CN110184296A - A kind of method and its nucleic acid constructs preparing the male and female lepidopterous insects of height infertility - Google Patents

Abstract

The invention discloses a kind of methods and its nucleic acid constructs for preparing the male and female lepidopterous insects of height infertility.This method comprises: 1) construct Vasa gene knockout nucleic acid constructs comprising the element that the following operability from 5 ' ends to 3 ' ends connects: U6 promoter, the first Vasa gene target and polyA；U6 promoter, the 2nd Vasa gene target and polyA；2) by the construction and the fresh insect ovum of PHA3PIG plasmid corotation Lepidoptera that Piggybac transposase can be expressed, G0 generation is obtained, G1 generation is selfed to obtain；With 3) in G1 generation, is mated with the transgenosis lepidopterous insects of expression Cas9 albumen G2 generation to get.The present invention successfully constructs the lepidopterous insects of height infertility under the premise of not influencing normal mating behavior using the CRISPR/Cas9 technology based on PiggyBac transposons, has important value in terms of lepidoptera pest is prevented and treated by insect sterile technique.

Description

A kind of method and its nucleic acid structure preparing the male and female lepidopterous insects of height infertility Build object

This application claims the applying date be on February 07th, 2018 Chinese patent application CN201810123478.1 it is preferential Power.The application quotes the full text of above-mentioned Chinese patent application.

Technical field

The invention belongs to field of biotechnology, be related to it is a kind of prepare the male and female method of the lepidopterous insects of height infertility and Its nucleic acid constructs.

Background technique

Silkworm has more than 5000 years cultivation history, economic valence as a kind of time-honored economic insects, in China Value still occupies high specific weight until today in China's Foreign Trade.Nowadays, with the fast development of modern biotechnology science and technology, family Representative of the silkworm as Lepidoptera (Lepidoptera) insect, not only due to its value economically, even more due to its raising side Method is mature, and life cycle is short and has the biological properties such as obvious development by metamorphosis, is increasingly becoming a kind of important biology mould Formula biology.Research as China takes the lead in domestic silkworm gene framing figure of having completed in the world at the beginning of 21 century, to silkworm The post-genomic science epoch are progressed into, silkworm is as lepidopterous insects model organism in silkworm biological reactor and squama wing in recent years It plays a significant role in the research of mesh field of pest control.Currently, the mesh that Lepidoptera is most as agriculture and forestry pest, including corn Snout moth's larva (Ostrinia nubilalis), black cutworm (Agrotis ypsilon), bollworm (Heliothis armigera) etc. A variety of insects for seriously endangering agriculture and forestry, and huge economic loss is brought every year.In order to reduce the damage of economy caused by pest It loses, the biological control of pest is gradually valued by the people also with the continuous development of biotechnology.Biological control is due to its people The characteristics of poultry is safe, pollution-free, does not form resistance, the damage compared to chemical prevention to environment, biological control shows huge Advantage.Currently, most popular in biological control is Sterile-insect technique (SIT), i.e., obtained by radiation or hybridizing method Its field is freeed after obtaining sterile pest, makes pest offspring reduce to reduce pest population by mating with wild insects pest Quantity.There is acquisition infertility completely in the infertility prevention and treatment of lepidoptera pest needs the irradiation doses of many idols (to generally require 300-500Gy), higher irradiation dose can reduce its male sexual competitiveness power, to influence control efficiency, therefore in Lepidoptera evil In the biological control of worm, Sterility of inheritance method is paid more and more attention.Therefore, model organism of the silkworm as lepidopterous insects is led to The a large amount of infertility individuals of genetic manipulation acquisition are crossed to be of great significance for the prevention and treatment of the following lepidoptera pest.

Currently, the silkworm insect sterile technique in China is mainly the Male Silkworm researched and developed by Inst. of Silkworm, Chinese Academy of Agricultural Sciences Sterile line --- it loses Zhenjiang open country.The Male Silkworm infertility strain be by Bombyx mandarina and silkworm distant hybridization breeding during, There is sterile symptom often in the sterile strain separated from offspring, the lines progenies.By constantly passing on screening, finally Temperature sensitive type sterile line No1 and composing type sterile line No2 are obtained.Sterility of the temperature sensitive type sterile line No1 in spring is 10%- 90%, a small amount of fertile offspring shows as 100% infertility in subsequent summer, and autumn shows as 99% infertility, No1 sterility by To being affected for environment temperature.Composing type sterile line No2 is 95% to 100% in spring sterility, a small number of fertile offsprings 100% height infertility is shown as in subsequent summer and autumn, No2 is influenced by ambient temperature less.It loses as one Zhenjiang open country Kind Male Silkworm infertility strain, 1. 2. azoospermia slo is 3. smart by male moth penis flesh degeneration slp with external reported 3 seed type Pod exception sls is compared, and Zhenjiang open country, which is lost, has the characteristics that high sterility and Genital System Dysplasia polymorphism, is more to manage at present The silkworm infertility strain thought.But Zhenjiang open country, which is lost, exists simultaneously following problem:

1) male-sterile line is lost in Zhenjiang open country is obtained by Bombyx mandarina and silkworm distant hybridization breeding, this is in other squama wings It is difficult to operate in mesh pest, by taking diamondback moth, black cutworm as an example, there is presently no this kind of pests of discovery to have between population as silkworm The so big difference between Bombyx mandarina.

2) Zhenjiang open country loses male-sterile line and needs constantly passage, and feeding work is huge, if the midway division of history into periods, regains phase Same male-sterile line is very difficult, and repeatability is poor.

