CN110499376B

CN110499376B - Composition, kit and method for detecting mycoplasma bovis by taking LppA gene as detection target

Info

Publication number: CN110499376B
Application number: CN201910847999.6A
Authority: CN
Inventors: 李敏; 郝秀静; 韩杨; 马春骥; 王玉炯
Original assignee: Ningxia University
Current assignee: Ningxia University
Priority date: 2019-09-09
Filing date: 2019-09-09
Publication date: 2023-07-25
Anticipated expiration: 2039-09-09
Also published as: CN110499376A

Abstract

The invention discloses a composition, a kit and a method for detecting mycoplasma bovis by taking an LppA gene as a detection target. The detection target of the composition is LppA gene of mycoplasma bovis, and can be aimed at various different fragments in the gene, and experiments prove that the composition can be designed into various different specific combination situations so as to be applied to various amplification methods such as traditional PCR, basic RPA, nfo RPA, exo-RPA and the like, and experimental results can be observed by means of agarose gel electrophoresis, a flow measurement chromatography test strip and a constant temperature fluorescence amplification instrument. The combination group of the invention can achieve the conservation in mycoplasma bovis standard strains and wild strains and the specificity between mycoplasma bovis and other pathogenic bacteria. The composition based on the invention can establish a rapid detection method of mycoplasma bovis with good specificity, high sensitivity and stable repeatability, and has the advantages of simple operation, convenience, time saving and no need of large-scale experimental instruments and equipment.

Description

Composition, kit and method for detecting mycoplasma bovis by taking LppA gene as detection target

Technical Field

The invention relates to the technical field of molecular biology, in particular to a composition, a kit and a method for detecting mycoplasma bovis by taking LppA genes as detection targets.

Background

Mycoplasma bovis (m.bovis), belonging to the kingdom of prokaryotes, phylum firmicutes, class mollicutes, order Mycoplasma, family Mycoplasma, genus Mycoplasma, is a pathogen that primarily infects the respiratory tract of cattle and is capable of continuously infecting the host, causing a variety of chronic diseases including bovine pneumonia, such as mastitis, otitis media, reproductive disorders, arthritis, meningitis, and keratoconjunctivitis, etc., which are often referred to as Mycoplasma bovis-associated diseases (Mycoplasma bovis associated disease, mbAD).

Current methods for detecting mycoplasma bovis generally include the following. The culture method is a direct evidence for the detection of the presence of pathogens and is a gold standard for the detection of m. Once detected, diagnosis can be confirmed. The method can be classified into a general solid culture method and a rapid culture method. However, because M.bovis grows slowly, the first separation from clinical samples generally needs 2-4 generations of blind transmission to see colonies on a solid medium through a microscope, and detection results can be obtained only by a few days, so that the detection rate is low, and the defects of excessive time consumption, complex intermediate links, high requirements on culture conditions and the like exist, so that certain difficulty is brought to the clinical separation of M.bovis, and the method is not suitable for clinical rapid diagnosis. The serological detection technology has the advantages of higher specificity, better sensitivity, rapidness, easiness in operation and the like, is very suitable for rapid examination of clinical samples and large-scale epidemiological investigation, but most mycoplasma have common antigens, and are easy to cause false positive experimental results. The immunohistochemical technology is a technology combining histology and immunology, and is characterized in that in situ of tissue cells, the corresponding antigen or antibody is positioned, qualitatively and quantitatively detected by means of visible markers through antigen-antibody specific binding reaction and histochemical chromogenic reaction, but when the disease is not serious or the deviation of a selected focus part is large, the existence of M.bovis is difficult to detect by immunohistochemistry. Among the numerous detection methods, the polymerase chain reaction is a simple and effective detection method. The PCR method has the advantages of rapid detection, high specificity and sensitivity, no living body of a detection sample, no influence of the immune function, the course of disease, the infection degree, the presence or absence of drug treatment and the lack of reaching the serum detection level of a patient, and the early diagnosis and the correct selection of antibiotics are possible. Has positive significance for early and non-antibody-producing patients and infected patients with disappeared antibodies; is helpful for early diagnosis and timely treatment, has no cross reaction and radioactive pollution, and is easy to standardize. Although the PCR method is rapid in detection, and can replace a culture method in a certain sense, the high sensitivity of the PCR method also makes the requirements of the PCR method on experimental environments and instruments relatively high, and the PCR method has the problems of high requirements on technical conditions, complex operation and difficult popularization, is difficult to develop in a basic laboratory, and has relatively high price.

