1-DsRed2-U6-U6 plasmid.It will Above-mentioned digestion products and the BmSer2RNA-1 segment with KnpI homology arm and the BmSer2RNA-2 segment with HindIII homology arm After mixing U6 promoter downstream is inserted by the method for homologous recombination respectively, is sequenced, after confirmation insertion is correct, obtains PXL- BacII-IE1-DsRed2-U6-BmSer2sgRNA1-U6-BmSer2sgRNA2 plasmid.After sequencing is correct, Qiagen public affairs are used The Plasmid Midi kit kits of department are spare.It thus obtains BmSer2 and knocks out plasmid PXL-BacII-IE1- DsRed2-U6-BmSer2sgRNA1-U6-BmSer2sgRNA2 (Plasmid pattern figure is shown in Fig. 1).

(2) transgenic bombyx mori Ser2 knocks out strain

In the present invention using can express Piggybac transposase PHA3PIG plasmid (referring to Tamura et al., Nature Biotechnology, 2000) auxiliary generates piggyBac transposon, and Ser2 is knocked out matter by micro-injection method It is injected after grain PXL-BacII-IE1-DsRed2-U6-BmSer2sgRNA1-U6-BmSer2sgRNA2 and PHA3PIG plasmid mixing Enter in the fresh ovum of silkworm, specific method is referring to Kanda & Tamura (1991).It is sealed to prevent pollution, then after injection with nontoxic glue Hatch in 25 DEG C of gnotobasis, and raises newly-hatched silkworm, the G1 of contemporary (G0 generation) silkworm moth selfing, acquisition is aobvious in fluorescence for silkworm seed Red fluorescence individual is filtered out under micro mirror.

Silkworm Nos-Cas9 is silkworm transgenosis activation strain.The lines transgenic silkworm whole body expression EGFG green is glimmering Light, and Cas9 albumen is expressed in sexual gland, it is the following parent silkworm for obtaining double fluorescence silkworms.According to document (Xu, J., Chen, S.,Zeng,B.,James,A.A.,Tan,A.and Huang,Y.(2017)Bombyx mori P-element Somatic Inhibitor(BmPSI)Is a Key Auxiliary Factor for Silkworm Male Sex Determination.PLoS Genet, 13, e1006576.) building.Imported in PiggyBac transposon vector first by The green fluorescent protein EGFP of IE1 promoter (Kojima et al, VirusResearch, 2008) driving, is configured to PXL- BacII-IE1-EGFP transgene carrier.Promoter, Cas9 gene and the SV40 terminator of silkworm Nos gene are then cloned respectively Sequence.PXL-BacII-IE1-EGFP transgene carrier is once inserted by methods of homologous recombination, to obtain PXL-BacII- IE1-EGFP-Nos-Cas9-SV40 transgenosis plasmid.Finally by microinjection wild type silkworm, transgenic bombyx mori product are obtained It is Nos-Cas9.Nos promoter sequence is referring to patent " the specifically expressed promoter of silkworm gonad and its catching method " (patent Application number 201610360601.2, Chen Rongmei etc., 2016).The sequence of Cas9 gene is as shown in SEQ ID NO:4.SV40 is terminated Subsequence is as shown in SEQ ID NO:5.It is sealed after injection with nontoxic glue to prevent pollution, is then incubated in 25 DEG C of gnotobasis Change, and raise newly-hatched silkworm, after contemporary (G0 generation) selfing, the G1 of acquisition filters out green fluorescence for newly-hatched silkworm under fluorescence microscope Body.

Then the G1 that screening obtains for green fluorescence individual feeding and is mated for red fluorescence individual and Nos-Cas9G1, The G2 of acquisition screens double fluorescence (glow green light again) newly-hatched silkworm, the double fluorescence silkworms pumpings of gained for newly-hatched silkworm under fluorescence microscope Genome identification target spot catastrophe is mentioned, grows to adult to it, carries out mating reproduction Phenomena Observation, and count oviposition situation.