3) the sterile mechanism complexity of male-sterile line is lost in Zhenjiang open country, shows a variety of unused mutant phenotypes, and losing Passing can not be corresponding with gene on learning, and makes it desirable to obtain similar sterile product in other lepidoptera pests by science of heredity means It is very difficult.

4) Zhenjiang open country is lost male-sterile line either temperature sensitive type sterile line No1 or composing type sterile line No2 and is existed A certain number of fertile offsprings, sterility are not thorough.

5) Zhenjiang open country loses male-sterile line and there was only male sterility, in the prevention and treatment of lepidoptera pest not compared with male and female It educates, effect halves.

Therefore, this field is badly in need of obtaining male and female silkworm height infertility, and operation repeatability is high, and sterile theoretical mechanism is completeer Standby, the following silkworm strain for being easy to promote in lepidoptera pest.

Summary of the invention

The purpose of the present invention is lack the lepidopterous insects product of male and female height infertility in lepidopterous insects Sterility of inheritance technology The deficiency of system provides the method and its nucleic acid constructs of a kind of lepidopterous insects for preparing male and female height infertility.

For this purpose, the present invention provides a kind of method of lepidopterous insects for preparing male and female height infertility comprising following steps:

1) Vasa gene knockout nucleic acid constructs is constructed comprising the member that the following operability from 5 ' ends to 3 ' ends connects Part: the first sgRNA Expression element and the 2nd sgRNA Expression element；The first sgRNA Expression element includes holding from 5 ' to 3 ' The element of the following operability connection at end: U6 promoter, the first Vasa gene target and polyA；The 2nd sgRNA table Up to element include from 5 ' end to 3 ' end following operability connect element: U6 promoter, the 2nd Vasa gene target and polyA；

2) by Vasa gene knockout nucleic acid constructs described in step 1) and the PHA3PIG that Piggybac transposase can be expressed The fresh insect ovum of plasmid corotation Lepidoptera, hatching change moth, obtain G0 generation, make G0 generation selfing, obtain G1 generation；With

3) in the generation of G1 described in step 2), is mated with the transgenosis lepidopterous insects of expression Cas9 albumen, the G2 generation of acquisition, Up to the lepidopterous insects of male and female height infertility.

Preferably, the nucleotide sequence of the first Vasa gene target is as shown in SEQ ID NO:1, and described second The nucleotide sequence of Vasa gene target is as shown in SEQ ID NO:2.

Preferably, the Vasa gene knockout nucleic acid constructs further includes the first riddled basins expression cassette.

Preferably, first riddled basins are red fluorescent protein genes.

Preferably, the transgenosis lepidopterous insects of the expression Cas9 albumen contain Cas9 expression casette, described Cas9 expression casette includes the element that the following operability from 5 ' ends to 3 ' ends connects: Nos promoter, Cas9 encoding histone Sequence and SV40 terminator.

Preferably, the transgenosis lepidopterous insects of the expression Cas9 albumen further include the expression of the second riddled basins Box.

Preferably, the corotation is by the Vasa gene knockout nucleic acid constructs and can to express Piggybac transposase PHA3PIG plasmid mixing after the resulting fresh insect ovum of mixed liquor microinjection.

Preferably, the lepidopterous insects are silkworms.

The present invention also provides a kind of Vasa gene knockout nucleic acid constructs comprising operates from 5 ' ends to 3 ' the following of end Property connection element: the first sgRNA Expression element and the 2nd sgRNA Expression element；The first sgRNA Expression element includes The element that following operability from 5 ' ends to 3 ' ends connects: U6 promoter, the first Vasa gene target and polyA；Described 2nd sgRNA Expression element includes the element that the following operability from 5 ' ends to 3 ' ends connects: U6 promoter, the 2nd Vasa base Because of target spot and polyA.

Also a kind of method for preventing and treating lepidoptera pest of the present invention, comprising the following steps: it is prepared by method as described above and The lepidopterous insects field of the male and female height infertility obtained is freeed, and by mating with wild lepidopterous insects, is reduced offspring, is reduced Population quantity.

The present invention relates to the gene BmVasa that one can regulate and control silkworm oviposition size and hatching rate.By depending on The CRISPR/Cas9 genome editing technique of piggyBac transposon building constructs BmVasa gene mutation silkworm strain, passes through Genetic regulation technology adjusts the size and its hatching rate of silkworm oviposition.The present invention also provides include the gene mutation site Selection and transgenosis plasmid construction method.Experiments have shown that the mutation of BmVasa can regulate and control silkworm egg size and its produced The hatching rate of ovum provides target gene by genetic method control pest to be following.The present invention is obtained by genetics technology Male and female silkworm height infertility was obtained, and it is high to operate repeatability, sterile theoretical mechanism is more complete, following is easy in lepidoptera pest The silkworm strain of middle popularization.

Detailed description of the invention

Fig. 1 is PXL-BacII-IE1-DsRed2-Real-U6-BmVasasgRNA1-U6-BmVasasg RNA plasmid figure Spectrum.

Fig. 2 is the table that transgenic bombyx mori pupa observes EGFP and DsRed under white light, green fluorescence and red fluorescence respectively It reaches.A is PXL-BacII-IE1-DsRed2-Real-U6-BmVasasgRNA1-U6-BmVasasg RNA2 transgenic bombyx mori product System；B is transgenic bombyx mori strain Nos-Cas9；C is the BmVasa mutant strain that A hybridizes with B.