Disclosure of Invention

In order to solve at least part of the technical problems in the prior art, the invention provides a composition, a kit and a method for rapidly and specifically detecting mycoplasma bovis. Specifically, the present invention includes the following:

in a first aspect of the invention, there is provided a composition for detecting mycoplasma bovis comprising a first oligonucleotide capable of hybridising to the LppA gene of mycoplasma bovis, a second oligonucleotide and a buffer to solubilize the first and second oligonucleotides.

There is little research on LppA proteins or genes thereof, and current research focuses on functions of proteins or structures thereof, e.g., secondary structures of protein molecules, hydrophilic regions, and antigen indexes. Unlike the studies focused so far, the present invention found that the LppA gene in Mycoplasma bovis has intra-species conservation and inter-species specificity, thereby allowing detection of Mycoplasma bovis with high specificity and sensitivity. The LppA gene of the invention has a sequence shown as SEQ ID No. 1.

In the present invention, the length of the first oligonucleotide is generally 35 to 45nt, preferably 35 to 40nt. In the present invention, the length of the second oligonucleotide is generally 35 to 50nt, preferably 35 to 45nt. In certain embodiments, the 5' end of the second oligonucleotide is free of any modification. In a further embodiment, the 5' end of the second oligonucleotide of the invention is provided with a Biotin tag. Preferably, the 5' end of the second oligonucleotide carries a Biotin tag. Preferably, the invention also includes a third oligonucleotide, which is typically 40 to 55nt, preferably 40 to 50nt in length. The 5' end of the third oligonucleotide carries a detection label, such as a FAM fluorophore. The third oligonucleotide carries a terminating phosphate group at the 3' end. Preferably, the third oligonucleotide has a THF cleavage site in the middle of its sequence.

In the present invention, the first oligonucleotide is capable of selectively hybridizing to a first region of the 5 'end of the LppA gene and the second oligonucleotide is capable of selectively hybridizing to a second region of the 3' end of the LppA gene. In certain embodiments, the invention further comprises a third oligonucleotide capable of selectively hybridizing to a third region of the LppA gene. The first region is located on the 5 'end side of the LppA gene and the second region is located on the 3' end side of the LppA gene. Wherein the closest distance between the first region and the second region is between 50bp and 2000bp, preferably 70 to 1000bp, more preferably 100 to 500bp, for example 100 to 200bp. Here, the nearest distance refers to the distance between the last base at the 3 '-end of the first region and the first base at the 5' -end of the second region. The third region is located between the first region and the second region. Here, there is preferably no overlap between the third region and the first region or the second region.

In certain embodiments, the compositions of the invention comprise a first oligonucleotide, a second oligonucleotide and a third oligonucleotide, wherein the sequence of the first oligonucleotide is shown in SEQ ID No.2, the sequence of the second oligonucleotide is shown in SEQ ID No.3, the sequence of the third nucleotide is shown in SEQ ID No.4, and has FAM at the 5 'end, terminating phosphate at the 3' end and idSp between bases 31-32.

In certain embodiments, the compositions of the invention comprise a first oligonucleotide and a second oligonucleotide, wherein the sequence of the first oligonucleotide is shown in SEQ ID No.5 and the sequence of the second oligonucleotide is shown in SEQ ID No. 6.

The term "5' -terminal side" as used herein refers to a region near the 5' -end of the LppA gene, and this region may be from the first nucleotide at the 5' -end or from a nucleotide further downstream from the 5' -end, and does not refer to the 5' -end of the LppA gene alone. Similarly, the "3' -terminal side" has a similar meaning.

In a second aspect of the invention there is provided a kit for detecting mycoplasma bovis comprising the composition of the first aspect of the invention. As described above, the composition has been described in detail, and will not be described in detail herein. Other parts of the kit of the invention are described below.

In a third aspect of the invention, there is provided a method for detecting mycoplasma bovis comprising the steps of:

(1) Providing a template of a biological sample derived from a bovine;

(2) The template and the composition form a reaction system, and the reaction is carried out for 5 to 20 minutes at the temperature of between 34 and 42 ℃ to obtain an amplification product;

(3) Detecting the amplified product.