(3) detection of BmSer2 mutant silkworm

The present invention has found BmSer2 base by verifying double fluorescence silkworm BmSer2 gene mutations and counting its situation of laying eggs Because mutation has substantial effect to male silkworm hatching rate.The identification of gene mutation situation: several double glimmering in newly-hatched silkworm phase picking Light silkworm extracts genome, clones target spot segment by PCR method and is sequenced.Obtaining trans genie individual can be red by observation The silkworm seed simultaneous with red and egfp expression is picked out with green fluorescence.Dissimilarity is distinguished by pupa time Not, male sterility is determined whether in adult.The case where double fluorescence silkworms are laid eggs can be by by the not double fluorescence men of a large amount of unisexuality Separation of copulating moth after silkworm mates 5 hours at 25 DEG C of environment temperature with wild type silkworm is then laid eggs 36 hours in identical environment, statistics Egg laying amount.

The present invention has the advantages that the CRISPR/Cas9 technology based on piggyBac transposon is utilized successfully to construct for the first time The silkworm strain of male height infertility under the premise of not influencing normal mating behavior.Obtained transgenosis BmSer2 mutation Body silkworm strain, no matter male and female mutant, which mates in identical environment with wild type, is not present any obstacle, mutant females Hatching Rate of Silkworm Eggs as parent is normal, however male mutant as parent Hatching Rate of Silkworm Eggs but close to 0.In addition, this hair It is bright to make being very easy to for mutant.The present invention has weight in terms of lepidoptera pest is prevented and treated by malesterile technique The value wanted.

Primers F 1	GAATCGTGGCTCCTGTTGTAAAT
		Primer R1	AGAACAGGTGCTCGGTTTTTGTT
Primers F 2	ATATCTCAGGTGCAGATTTTGCG
		Primer R2	TACTCGAATTGGAGCAAGCGAAT
Primer sgRNA-F1	GGATGAACCCAAAATTATGAGTTTTAGAGCTAGAAATAGCAAGTT
		Primer sgRNA-R1	TCATAATTTTGGGTTCATCCACTTGTAGAGCACGATATTTTGTAT
Primer sgRNA-F2	GGCCTTTAAAAGGGTTCTCGGTTTTAGAGCTAGAAATAGCAAGTT
		Primer sgRNA-R2	CGAGAACCCTTTTAAAGGCCACTTGTAGAGCACGATATTTTGTAT
Primer sgRNA-KnpI-F	CTCACTATAGGGCGAATTGGAGGTTATGTAGTACACATTGTTGTA
		Primer sgRNA-HindIII-R	TTTTCTTGTTATAGATATCAAAAAAAGCACCGACTCGGTG
Primer sgRNA-Overlap-F	GCTAGCCATTGACTCCGCGGAGGTTATGTAGTACACATTGTTGTA
		Primer sgRNA-Overlap-R	CCGCGGAGTCAATGGCTAGCAAAAAAGCACCGACTCGGTG
Primer sgRNA-F3421	GTGGAGCTCCAGCTTTTGTT
		Primer sgRNA-R3667	GTGAGTCAAAATGACGCATG

The building of 1 carrier of embodiment

Plasmid PXL-BacII-IE1-DsRed2-U6- is knocked out 1. cloning by PCR method and obtaining BmSer2 BmSer2sgRNA1-U6-BmSer2sgRNA2.Specific steps:

I.sgRNA-KnpI-F and sgRNA-R1, sgRNA-F1 and sgRNA-Overlap-R two are to primer respectively with PXL- BacII-IE1-DsRed2-U6-U6 plasmid is template, obtains product by PCR, and then product is using the volume ratio of 2:1 as template, Using sgRNA-KnpI-F and sgRNA-Overlap-R as primer, obtained by PCR with restriction enzyme KnpI homology arm BmSer2sgRNA-1 segment.Similarly, with sgRNA-Overlap-F and sgRNA-R2, sgRNA-F2 and sgRNA-HindIII-R For first round PCR primer, after obtaining product, it is the second wheel primer with sgRNA-Overlap-F and sgRNA-HindIII-R, passes through PCR obtains the BmSer2sgRNA-2 segment with restriction enzyme HindIII homology arm.