Fig. 3 is laid eggs by mutant silkworm and wild type silkworm post-coitum is selfed laid eggs size pair with wild type silkworm Than.Δ BmVasa:BmVasa mutant；WT: wild type.

Specific embodiment

Test of the present inventor by extensive research and repeatedly, passes through the selection and transgenosis to gene mutation site The building of plasmid combines silkworm embryos microinjection technique, fluorescence detection with molecular biosciences operation, constructs one BmVasa gene mutation silkworm strain, after finding Vasa gene mutation, the normal mating behavior of silkworm is simultaneously unaffected, but female Mutant only has 1% or so as the Hatching Rate of Silkworm Eggs of parent, and wherein male mutant is close as the Hatching Rate of Silkworm Eggs of parent 0, BmVasa gene mutation body silkworm male and female height infertility, can be used for the heredity control of lepidopterous insects, prevents and treats Lepidoptera Pest, so as to complete the present invention.

Lepidoptera

Lepidoptera includes moth, two class insect of butterfly.Belong to Pterigota, Holo metabola.About 200,000 kinds known to the whole world, China Known about more than 8000.The mesh is the 2nd big mesh that coleoptera is only second in Insecta.Including Gelechidae；Sulfur butterfly, such as wheat Moth, pink bollworm, phthorimaea operculella and brachmia triannuella etc.；Tortricidae, such as adoxophyes moth, eating-core bean worm；Pyralidae, Such as pear fruit borer, corn borer；Geometridae, such as big bridging worm；Sulfur butterfly, such as cabbage butterfly；Noctuidae, such as powder mosquito night Moth, bollworm etc.；Lymantriidae, such as gypsymoth；Papilionidae, such as jade belt wind butterfly, golden wind butterfly；Notodontidae, such as boat-shaped caterpillar； Arctiidae, such as yellow abdomen moths attracted by lamplight, white tiger moth, fall webworms；Sphingidae, such as vine hawk moth；Bombycidae, such as silkworm；It Bombycidae, such as Philosamia cynthia；Hesperiidae, such as rice plant skipper.The distribution of lepidopterous insects is extremely wide, the richest with tropical type It is rich.The larva of most types is caused harm all kinds of cultivated plants, and bodily form the greater often eats blade or brill moth limb to the greatest extent.The bodily form is smaller Person often leaf roll, sew leaf, knot sheath, spinning netting or pierce plant tissue feeding and cause harm.Adult is mostly using nectar etc. as Replacement Battalion Feeding or mouthpart degeneration no longer feeding, does not cause generally directly to endanger.

In conclusion it is pest that lepidopterous insects week is most of, also there is minority, such as silkworm is the elder brother for having economic value Worm.Therefore, the extensive insect sterile technique of lepidopterous insects is studied, prevention and treatment for pest and has turning for economic value Gene product will generate great realistic meaning.

Therefore, in a preferred embodiment, lepidopterous insects of the invention are silkworms.

Lepidopterous insects transgenic technology is often carried out with the mode of transposons at present.PiggyBac transposons is a kind of source It is initially that mosquito powder exigua (Trichoplusia is infected by baculoviral (Baculovirus) in the transposons of lepidopterous insects Ni) TN-368 cell strain system, from Galleria mellonella (GmMNPV) and Autographa californica (AcMNPV) isolated for the first time in nucleopolyhedrosis virus, at pink corn earworm worm (Pectinophora gassypiella) Embryo, excision test of silkworm (Bombyx mori) egg cell etc. all demonstrate the accuracy of PiggyBac transposons excision.? Intracellular etc. the experiment of yellow typhoid fever mosquito (Aedes aegypti), mosquito powder exigua and silkworm egg also shows PiggyBac can Be well on swivel base, and the frequency of excision and swivel base is all higher.Research in silkworm starts from 1997, finds PiggyBac Transposons studies silkworm the transposition of silkworm, researcher followed by PiggyBac transposons. The further investigation of PiggyBac transposons will be for the genetic control based theoretical of pest.

The principle for the genome editing technique being commonly used is to generate DNA in genome specific site by artificial Double-strand break (Double-strand break, DSB), so that nonhomologous end company occurs for the DNA repair system induced in cell Connect (Nonhomologous end joining, NHEJ) and homologous recombination repair (Homologous recombination, HR).Pass through above-mentioned reparation approach, it is believed that the DNA double key breaking part of generation will realize that gene mutation, specific mutagenesis introduce and determine Point modification.Genome editor is divided into three classes, and wherein CRISPR/Cas9 technical costs is lower, and target spot shear efficiency is higher.

Vasa (also known as Vasa-like-gene, VLG) is a kind of RNA helicase that ATP is relied on, and is had extremely strong conservative Property, it is generally existing in animal, it plays a significant role in gonad development and reproduction.Vasa belongs to DEAD- in gene family Box gene family, the gene of the family generally include the RNA helicase that a variety of ATP- are relied on and the DNA helicase that ATP is relied on. The present inventionVasa geneIt is lepidopterous insectsVasa gene, preferred silkworm.The BmVasa base of silkwormBecause being research squama wing The reproduction of mesh insect, and the suitable material by insect sterile technique prevention and treatment lepidoptera pest.