In the present invention, detecting the amplification product may include subjecting the amplification product to agarose gel electrophoresis. In certain embodiments, detecting the amplification product comprises contacting the amplification product with a labeled flow-through chromatographic test strip, determining that the biological sample is a positive sample when red is displayed at both the detection line and the quality control line, determining that the biological sample is a negative sample when red is displayed at the quality control line and the detection line is not colored, and determining that the test strip is invalid when the quality control line is not displaying red.

The biological sample of the present invention refers to body fluids or secretions derived from the cattle to be tested. Preferably, the biological sample is derived from a cow suffering from a related disease. Examples of body fluids include, but are not limited to, cyst fluid, nasal and joint fluids, milk, and the like. The biological sample of the invention is bovine nasal fluid or joint fluid. The template substance may be DNA or RNA. #

The method of the invention may be a PCR-based method. And may be different from a general PCR reaction. The process of the invention comprises the step of maintaining the reaction system at a constant temperature and the reaction temperature is low, generally at a temperature of 34℃to 42℃and for a reaction time of only 5 to 20 minutes, preferably 8 to 15 minutes. In a most preferred embodiment, the reaction temperature of the present invention is 39℃and the reaction time is 10 minutes.

In an exemplary embodiment, the reaction system of the present invention (excluding the template) includes:

it is known in the art that mycoplasma bovis and mycoplasma agalactiae exhibit great similarity in the 16S rRNA conventionally used to distinguish between different species or strains, even the membrane surface lipoprotein family genes associated with mycoplasma pathogenesis, or even in the whole genome sequence of both. This presents a great challenge for the specific detection of mycoplasma bovis. The invention discovers that the LppA gene related to antigenicity conventionally, in particular a specific region thereof, can be used for designing a primer target region of a recombinant polymerization amplification reaction through analysis and screening of a large amount of data.

The composition of the invention can specifically detect M.bovis in streptococcus pneumoniae, klebsiella and pseudomonas aeruginosa, and can detect not only M.bovis standard strain PG45 but also M.bovis wild strain ltb and WWM. When these compositions are used for detection of mycoplasma bovis, it is possible to achieve conservation in mycoplasma bovis species and specificity between mycoplasma bovis and other pathogenic species, based on this finding, the present invention devised oligonucleotide sequences for recombinant polymerization amplification reactions directed against specific regions of the gene.

In a preferred embodiment, the invention optimizes the reaction system, obtains the optimal reaction time and the optimal reaction temperature, greatly improves the specificity, sensitivity, repeatability and stability of detection, and establishes an M.bovis rapid detection method which has good specificity, high sensitivity and can be stably and repeatedly.

In addition, the method is simple to operate, convenient and time-saving when the established scheme is used for detecting the M.bovis, large-scale experimental instrument equipment is not needed, and the method is very suitable for rapid detection in the field or on site without any experimental foundation and is worthy of popularization and use.

In summary, the detection target of the composition of the invention is the LppA gene of mycoplasma bovis, and can be directed against various fragments in the gene, and experiments prove that the composition of the invention can be designed into various specific combination situations to be applied to various amplification methods such as traditional PCR, basic RPA, nfo RPA, exo RPA and the like, and in addition, experimental results can be observed by means of agarose gel electrophoresis, a flow chromatography test strip and a constant temperature fluorescence amplification instrument. The combination group of the invention can achieve the conservation in mycoplasma bovis standard strains and wild strains and the specificity between mycoplasma bovis and other pathogenic bacteria. The composition based on the invention can establish a rapid detection method of mycoplasma bovis with good specificity, high sensitivity and stable repeatability, and has the advantages of simple operation, convenience, time saving and no need of large-scale experimental instruments and equipment.

Drawings

Fig. 1: and (3) a first amplification reaction detection result diagram of the mycoplasma bovis marker gene LppA. M: molecular mass standard 1: mycoplasma bovis Standard strain PG45 2: mycoplasma bovis wild strain Ltb 3: mycoplasma bovis wild strain WWM 4: mycoplasma ovipneumoniae standard strain Y98 5: mycoplasma agalactiae standard strain PG2 6: standard strain PG 37 of the mycoplasma caprae subspecies of the filamentous species: mycoplasma caprae subspecies caprae pneumonitis standard strain F38 8: pasteurella 9: staphylococcus aureus 10: klebsiella 11: streptococcus pneumoniae 12: serratia spp.13: salmonella 14: coli 15: pseudomonas aeruginosa 16: no template control.