Finally, with restriction enzyme KnpI and HindIII digestion PXL-BacII-IE1-DsRed2-U6-U6 plasmid.It will Above-mentioned digestion products and the BmSer2RNA-1 segment with KnpI homology arm and the BmSer2RNA-2 segment with HindIII homology arm After mixing U6 promoter downstream is inserted by the method for homologous recombination respectively, is sequenced, after confirmation insertion is correct, obtains PXL- BacII-IE1-DsRed2-U6-BmSer2sgRNA1-U6-BmSer2sgRNA2 plasmid.After sequencing is correct, Qiagen public affairs are used The Plasmid Midi kit kits of department are spare.It thus obtains BmSer2 and knocks out plasmid PXL-BacII-IE1- DsRed2-U6-BmSer2sgRNA1-U6-BmSer2sgRNA2.Wherein (precious bioengineering is public using KOD PLUS Taq enzyme by PCP Department) press following system configurations PCR reaction system.

The setting of PCR program are as follows:

PCR product uses spare after Gel Extraction Kit D2500 kits.

II. digestion PXL-BacII-IE1-DsRed2-Real-U6-U6 plasmid.Digestion system is as follows:

Title	Dosage
		KnpI restriction endonuclease (NEB company)	3μl
HindIII restriction endonuclease (NEB company)	3μl
		PXL-BacII-IE1-DsRed2-U6-U6 plasmid	3μg
Deionized water	~50 μ l

Digestion program: 37 DEG C, overnight (> 8h).

Digestion products use the Plasmid Midi kit kits of Qiagen company.

III. BmSer2sgRNA-1 and BmSer2sgRNA-2 segment is inserted respectively using One Step Cloning Kit Enter to the downstream of the U6 promoter of PXL-BacII-IE1-DsRed2-U6-U6.Reaction system is as follows:

Response procedures: 37 DEG C, 30min；Ice bath 5min.

IV. the recombinant plasmid obtained in III is converted, coated plate is bacterium colony PCR every other day.Reaction system is identical as I step.Sun Property monoclonal send sequencing.Use primer are as follows: sgRNA-F3421 and sgRNA-R3667.

V. sequencing result proves that the insertion of BmSer2sgRNA-1 and BmSer2sgRNA-2 segment is correct.Use Qiagen company The Plasmid Midi kit kits plasmids.Plasmid PXL-BacII-IE1-DsRed2- is knocked out to obtain Ser2 U6-BmSer2sgRNA1-U6-BmSer2sgRNA2, for then injecting.

The acquisition of 2 transgenic bombyx mori of embodiment

Ser2 prepared by embodiment 1 knocks out plasmid PXL-BacII-IE1-DsRed2-U6-BmSer2sgRNA1-U6- It is injected into silkworm just oviposition after BmSer2sgRNA2 and the plasmid PHA3PIG mixed in equal amounts that Piggybac transposase can be expressed. Injecting method is to carry out microinjection according to method described in Kanda & Tamura (1991).After injection with nontoxic glue seal to prevent Pollution, then hatches in 25 DEG C of gnotobasis, and raise newly-hatched silkworm, and after changing moth, contemporary (G0 generation) silkworm moth is selfed, acquisition G1 is for newly-hatched silkworm, and the transgenic bombyx mori individual with red fluorescence is filtered out under fluorescence microscope, and (as BmSer2 mutation is intermediate Strain).

Then, red fluorescence transgenic bombyx mori and green fluorescent transgenic silkworm Nos-Cas9 raising screening obtained is simultaneously Mating, the G2 of acquisition screens pair fluorescence (glow and green light) newly-hatched silkworm (as BmSer2 for newly-hatched silkworm under fluorescence microscope Mutant strain), the double fluorescence silkworms of gained extract genome identification target spot catastrophe, and observe statistics oviposition and hatching rate situation (referring to fig. 2).

The detection of 3 transgenic bombyx mori of embodiment

The identification of gene mutation situation: newly-hatched silkworm phase picking 10 double fluorescence silkworms extract its genome, use 1 He of primers F R1, F2 and R2 clone target spot segment by PCR method and are sequenced.Sequencing result shows the intracorporal BmSer2 base of double fluorescence silkworms Because in, " target spot 1 " and " target spot 2 " sequence mutates.