In view of the teachings of the present invention and the prior art, those of ordinary skilled in the art can easily understand that, although reality of the invention The target sequence of the Vasa gene from silkworm is provided in example, but is derived from other insects of Lepidoptera, such as Asia Corn borer, bollworm have the Vasa gene target sequence of certain homology (conservative) with promoter of the present invention, are also included within In the scope of the present invention, as long as those skilled in the art can be convenient after having read the application according to information provided by the present application The isolated Vasa gene target sequence and its function is verified from other insects in ground.

Therefore, the present invention includes having with preferred Vasa gene target sequence 1 or 2 (SEQ ID NO:1 or 2) of the invention 50% or more (preferably 60% or more, 70% or more, 80% or more, more preferable 90% or more, more preferable 95% or more, it is optimal 98% or more is selected, such as 99%) nucleic acid of homology, the nucleic acid also have in CRISPR/Cas9 technology as target sequence Vasa gene is knocked out, to obtain the function of sterile mutant." homology " refers to according to the identical percentage in position, two or Similar level (i.e. sequence similarity or identity) between a plurality of nucleic acid.

In the present invention, BmVasa gene mutation target spot are as follows:

Target spot 1:GGTGGCCGAGGCGGAGGACGAGG；

Target spot 2:GGCACTGCTGTGCGCCATCAAGG.

(1) BmVasa gene knockout carrier:

BmVasa used in the present invention knocks out plasmid PXL-BacII-IE1-DsRed2-Real-U6- BmVasasgRNA1-U6-BmVasasgRNA2 is based on the PiggyBac transposons for being widely used in insecticidal transgenic research (Piggybac transposons see Fraser et al., Insect Moecular Biology, 1996)) it is transformed and is completed. It is as follows:

Imported in PiggyBac transposon vector first by IE1 promoter (Kojima et al, VirusResearch, 2008) the red fluorescent protein DsRed of driving, is configured to PXL-BacII-IE1-DsRed2 transgenosis Carrier.After being successfully transferred to this carrier, transgenic positive individual can be with whole body expression red fluorescence, convenient for screening from late embryogenesis. Two insertion U6 sequence-polyA sequences are then gradually inserted into PXL-BacII-IE1-DsRed2 plasmid, and (U6 is promoter sequence Column, polyA sequence are the polyadenylation sequence of the 3 ' end mRNA), wherein U6 sequence is polyA shown in SEQ ID NO:3 Sequence are as follows: " TTTTTT ".So far, PiggyBac transposon vector is transformed into plasmid PXL-BacII-IE1-DsRed2- Real-U6-U6。

Then, silkworm cDNA is obtained by silkworm sexual gland RNA reverse transcription, identifies primer using target spot using cDNA as template SiteF and SiteR obtains BmVasa gene cDNA fragment by PCR method.Sequencing, therefrom selects target sequence.Synthesis length is drawn Object BmVasa-sgRNA-1 and BmVasa-sgRNA-2, and respectively with the primer sgRNA-SalI-R with homology arm segment and SgRNA-NheI-R composition primer pair is closed using PXL-BacII-IE1-DsRed2-Real-U6-U6 plasmid as template by PCR At the BmVasasgRNA-1 segment and BmVasasgRNA-2 segment of the homology arm respectively with restriction enzyme SalI and NheI.

Finally, with restriction enzyme SaiI digestion PXL-BacII-IE1-DsRed2-Real-U6-U6 plasmid.It will be above-mentioned Digestion products are inserted into first U6 by the method for homologous recombination after mixing with the BmVasaRNA-1 segment with SalI homology arm and open Mover downstream, is sequenced, and after confirmation insertion is correct, obtains PXL-BacII-IE1-DsRed2-Real-U6- BmVasasgRNA1-U6 plasmid.Followed in turn by restriction enzyme NheI digestion PXL-BacII-IE1-DsRed2-Real-U6- BmVasasgRNA1-U6 plasmid passes through the side of homologous recombination after then mixing with the BmVasaRNA-2 segment with NheI homology arm Method is inserted into second U6 promoter downstream, pure using the Plasmid Midi kit kit of Qiagen company after sequencing is correct Change spare.It thus obtains BmVasa and knocks out plasmid PXL-BacII-IE1-DsRed2-Real-U6-BmVasasgRNA1- U6-BmVasasgRNA2。

(2) transgenic bombyx mori Vasa knocks out strain

In the present invention using can express Piggybac transposase PHA3PIG plasmid (referring to Tamura et al., Nature Biotechnology, 2000) auxiliary generates piggyBac transposon, and Vasa is knocked out matter by micro-injection method Grain PXL-BacII-IE1-DsRed2-Real-U6-BmVasasgRNA1-U6-BmVasasgRNA 2 and the mixing of PHA3PIG plasmid After be injected into the fresh ovum of wild type silkworm, specific method is referring to Kanda & Tamura (1991).It is sealed after injection with nontoxic glue To prevent pollution, then hatch in 25 DEG C of gnotobasis, and raise newly-hatched silkworm, after contemporary (G0 generation) selfing, the G1 generation of acquisition Newly-hatched silkworm filters out red fluorescence individual under fluorescence microscope.