Fig. 2: schematic view of the observation of the time reaction gradient results of the second amplification reaction for the LppA gene. M: molecular mass standard; 1:0min;2:5min;3: for 10min;4:15min;5:20min;6:25min;7:30min;8:35min;9: for 40min;10:45min; c: no template control.

Fig. 3: schematic diagram of observation of temperature reaction gradient results of the second amplification reaction for the LppA gene. M: a DNA molecular mass standard; 1:34 ℃;2:35 ℃;3:36 ℃;4:37 ℃;5:38 ℃;6:39 ℃;7:40 ℃;8:41 ℃;9:42 ℃; c: no template control.

Fig. 4: schematic view of observation of specific reaction results of the second amplification reaction against the LppA gene. M: molecular mass standard 1: mycoplasma bovis Standard strain PG45 2: mycoplasma bovis wild strain Ltb 3: mycoplasma bovis wild strain WWM 4: mycoplasma ovipneumoniae standard strain Y98 5: mycoplasma agalactiae standard strain PG2 6: standard strain PG 37 of the mycoplasma caprae subspecies of the filamentous species: mycoplasma caprae subspecies caprae pneumonitis standard strain F38 8: pasteurella 9: staphylococcus aureus 10: klebsiella 11: streptococcus pneumoniae 12: serratia spp.13: salmonella 14: coli 15: pseudomonas aeruginosa 16: no template control.

Fig. 5: schematic observations of the sensitive reaction results of the second amplification reaction against the LppA gene. M: a DNA molecular mass standard; 1: 6X 10 ¹⁰ ；2：6×10 ⁹ ；3：6×10 ⁸ ；4：6×10 ⁷ ；5：6×10 ⁶ ；6：6×10 ⁵ ；7：6×10 ⁴ ；8：6×10 ³ ；9：6×10 ² ；10：6×10 ¹ ；10：6×10 ⁰ The method comprises the steps of carrying out a first treatment on the surface of the C: no template control.

Fig. 6: schematic observation of the in-batch reproducibility of the second amplification reaction for the LppA gene.

Fig. 7: schematic of the observation of the results of the batch-to-batch reproducibility of the second amplification reaction for the LppA gene.

Fig. 8: schematic view of the third amplification reaction results for the LppA gene.

Fig. 9: schematic view of the observation of the time reaction gradient results of the third amplification reaction for the LppA gene.

Fig. 10: schematic diagram of observation of temperature reaction gradient results of the third amplification reaction for the LppA gene.

Fig. 11: schematic view of observation of specific reaction results of the third amplification reaction against the LppA gene.

Fig. 12: schematic observations of the result of the sensitive reaction against the third amplification reaction of the LppA gene.

Fig. 13: schematic observation of the results of the in-batch reproducibility of the third amplification reaction for the LppA gene.

Fig. 14: schematic of the observation of the results of the batch-to-batch reproducibility of the third amplification reaction for the LppA gene.

Fig. 15: a graph of the fluorescence detection result of the fourth amplification reaction against the LppA gene. In fig. 15, tube1: is mycoplasma bovis standard strain PG45 tube2: mycoplasma bovis wild strain Ltb tube3: mycoplasma bovis wild strain WWM tube4: mycoplasma ovipneumoniae standard strain Y98 tube5: mycoplasma agalactiae standard strain PG2 tube6: mycoplasma filiform goat subspecies standard strain PG3 tube7: mycoplasma caprae the subspecies caprae pneumonitis standard strain F38 tube8: pasteurella tube9: staphylococcus aureus tube10: klebsiella tube11: streptococcus pneumoniae tube12: serratia spp.tube 13: salmonella tube14: coli tube 15: pseudomonas aeruginosa tube 16: no template control. In the curves of FIG. 15, the top three curves are tube1, tube2 and tube3 in order from top to bottom.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in the present invention, it is understood that the upper and lower limits of the ranges and each intermediate value therebetween are specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control. Unless otherwise indicated, "%" is percent by weight.

Since M.bovis has high homology with Mycoplasma agalactiae, the similarity of 16S rRNA of the M.bovis and Mycoplasma agalactiae can reach 96%, so that searching other marker genes is very important for the specific detection of M.bovis. The invention not only considers the conservation or homology of the gene when selecting the marker gene, but also discovers that the design of the oligonucleotide aiming at the LppA gene, especially the specific region in the LppA gene, can rapidly and specifically detect M.bovis.