The case where double fluorescence silkworms are laid eggs: by the not double fluorescence silkworms of 30 unisexuality and wild type silkworm in environment temperature 25 Separation of copulating moth after mating 5 hours at DEG C is then laid eggs 36 hours in identical environment, counts egg laying amount and hatching rate, referring to fig. 2.It can See, BmSer2 generates the female silkworm for being mutated (i.e. double fluorescence) and the produced egg hatching rate of normal male silkworm is normal；BmSer2 is generated The male silkworm for being mutated (i.e. double fluorescence) and the normal female produced egg hatching rate of silkworm are close to 0, and mutant male and female silkworm mates institute The egg hatching rate of production is close to 0.In conclusion the male silkworm that BmSer2 generates mutation (i.e. double fluorescence) is sterile (Fig. 2).

In adult, the ovum that wild type is female, male worm mating (WT ♂ × WT ♀) produces can develop；Wild type female adult and mutation The ovum agensis that male worm mating (Δ Ser2 ♂ × WT ♀) produces；Wild type male worm mates (WT ♂ × Δ Ser2 ♀) with the female adult of mutation The ovum of production can develop；The ovum agensis that the female of mutation, male worm mating (Δ Ser2 ♂ × Δ Ser2 ♀) produce.This is the result shows that male Mutant infertility, and this system stabilization is hereditary to offspring by the way that mutant females are fertile, the male mutant in offspring can Infertility, and then reach controllable quantity.

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.

Claims (10)

1. a kind of method for preparing male sterile lepidopterous insects, which comprises the following steps:

1) Ser2 gene knockout nucleic acid constructs is constructed comprising the element that the following operability from 5 ' ends to 3 ' ends connects: First sgRNA Expression element and the 2nd sgRNA Expression element；The first sgRNA Expression element includes from 5 ' ends to 3 ' ends Following operability connection element: U6 promoter, the first Ser2 gene target and polyA；The 2nd sgRNA expression Element include from 5 ' end to 3 ' end following operability connect element: U6 promoter, the 2nd Ser2 gene target and polyA；

2) by Ser2 gene knockout nucleic acid constructs described in step 1) and the PHA3PIG plasmid that Piggybac transposase can be expressed The fresh insect ovum of corotation Lepidoptera, hatching change moth, obtain G0 generation, make G0 generation selfing, obtain G1 generation；With

3) in the generation of G1 described in step 2), mate with the transgenosis lepidopterous insects of expression Cas9 albumen, the G2 of acquisition for get Male sterile lepidopterous insects.

2. method as described in claim 1, which is characterized in that the nucleotide sequence such as SEQ of the first Ser2 gene target Shown in ID NO:1, the nucleotide sequence of the 2nd Ser2 gene target is as shown in SEQ ID NO:2.

3. method as described in claim 1, which is characterized in that the Ser2 gene knockout nucleic acid constructs further includes the first sieve Select marker gene expression cassette.

4. method as claimed in claim 3, which is characterized in that first riddled basins are red fluorescent protein bases Cause.

5. method as described in claim 1, which is characterized in that the transgenosis lepidopterous insects of the expression Cas9 albumen contain Cas9 expression casette, the Cas9 expression casette include the element that the following operability from 5 ' ends to 3 ' ends connects: Nos promoter, Cas9 albumen coded sequence and SV40 terminator.

6. method as claimed in claim 5, which is characterized in that the transgenosis lepidopterous insects of the expression Cas9 albumen also wrap Include the second riddled basins expression cassette.

7. method as described in claim 1, which is characterized in that the corotation is by the Ser2 gene knockout nucleic acid constructs The resulting fresh insect ovum of mixed liquor microinjection after being mixed with the PHA3PIG plasmid that can express Piggybac transposase.

8. method as described in claim 1, which is characterized in that the lepidopterous insects are silkworms.

9. a kind of Ser2 gene knockout nucleic acid constructs, which is characterized in that it includes the following operability from 5 ' ends to 3 ' ends The element of connection: the first sgRNA Expression element and the 2nd sgRNA Expression element；The first sgRNA Expression element include from The element of the following operability connection at 5 ' ends to 3 ' ends: U6 promoter, the first Ser2 gene target and polyA；Described Two sgRNA Expression elements include the element that the following operability from 5 ' ends to 3 ' ends connects: U6 promoter, the 2nd Ser2 gene Target spot and polyA.

10. a kind of method for preventing and treating lepidoptera pest, which comprises the following steps: will be square as described in claim 1 Male sterile lepidopterous insects field obtained by method preparation is freeed, and by mating with wild lepidopterous insects, reduces offspring, Reduce population quantity.