Silkworm Nos-Cas9 is silkworm transgenosis activation strain.The lines transgenic silkworm whole body expression EGFG green is glimmering Light, and Cas9 albumen is expressed in sexual gland, it is the following parent silkworm for obtaining double fluorescence silkworms.According to document (Xu, J., Chen, S.,Zeng,B.,James,A.A.,Tan,A.and Huang,Y.(2017)Bombyx mori P-element Somatic Inhibitor(BmPSI)Is a Key Auxiliary Factor for Silkworm Male Sex Determination.PLoS Genet, 13, e1006576.) building.Imported in PiggyBac transposon vector first by The green fluorescent protein EGFP of IE1 promoter (Kojima et al, VirusResearch, 2008) driving, is configured to PXL- BacII-IE1-EGFP transgene carrier.Promoter, Cas9 gene and the SV40 terminator of silkworm Nos gene are then cloned respectively Sequence.PXL-BacII-IE1-EGFP transgene carrier is once inserted by methods of homologous recombination, to obtain PXL-BacII- IE1-EGFP-Nos-Cas9-SV40 transgenosis plasmid.Finally by microinjection wild type silkworm, transgenic bombyx mori product are obtained It is Nos-Cas9.Nos promoter sequence is referring to patent " the specifically expressed promoter of silkworm gonad and its catching method " (patent Application number 201610360601.2, Chen Rongmei etc., 2016).The sequence of Cas9 gene is as shown in SEQ ID NO:4.SV40 is terminated Subsequence is as shown in SEQ ID NO:5.It is sealed after injection with nontoxic glue to prevent pollution, is then incubated in 25 DEG C of gnotobasis Change, and raise newly-hatched silkworm, after contemporary (G0 generation) selfing, the G1 of acquisition filters out green fluorescence for newly-hatched silkworm under fluorescence microscope Body.

Then the G1 that screening obtains for green fluorescence individual feeding and is mated for red fluorescence individual and Nos-Cas9G1, The G2 of acquisition screens double fluorescence (glow green light again) newly-hatched silkworm, the double fluorescence silkworms pumpings of gained for newly-hatched silkworm under fluorescence microscope Genome identification target spot catastrophe is mentioned, and counts oviposition situation.

(3) detection of BmVasa mutant silkworm

The present invention has found BmVasa base by verifying double fluorescence silkworm BmVasa gene mutations and counting its situation of laying eggs Because mutation has substantial effect to silkworm Egg size and hatching rate.The identification of gene mutation situation are as follows: in newly-hatched silkworm phase picking Several double fluorescence silkworm extractings take genome, clone target spot segment by PCR method and are sequenced.The feelings that double fluorescence silkworms are laid eggs Condition can by separation of copulating moth after the not double fluorescence silkworms of a large amount of unisexuality mate 5 hours at 25 DEG C of environment temperature with wild type silkworm, with It lays eggs 36 hours in identical environment afterwards, counts egg laying amount.

The present invention has the advantages that the CRISPR/Cas9 technology based on piggyBac transposon is utilized successfully to construct for the first time The silkworm strain of height infertility under the premise of not influencing normal mating behavior.Obtained transgenosis BmVasa mutant man Silkworm strain mates with wild type in identical environment and any obstacle is not present, but egg-incubation of the mutant females as parent Rate only has 1% or so, and wherein male mutant is as the Hatching Rate of Silkworm Eggs of parent close to 0.In addition, the present invention makes obtaining for mutant It must be very easy to.The present invention has important value in terms of lepidoptera pest is prevented and treated by insect sterile technique.

The building of 1 carrier of embodiment

Plasmid PXL-BacII-IE1-DsRed2-Real-U6- is knocked out 1. cloning by PCR method and obtaining BmVasa BmVasasgRNA1-U6-BmVasasgRNA2.Specific steps:

I. using BmVasa-sgRNA-1, sgRNA-SalI-R as primer, with PXL-BacII-IE1-DsRed2-Real-U6- U6 plasmid is template, presses following system configurations PCR reaction system using KOD PLUS Taq enzyme (Bao Bio-Engineering Company), obtains BmVasasgRNA-1 segment.

Title	Dosage (μ l)
		10×Buffer	5
2mM dNTPs	5
		25mM MgSO4	2
BmVasa-sgRNA-1	1.5
		sgRNA-SalI-R	1.5
KOD-Plus	0.5
		PXL-BacII-IE1-DsRed2-Real-U6-U6 plasmid	100ng
Add deionized water extremely	50

The setting of PCR program are as follows:

PCR product uses spare after Gel Extraction Kit D2500 kits.

Likewise, using primer BmVasa-sgRNA-2, primer sgRNA-NheI-R and above-mentioned PCR purified product as template Obtain BmVasasgRNA-2 segment.

II. digestion PXL-BacII-IE1-DsRed2-Real-U6-U6 plasmid.Digestion system is as follows:

Digestion program: 37 DEG C, 1 hour.

Digestion products use the Plasmid Midi kit kits of Qiagen company.

III. BmVasasgRNA-1 and BmVasasgRNA-2 segment is inserted into using One Step Cloning Kit The downstream of the U6 promoter of PXL-BacII-IE1-DsRed2-Real-U6-U6.(for being inserted into BmVasasgRNA-1)

Reaction system is as follows:

Response procedures: 37 DEG C, 30min；Ice bath 5min.

IV. the recombinant plasmid obtained in III is converted, coated plate is bacterium colony PCR every other day.Reaction system is identical as I step.Sun Property monoclonal send sequencing, uses primer are as follows: sgRNA-F3421；sgRNA-R20.