In addition, it was also found that the primers of the recombinant polymerization amplification reaction thus obtained can also be used for conventional PCR reactions, and have excellent amplification results. This is in contrast to the primers known in the art which are designed for different conserved genes, which are either general PCR primers or conventional primers for LAMP. None of these primers is used in the recombinant polymerization reaction at room temperature, which is completely different.

Example 1

This example is a detection system for the first amplification reaction of the specific gene LppA, i.e.the detection of the specific gene by the polymerase chain reaction. The method specifically comprises the following steps:

(1) The detection system of the first amplification reaction of the present invention:

(2) PCR reaction conditions:

wherein:

Lppa F:ACTCTTCAGAAATAACAGACACTTCATC(SEQ ID No.5)；

Lppa R:GAGTTGTCTGCATTAGTTGCGTAATC(SEQ ID No.6)。

(3) Detection result: after the reaction, 5. Mu.L of the reaction product was collected and detected by agarose gel (1.5%) electrophoresis, and the detection results are shown in FIG. 1.

Example 2

This example is a detection system for a second amplification reaction of a specific gene LppA, i.e.a basic (basic) RPA detection system. The method specifically comprises the following steps:

(1) The detection system of the invention is constructed by:

Lppa F:ACTCTTCAGAAATAACAGACACTTCATC(SEQ ID No.5)；

Lppa R:GAGTTGTCTGCATTAGTTGCGTAATC(SEQ ID No.6)。

mixing the reaction liquid, adding 1 mu L of template to be detected and 1.25 mu L of MgoAC, swirling, briefly centrifuging, and placing the reaction liquid into a water bath kettle at 39 ℃ for reaction for 20min. And (3) result detection: after the reaction, 5. Mu.L of the reaction product was collected and detected by agarose gel (1.5%) electrophoresis.

(2) Exploration of optimal reaction time

After a reaction system is established, the optimal reaction time is explored by setting a time gradient reaction for 0-45 min, the amplification product can be generated after the reaction is found to be started for 5min, a visible detection result can be formed after 10min, the reaction is gradually stabilized after 15min, and 20min is set as the optimal reaction time for more stable reaction. The detection results are shown in FIG. 2.

(3) Exploration of optimal reaction temperature

The reaction temperature gradient of 34-42 ℃ is set by taking 20min as the optimal reaction time, the reaction can be found in 34-42 ℃, the detection result of the temperature gradient is shown in figure 3, the specific amplified bands are generated in 34-42 ℃, the bands are brighter, and the optimal reaction temperature is selected at 39 ℃.

(4) Specificity of the assay

The specificity of the reaction of the present invention was examined with an optimal reaction time of 10min and an optimal reaction temperature of 39℃as shown in FIG. 4. As shown in FIG. 4, only the M.bovis standard strain PG45, the wild type strains Ltb and WWM were detected, and the remaining pathogenic bacteria were not detected.

(5) Sensitivity of detection

On the premise of good specificity, cloning the target fragment of LppA gene, calculating the copy number of the target fragment, and carrying out 10-time gradient dilution to find that the minimum detectable amount is 6 multiplied by 10 ¹ Far higher than PCR method6×10 of (2) ³ The detection results are shown in FIG. 5.

(6) Stability of detection

After exploring the specificity and sensitivity of the reaction, the stability of the reaction was examined. Therefore, 6×10 is selected ⁷ 、6×10 ⁶ 、6×10 ⁵ Three positive plasmid standard substances with different concentrations are repeated three times under the same condition, the repeated effect in the batch is observed, and the detection result of the stability in the batch is shown in figure 6; the above 3 positive plasmid standards with different concentrations were taken and repeated three times in the same experiment to observe the repeated effect between batches, and the results of the batch stability experiment are shown in fig. 6.

After the method is established, 53 clinical samples of 5 pastures in the I area are detected, 17 positive samples are detected by using a second amplification system, and compared with the clinical samples by using a traditional molecular biological detection method PCR, the detection coincidence rate is as high as 96%. The second amplification system established in this experiment was shown to be effective.

Example 3

This example is a system based on a third amplification reaction of the specific gene LppA, nfo RPA.