V. sequencing result proves that the insertion of BmVasasgRNA-1 segment is correct.Use the Plasmid Midi of Qiagen company The kit kits plasmid.I, II, III, IV step are repeated using the plasmid, BmVasasgRNA-2 segment is inserted into, from And it obtains Vasa and knocks out plasmid PXL-BacII-IE1-DsRed2-Real-U6-BmVasasgRNA1-U6-BmVasasgRNA 2 (plasmid map is shown in Fig. 1), for then injecting.Repeat in I, II, III, IV step required primer or enzyme then are as follows: I step, BmVasa-sgRNA-2, sgRNA-SalI-R；II step, NheI restriction endonuclease (NEB company)；III step, sgRNA-F3421, sgRNA-R3667。

The acquisition and detection of 2 transgenic bombyx mori of embodiment

Vasa prepared by embodiment 1 knocks out plasmid PXL-BacII-IE1-DsRed2-Real-U6-BmVasasgRNA1- Silkworm just oviposition is injected into after U6-BmVasasgRNA2 and the plasmid PHA3PIG mixed in equal amounts that Piggybac transposase can be expressed In.Injecting method is to carry out microinjection according to method described in Kanda & Tamura (1991).It is sealed after injection with nontoxic glue To prevent pollution, then hatch in 25 DEG C of gnotobasis, and raise newly-hatched silkworm, after changing moth, contemporary (G0 generation) silkworm moth selfing obtains The G1 obtained filters out transgenic bombyx mori individual (the as BmVasa mutation with red fluorescence for newly-hatched silkworm under fluorescence microscope Intermediate strain).

By PXL-BacII-IE1-EGFP-Nos-Cas9-SV40 transgenosis plasmid and Piggybac transposase can be expressed It is injected into after plasmid PHA3PIG mixed in equal amounts in silkworm just oviposition.Injecting method is according to described in Kanda & Tamura (1991) Method carry out microinjection.It is sealed after injection with nontoxic glue to prevent pollution, is then hatched in 25 DEG C of gnotobasis, and raise Newly-hatched silkworm is supported, after changing moth, by contemporary (G0 generation) silkworm moth selfing, the G1 of acquisition is filtered out under fluorescence microscope with green for newly-hatched silkworm The transgenic bombyx mori individual of color fluorescence, as transgenic bombyx mori strain Nos-Cas9.

Obtained red fluorescence transgenic bombyx mori and green fluorescent transgenic silkworm rearing will then be screened and mated, obtained G2 double fluorescence (glow and green light) newly-hatched silkworm (as BmVasa mutant strain) is screened under fluorescence microscope for newly-hatched silkworm, The double fluorescence silkworms of gained extract genome identification target spot catastrophe, and count oviposition situation (referring to fig. 2).

The identification of gene mutation situation: newly-hatched silkworm phase picking 10 double fluorescence silkworms extract its genome, use primer SiteF Target spot segment is cloned by PCR method with SiteR and is sequenced.Sequencing result shows the intracorporal BmVasa gene of double fluorescence silkworms In, " target spot 1 " and " target spot 2 " sequence mutates.

The case where double fluorescence silkworms are laid eggs: by the not double fluorescence silkworms of 30 unisexuality and wild type silkworm in environment temperature 25 Separation of copulating moth after mating 5 hours at DEG C is then laid eggs 36 hours in identical environment, egg laying amount is counted, referring to Fig. 3 and table 1.As it can be seen that BmVasa generates the female silkworm of mutation (i.e. double fluorescence) and deformity generally occurs for the normal male produced ovum of silkworm, and hatching rate only has 1%；Male silkworm that BmVasa generates mutation (i.e. double fluorescence) and the normal female produced ovum of silkworm are there is no deformity, but hatching rate Close to 0%.Generated offspring's hatching in conclusion the silkworm that BmVasa generates mutation (i.e. double fluorescence) mates with normal silkworm Rate is average less than 1%.

The oviposition situation of table 1.

Specific embodiment described herein is only an example for the spirit of the invention.The neck of technology belonging to the present invention The technical staff in domain can make various modifications or additions to the described embodiments or replace by a similar method In generation, however, it does not deviate from the spirit of the invention or beyond the scope of the appended claims.

Sequence table

<110>Shanghai University

Shanghai Inst. of Life Science, CAS

<120>a kind of method and its nucleic acid constructs for preparing the male and female lepidopterous insects of height infertility

<150> 201810123478.1

<151> 2018-02-07

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

ggtggccgag gcggaggacg agg 23

<210> 2

<211> 23

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

ggcactgctg tgcgccatca agg 23

<210> 3

<211> 467

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

aggttatgta gtacacattg ttgtaaatca ctgaattgtt ttagatgatt ttaacaatta 60

gtacttatta atattaaata agtacatacc ttgagaattt aaaaatcgtc aactataagc 120

catacgaatt taagcttggt acttggctta tagataagga cagaataaga attgttaacg 180

tgtaagacaa ggtcagatag tcatagtgat tttgtcaaag taataacaga tggcgctgta 240

caaaccataa ctgttttcat ttgtttttat ggattttatt acaaattcta aaggttttat 300

tgttattatt taatttcgtt ttaattatat tatatatctt taatagaata tgttaagagt 360

ttttgctctt tttgaataat ctttgtaaag tcgagtgttg ttgtaaatca cgctttcaat 420

agtttagttt ttttaggtat atatacaaaa tatcgtgctc tacaagt 467

<210> 4

<211> 4140

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

atggacaaga agtactccat tgggctcgat atcggcacaa acagcgtcgg ctgggccgtc 60

attacggacg agtacaaggt gccgagcaaa aaattcaaag ttctgggcaa taccgatcgc 120

cacagcataa agaagaacct cattggcgcc ctcctgttcg actccgggga gacggccgaa 180

gccacgcggc tcaaaagaac agcacggcgc agatataccc gcagaaagaa tcggatctgc 240

tacctgcagg agatctttag taatgagatg gctaaggtgg atgactcttt cttccatagg 300

ctggaggagt cctttttggt ggaggaggat aaaaagcacg agcgccaccc aatctttggc 360

aatatcgtgg acgaggtggc gtaccatgaa aagtacccaa ccatatatca tctgaggaag 420

aagcttgtag acagtactga taaggctgac ttgcggttga tctatctcgc gctggcgcat 480

atgatcaaat ttcggggaca cttcctcatc gagggggacc tgaacccaga caacagcgat 540

gtcgacaaac tctttatcca actggttcag acttacaatc agcttttcga agagaacccg 600

atcaacgcat ccggagttga cgccaaagca atcctgagcg ctaggctgtc caaatcccgg 660

cggctcgaaa acctcatcgc acagctccct ggggagaaga agaacggcct gtttggtaat 720

cttatcgccc tgtcactcgg gctgaccccc aactttaaat ctaacttcga cctggccgaa 780

gatgccaagc ttcaactgag caaagacacc tacgatgatg atctcgacaa tctgctggcc 840

cagatcggcg accagtacgc agaccttttt ttggcggcaa agaacctgtc agacgccatt 900

ctgctgagtg atattctgcg agtgaacacg gagatcacca aagctccgct gagcgctagt 960

atgatcaagc gctatgatga gcaccaccaa gacttgactt tgctgaaggc ccttgtcaga 1020

cagcaactgc ctgagaagta caaggaaatt ttcttcgatc agtctaaaaa tggctacgcc 1080

ggatacattg acggcggagc aagccaggag gaattttaca aatttattaa gcccatcttg 1140

gaaaaaatgg acggcaccga ggagctgctg gtaaagctta acagagaaga tctgttgcgc 1200

aaacagcgca ctttcgacaa tggaagcatc ccccaccaga ttcacctggg cgaactgcac 1260

gctatcctca ggcggcaaga ggatttctac ccctttttga aagataacag ggaaaagatt 1320

gagaaaatcc tcacatttcg gataccctac tatgtaggcc ccctcgcccg gggaaattcc 1380

agattcgcgt ggatgactcg caaatcagaa gagaccatca ctccctggaa cttcgaggaa 1440

gtcgtggata agggggcctc tgcccagtcc ttcatcgaaa ggatgactaa ctttgataaa 1500

aatctgccta acgaaaaggt gcttcctaaa cactctctgc tgtacgagta cttcacagtt 1560

tataacgagc tcaccaaggt caaatacgtc acagaaggga tgagaaagcc agcattcctg 1620

tctggagagc agaagaaagc tatcgtggac ctcctcttca agacgaaccg gaaagttacc 1680

gtgaaacagc tcaaagaaga ctatttcaaa aagattgaat gtttcgactc tgttgaaatc 1740

agcggagtgg aggatcgctt caacgcatcc ctgggaacgt atcacgatct cctgaaaatc 1800

attaaagaca aggacttcct ggacaatgag gagaacgagg acattcttga ggacattgtc 1860

ctcaccctta cgttgtttga agatagggag atgattgaag aacgcttgaa aacttacgct 1920

catctcttcg acgacaaagt catgaaacag ctcaagaggc gccgatatac aggatggggg 1980

cggctgtcaa gaaaactgat caatgggatc cgagacaagc agagtggaaa gacaatcctg 2040

gattttctta agtccgatgg atttgccaac cggaacttca tgcagttgat ccatgatgac 2100

tctctcacct ttaaggagga catccagaaa gcacaagttt ctggccaggg ggacagtctt 2160

cacgagcaca tcgctaatct tgcaggtagc ccagctatca aaaagggaat actgcagacc 2220

gttaaggtcg tggatgaact cgtcaaagta atgggaaggc ataagcccga gaatatcgtt 2280

atcgagatgg cccgagagaa ccaaactacc cagaagggac agaagaacag tagggaaagg 2340

atgaagagga ttgaagaggg tataaaagaa ctggggtccc aaatccttaa ggaacaccca 2400

gttgaaaaca cccagcttca gaatgagaag ctctacctgt actacctgca gaacggcagg 2460

gacatgtacg tggatcagga actggacatc aatcggctct ccgactacga cgtggatcat 2520

atcgtgcccc agtcttttct caaagatgat tctattgata ataaagtgtt gacaagatcc 2580

gataaaaata gagggaagag tgataacgtc ccctcagaag aagttgtcaa gaaaatgaaa 2640

aattattggc ggcagctgct gaacgccaaa ctgatcacac aacggaagtt cgataatctg 2700

actaaggctg aacgaggtgg cctgtctgag ttggataaag ccggcttcat caaaaggcag 2760

cttgttgaga cacgccagat caccaagcac gtggcccaaa ttctcgattc acgcatgaac 2820

accaagtacg atgaaaatga caaactgatt cgagaggtga aagttattac tctgaagtct 2880

aagctggtct cagatttcag aaaggacttt cagttttata aggtgagaga gatcaacaat 2940

taccaccatg cgcatgatgc ctacctgaat gcagtggtag gcactgcact tatcaaaaaa 3000

tatcccaagc ttgaatctga atttgtttac ggagactata aagtgtacga tgttaggaaa 3060

atgatcgcaa agtctgagca ggaaataggc aaggccaccg ctaagtactt cttttacagc 3120

aatattatga attttttcaa gaccgagatt acactggcca atggagagat tcggaagcga 3180

ccacttatcg aaacaaacgg agaaacagga gaaatcgtgt gggacaaggg tagggatttc 3240

gcgacagtcc ggaaggtcct gtccatgccg caggtgaaca tcgttaaaaa gaccgaagta 3300

cagaccggag gcttctccaa ggaaagtatc ctcccgaaaa ggaacagcga caagctgatc 3360