The method comprises the following steps:

(1) The detection system of the invention is constructed by:

first detection system:

among them, primer free Rehydration buffer is a known commercially available product.

The base mixture contains all the enzymes and reagents necessary for the reaction, with the addition of templates and corresponding oligonucleotides. Before the reaction, for example, 1.25. Mu.l of magnesium acetate (MgOAc) at a concentration of 280mM is added to the mixture system to initiate the reaction. The amplified product is obtained after the reaction, and the product can be detected by using a flow-measuring chromatographic test strip with a mark. When the detection product is combined with the test strip, the positive sample can display red at the detection line and the quality control line, while the negative sample can only display red at the command line, and when the quality control line does not display red, the test strip is proved to be invalid, so that the detection result is invalid. The test paper detection result is shown in fig. 8.

(2) Exploration of optimal reaction time

The LppA gene is selected to carry out the following experimental conditions of recombinant polymerization amplification, the following oligonucleotides are designed to carry out the recombinant polymerization amplification reaction, and thus a method for rapidly detecting M.bovis is established, and the specific experimental process is as follows:

the sequence of LppA F is as follows:

GAAAACATATGATTCATTATGCTAGACACACTTTAAA (comprising SEQ ID No. 2)

The sequence of LppA R is as follows:

(Biotin) TAGTAAGCGAGCCGTAAAACGGATAAACTATAGCTTTG (comprising SEQ ID No. 3)

The sequence of LppA P is as follows:

(FAM) CAAGCATAAATAATCCAAATAAGCTACGTTT/idSp/GTCAGGTATTTGTTTAC (P) (comprising SEQ ID No. 4).

The reaction system:

mixing the reaction liquid, adding into a reaction tube, fully mixing, adding 1 mu L of template to be detected and 1.25 mu L of MgOAC, swirling, briefly centrifuging, placing into a water bath kettle at 39 ℃, and reacting for 10min. After the reaction is finished, 2 mu L of reaction solution and 100 mu L of detection buffer solution are taken and fully and uniformly mixed in a sterile 1.5mL centrifuge tube, and a flow measurement chromatography test strip is inserted into the mixed solution, so that the reaction result can be observed.

After a reaction system is established, the optimal reaction time is explored by setting a time gradient reaction for 0-45 min, and a macroscopic detection result can be generated after the reaction is found for 5min, so that the reaction is more stable, and the optimal reaction time is set to be10 min. The detection results are shown in FIG. 9.

(3) Exploration of optimal reaction temperature

The reaction temperature gradient of 34-42 ℃ is set by taking 10min as the optimal reaction time, and the reaction can be carried out at 34-42 ℃ as shown in a detection result shown in figure 10, so that the reaction can be carried out at normal temperature. As a result, the detection line was dark red at 39℃and therefore the optimum reaction temperature was selected at 39 ℃.

(4) Specificity of the assay

The specificity of the reaction of the present invention was examined with 10min as the optimal reaction time and 39℃as the optimal reaction temperature, and the results of the examination are shown in FIG. 11, which shows that only M.bovis standard strain PG45 and wild strains Ltb and WWM, but not the remaining pathogenic bacteria, were examined as in the case of PCR.

(5) Sensitivity of detection

On the premise of good specificity, the target fragment of LppA gene is cloned, the copy number is calculated, and 10-time gradient dilution is carried out, so that the minimum detectable limit of the reaction of the invention is 3 multiplied by 10 ¹ The detection results are shown in FIG. 12.

(6) Stability of detection

After exploring the specificity and sensitivity of the reaction, the stability of the reaction was examined. Therefore, 3×10 is selected ⁷ 、3×10 ⁶ 、3×10 ⁵ Three positive plasmid standard substances with different concentrations are repeated three times under the same condition, the repeated effect in the batch is observed, and the detection result of the stability in the batch is shown in figure 13; the above 3 positive plasmid standards with different concentrations were repeated three times in the same experiment, and the repeated effect between batches was observed, and the results of the batch stability experiment are shown in fig. 14.

After the method is established, 53 clinical samples of 5 pastures in the I area are detected, 22 positive samples detected by the third amplification system are found, the clinical samples are detected by a traditional molecular biological detection method, and the coincidence rate of the detection result and the PCR detection result is found to be 94%.

Example 4

This example is a system based on a fourth amplification reaction of the specific gene LppA, exo-RPA.