gcacgcaaaa aagattggga ccccaagaaa tacggcggat tcgattctcc tacagtcgct 3420

tacagtgtac tggttgtggc caaagtggag aaagggaagt ctaaaaaact caaaagcgtc 3480

aaggaactgc tgggcatcac aatcatggag cgatcaagct tcgaaaaaaa ccccatcgac 3540

tttctcgagg cgaaaggata taaagaggtc aaaaaagacc tcatcattaa gcttcccaag 3600

tactctctct ttgagcttga aaacggccgg aaacgaatgc tcgctagtgc gggcgagctg 3660

cagaaaggta acgagctggc actgccctct aaatacgtta atttcttgta tctggccagc 3720

cactatgaaa agctcaaagg gtctcccgaa gataatgagc agaagcagct gttcgtggaa 3780

caacacaaac actaccttga tgagatcatc gagcaaataa gcgaattctc caaaagagtg 3840

atcctcgccg acgctaacct cgataaggtg ctttctgctt acaataagca cagggataag 3900

cccatcaggg agcaggcaga aaacattatc cacttgttta ctctgaccaa cttgggcgcg 3960

cctgcagcct tcaagtactt cgacaccacc atagacagaa agcggtacac ctctacaaag 4020

gaggtcctgg acgccacact gattcatcag tcaattacgg ggctctatga aacaagaatc 4080

gacctctctc agctcggtgg agacagcagg gctgacccca agaagaagag gaaggtgtga 4140

<210> 5

<211> 231

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

gactctagat cataatcagc cataccacat ttgtagaggt tttacttgct ttaaaaaacc 60

tcccacacct ccccctgaac ctgaaacata aaatgaatgc aattgttgtt gttaacttgt 120

ttattgcagc ttataatggt tacaaataaa gcaatagcat cacaaatttc acaaataaag 180

catttttttc actgcattct agttgtggtt tgtccaaact catcaatgta t 231

Claims (10)

1. a kind of method for the lepidopterous insects for preparing male and female height infertility, which comprises the following steps:

1) Vasa gene knockout nucleic acid constructs is constructed comprising the element that the following operability from 5 ' ends to 3 ' ends connects: First sgRNA Expression element and the 2nd sgRNA Expression element；The first sgRNA Expression element includes from 5 ' ends to 3 ' ends Following operability connection element: U6 promoter, the first Vasa gene target and polyA；The 2nd sgRNA expression Element include from 5 ' end to 3 ' end following operability connect element: U6 promoter, the 2nd Vasa gene target and polyA；

2) by Vasa gene knockout nucleic acid constructs described in step 1) and the PHA3PIG plasmid that Piggybac transposase can be expressed The fresh insect ovum of corotation Lepidoptera, hatching change moth, obtain G0 generation, make G0 generation selfing, obtain G1 generation；With

3) in the generation of G1 described in step 2), mate with the transgenosis lepidopterous insects of expression Cas9 albumen, the G2 of acquisition for get The lepidopterous insects of male and female height infertility.

2. method as described in claim 1, which is characterized in that the nucleotide sequence such as SEQ of the first Vasa gene target Shown in ID NO:1, the nucleotide sequence of the 2nd Vasa gene target is as shown in SEQ ID NO:2.

3. method as described in claim 1, which is characterized in that the Vasa gene knockout nucleic acid constructs further includes the first sieve Select marker gene expression cassette.

4. method as claimed in claim 3, which is characterized in that first riddled basins are red fluorescent protein bases Cause.

5. method as described in claim 1, which is characterized in that the transgenosis lepidopterous insects of the expression Cas9 albumen contain Cas9 expression casette, the Cas9 expression casette include the element that the following operability from 5 ' ends to 3 ' ends connects: Nos promoter, Cas9 albumen coded sequence and SV40 terminator.

6. method as claimed in claim 5, which is characterized in that the transgenosis lepidopterous insects of the expression Cas9 albumen also wrap Include the second riddled basins expression cassette.

7. method as described in claim 1, which is characterized in that the corotation is by the Vasa gene knockout nucleic acid constructs The resulting fresh insect ovum of mixed liquor microinjection after being mixed with the PHA3PIG plasmid that can express Piggybac transposase.

8. method as described in claim 1, which is characterized in that the lepidopterous insects are silkworms.

9. a kind of Vasa gene knockout nucleic acid constructs, which is characterized in that it includes the following operability from 5 ' ends to 3 ' ends The element of connection: the first sgRNA Expression element and the 2nd sgRNA Expression element；The first sgRNA Expression element include from The element of the following operability connection at 5 ' ends to 3 ' ends: U6 promoter, the first Vasa gene target and polyA；Described Two sgRNA Expression elements include the element that the following operability from 5 ' ends to 3 ' ends connects: U6 promoter, the 2nd Vasa gene Target spot and polyA.

10. a kind of method for preventing and treating lepidoptera pest, which comprises the following steps: will be square as described in claim 1 The lepidopterous insects field of male and female height infertility obtained by method preparation is freeed, and by mating with wild lepidopterous insects, makes offspring It reduces, reduces population quantity.