The method comprises the following steps:

(1) The detection system of the invention is constructed by:

first detection system:

The base mixture contains all the enzymes and reagents necessary for the reaction, and only 1. Mu.L of template and corresponding oligonucleotides are added thereto. Before the reaction, for example, 1.25. Mu.l of magnesium acetate (MgOAc) at a concentration of 280mM is added to the mixture system to initiate the reaction. The reaction result is carried out in a constant temperature fluorescence amplification instrument, and the reaction can be detected in real time.

Specifically, the sequence of the first oligonucleotide LppA F of this example is the same as Lppa F of example 1: ACTCTTCAGAAATA ACAGACACTTCATC (SEQ ID No. 5).

The second oligonucleotide sequence LppA R of this example is identical to Lppa R of example 1: GAGTTGTCTGCATTAGTTGCGTAATC (SEQ ID No. 6).

The third oligonucleotide sequence LppA P of this example is shown below: TACCTAGAGAAATATTGGGTTTATATCCCTCA/i6FAMdT/T/idSp/A/iBHQ1dT/AGGAAGTACAATTCTT (comprising SEQ ID No.7 and having a modifying group i6FAMdT/T/idSp/A/iBHQ1dT between 33 and 34).

In one exemplary reaction system, it comprises:

mixing the reaction liquid, adding the mixture into a reaction tube, fully mixing, adding 1 mu L of template to be detected and 1.25 mu L of MgOAC, swirling, briefly centrifuging, and placing into a constant temperature fluorescence amplification instrument for reaction for 15min. The computer can be connected to observe the reaction result in real time. As shown in FIG. 15, only Mycoplasma bovis standard strain PG45, wild strain LTb and wild strain WWM were amplified.

The invention searches the optimal reaction time and the optimal reaction temperature, the specificity, the sensitivity, the repeatability and the stability of detection by designing the specific primer and the probe of the recombination, polymerization and amplification reaction of the specific gene LppA, finds the optimal reaction condition, and establishes the M.bovis rapid detection method which has good specificity, high sensitivity and can stably and repeatedly. The method for detecting the M.bovis is simple to operate, convenient and time-saving, does not need large-scale experimental instrument equipment, is very suitable for personnel operation without any experimental foundation, and is worthy of popularization and use.

While the invention has been described with reference to exemplary embodiments, it is to be understood that the invention is not limited to the disclosed exemplary embodiments. Various modifications or changes may be made to the exemplary embodiments of the present description without departing from the scope or spirit of the invention. The scope of the following claims is to be accorded the broadest interpretation so as to encompass all such modifications and equivalent structures and functions.

Sequence listing

<110> university of Ningxia

<120> composition, kit and method for Mycoplasma bovis detection Using LppA Gene as detection target

<130> BH1900189-1

<141> 2019-09-09

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1152

<212> DNA

<213> Mycoplasma bovis

<400> 1

atgattaaaa gagtaactaa attattatct tcacaacttg taattttgcc tatggttctt 60

ccgttgttat cttctaaatg tgataaacaa actaataaca atgatagcaa ctcttcagaa 120

ataacagaca cttcatctaa ctactttgac gaaagagcca atctagcatc gcctgcaaca 180

ttacctagag aaatattggg tttatatccc tcattaatag gaagtacaat tcttaataat 240

cttaaattag aagcaaatag aaaacaaaat cctaactcag attacgcaac taatgcagac 300

aactctggct ttggattatt attcaaaaaa gagaaaaatc tttttattga tgaaatgccg 360

tcacttcata aagaattaga gaaaatattc tttaatttta atcctaaata tacttcaaaa 420

tatgaagcta aaatagtggc tgctggcttt aacgatcttg aaggcgaatt aactcttggc 480

attcaaattt tatatagacc tgatacagct attgaaaata ctaacaacaa tacctatttt 540

caaagtttta aatttactgg ctttagaaaa tttgacttaa caaacagcga taataatgtt 600

ttaaaactaa aatttgacaa tcaaaattta gccaacatat ctaaaaaatg aagaaaacat 660

atgattcatt atgctagaca cactttaaaa aaagctatga ctgaaaatac ttcacttgca 720

agcataaata atccaaataa gctacgtttt gtcaggtatt tgtttacacc gcatttttta 780

ctaagtgaaa tacctttgaa tattaaagat gatacaaaca tttataacat taaagataat 840

aatttgactc tttttgatgt attttctcgt gaccacaaag ctatagttta tccgttttac 900

ggctcgctta ctagttttga tgatattttc gatataccaa ataatgattc tgttaagttt 960

gacatataca aaaattctga aaataaagaa atcttaaaaa ttactattaa ccttactata 1020

gtgccagggg ttcaaaatat atacacaaat attgaaagaa gcactaaaga caagaagaag 1080

gtgacattta gttttcaagt cgaagctcct tttgatgaat tattgcctga taataatcct 1140

gttgataatt aa 1152

<210> 2

<211> 37

<212> DNA

<213> Artificial Sequence

<400> 2

gaaaacatat gattcattat gctagacaca ctttaaa 37

<210> 3

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 3

tagtaagcga gccgtaaaac ggataaacta tagctttg 38

<210> 4

<211> 48

<212> DNA

<213> Artificial Sequence

<400> 4

caagcataaa taatccaaat aagctacgtt tgtcaggtat ttgtttac 48

<210> 5

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 5

actcttcaga aataacagac acttcatc 28

<210> 6

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 6

gagttgtctg cattagttgc gtaatc 26

<210> 7

<211> 48

<212> DNA

<213> Artificial Sequence

<400> 7

tacctagaga aatattgggt ttatatccct caaggaagta caattctt 48

Claims

1. A composition for detecting mycoplasma bovis comprising a first oligonucleotide capable of hybridizing to the LppA gene of mycoplasma bovis, a second oligonucleotide, a third oligonucleotide, and a buffer that solubilizes the first and second oligonucleotides, wherein: the first oligonucleotide hybridizes selectively to a first region of the LppA gene, the second oligonucleotide hybridizes selectively to a second region of the LppA gene, the first region is located at the 5' end of the LppA gene, the second region is located at the 3' end of the LppA gene, the distance between the first region and the second region is between 50bp and 2000bp, the 3' end of the third oligonucleotide carries a terminating phosphate group and a THF cleavage site located 31 to 32 in the middle of the third oligonucleotide, the sequence of the first oligonucleotide is shown as SEQ ID No.2, the sequence of the second oligonucleotide is shown as SEQ ID No.3, the sequence of the second oligonucleotide is (Biotin) TAGTAAGCGAGCCGTAAAACGGATAAACTATAGC TTTG, the sequence of the third oligonucleotide is shown as SEQ ID No.4, the sequence of the third oligonucleotide is (FAM) CA AGCATAAATAATCCAAATAAGCTACGTTT/idSp/GTCAGGTATTTGTTTAC (P), the pH of the buffer is between 6.9 and 7.0, and the first and second oligonucleotides are each present in a concentration of 0.5 mol/1, respectively.

2. The composition for detecting mycoplasma bovis according to claim 1, wherein the sequence of the LppA gene is shown in SEQ ID No. 1.

3. The composition for detecting mycoplasma bovis of claim 1, wherein the third oligonucleotide selectively hybridizes to a third region of the LppA gene, the third region being located between the first region and the second region.

4. The composition for detecting mycoplasma bovis according to claim 3, wherein the length of the first oligonucleotide is 35-45nt; the length of the second oligonucleotide is 35-50nt; the length of the third oligonucleotide is 40-55nt.

5. A kit for detecting mycoplasma bovis, comprising a composition according to any one of claims 1-4.

6. Use of a reagent for the preparation of a kit for detecting mycoplasma bovis by the method comprising a composition according to any one of claims 1 to 4;

the detection method comprises the following steps:

(1) Providing a template of a biological sample derived from a bovine;

(2) Combining the template with the composition according to any one of claims 1-4 to form a reaction system, and reacting the reaction system at 34-42 ℃ for 5-20 minutes to obtain an amplification product;

(3) Detecting the amplified product.

7. The use according to claim 6, wherein the detection of the amplification product comprises a step of subjecting the amplification product to agarose gel electrophoresis.

8. The use of claim 7, wherein detecting the amplification product comprises contacting the amplification product with a labeled flow-through chromatographic test strip, wherein the biological sample is determined to be a positive sample when red is displayed at both the detection line and the quality control line, wherein the biological sample is determined to be a negative sample when red is displayed at the quality control line and the detection line is not colored, and wherein the test strip is demonstrated to fail when the quality control line is not displaying red.