CN110229919A - For detecting the composition, kit and method of Mycoplasma bovis - Google Patents
For detecting the composition, kit and method of Mycoplasma bovis Download PDFInfo
- Publication number
- CN110229919A CN110229919A CN201910560295.0A CN201910560295A CN110229919A CN 110229919 A CN110229919 A CN 110229919A CN 201910560295 A CN201910560295 A CN 201910560295A CN 110229919 A CN110229919 A CN 110229919A
- Authority
- CN
- China
- Prior art keywords
- mycoplasma bovis
- oligonucleotides
- detecting
- composition
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses the composition, kit and method for detecting Mycoplasma bovis.The present invention completes the accurate detection of Mycoplasma bovis by designing specific primer, the probe of the LppA gene of Mycoplasma bovis, which can accomplish Mycoplasma bovis type strain and the conservative and Mycoplasma bovis in wild strain kind and the specificity between other pathogenic species.The present invention explores optimum reacting time in detection process and optimal reaction temperature, the specificity of detection, sensibility, repeatability and stability, have found optimum reaction condition, establish specificity it is good, sensibility is high and can stablize duplicate Mycoplasma bovis rapid detection method, with easy to operate, it is convenient time saving, without large-scale experimental instrument and equipment, it is very suitable to personnel's operation of no any experiment basis.
Description
Technical field
The present invention relates to field of molecular biotechnology, more particularly to a kind of composition that Mycoplasma bovis quickly detects, examination
Agent box and method.
Background technique
Mycoplasma bovis (Mycoplasma bovis, M.bovis) is under the jurisdiction of Prokaryota, Firmicutes, Mollicutes,
Mycoplasmas, Mycoplasmataceae, Mycoplasma are a kind of pathogen of main infection bovine respiratory, can persistent infection host,
Cause a variety of chronic diseases including ox pneumonia, such as mazoitis, tympanitis, dysgenesia, arthritis, meningitis and angle
Film conjunctivitis etc., these diseases are commonly referred to as Mycoplasma bovis related disease (Mycoplasma bovis associated
Disease, MbAD).
The method of detection Mycoplasma bovis generally comprises following at present.Cultivation is directly demonstrate,proved existing for detection pathogen
According to, be detect M.bovis goldstandard.Once detection, can make a definite diagnosis.General plate method and fast culture can be divided into
Method.However due to M.bovis slow growth, from clinical sample for the first time separation generally require 2~4 generation of blind passage could be by micro-
Mirror sees bacterium colony on solid medium, needs a few days that can just obtain testing result, and not only recall rate is low, but also there is time-consuming mistake
More, intermediate link complexity, condition of culture require the defects of high, bring certain difficulty to being clinically separated for M.bovis, uncomfortable
Close clinical quick diagnosis.Serologic detection technology has many advantages, such as that specificity is higher, sensitivity is preferable, quick, easily operated, non-
The often quick inspection and large-scale epidemiological survey of suitable clinical sample, but mycoplasma class has common antigen mostly,
It is easy to cause the experimental result of false positive.Immunohistochemistry technique is the technology that goalkeeper's histology is combined with immunology, be
Histocyte is in situ, is reacted by Ag-Ab specific binding reaction and Histochemical staining, by visible marker pair
Corresponding antigens or antibody positioned, qualitative and quantitative detection, but not heavy for the state of an illness or lesions position is selected deviation occur
When larger, immunohistochemistry is then difficult to detect the presence of M.bovis.In numerous detection methods, polymerase chain reaction is letter
Just and effective detection method.The detection of PCR method is quick, specific and sensibility is high, and detection sample needs not be living body, no
By patient immune function, the course of disease, gradient of infection, whether there is or not drug therapy is used and not up to measurable serum levels are influenced, make morning
Phase diagnosis and the correct of antibiotic are selected to possibility.The infected patient that early stage and the person that do not generate antibody and antibody have not disappeared has
Positive meaning；Help to early diagnose, treat in time, and cross reaction and radioactive pollution is not present, easily standardizes.Though
Right PCR method detection is quick, in some sense alternative cultivation, but its hypersensitivity also makes PCR method to experimental situation and instrument
Device requirement is relatively high, there is a problem that technical conditions requirement is high, complicated for operation, it is universal to be not easy, general laboratories are difficult to
Carry out, and price is also relatively high.
Summary of the invention
To solve at least partly technical problem in the prior art, the present invention provides a kind of quick, specific detection Niu Zhiyuan
Composition, kit and the method for body.Specifically, the present invention includes the following contents:
The first aspect of the present invention provides the composition for detecting Mycoplasma bovis comprising can be with Mycoplasma bovis
The first oligonucleotides, the second oligonucleotides and the third oligonucleotides of LppA gene recombination.
In the present invention, the length of the first oligonucleotides is generally 35~45nt, preferably 35~40nt.Preferably, first
The sequence of oligonucleotides is as shown in SEQ ID No.1.In the present invention, the length of the second oligonucleotides is generally 35~50nt, excellent
It is selected as 35~45nt, is marked at 5 ' ends with Biotin.Preferably, the sequence of the second oligonucleotides such as SEQ ID No.2 institute
Show, and is marked at 5 ' ends with Biotin.In the present invention, the length of third oligonucleotides is generally 40~55nt, preferably 40~
50nt.5 ' ends of third oligonucleotides are with detection label, such as FAM fluorophor.3 ' ends of third oligonucleotides are with eventually
Only phosphate group.Contain THF cleavage site among the sequence of third oligonucleotides.Preferably, the sequence of third oligonucleotides is such as
Shown in SEQ ID No.3, and FAM is had at 5 ' ends, is with termination phosphate group and between 31-32 bit base at 3 ' ends
idSp。
In the present invention, the first oligonucleotides can be with the first area selective cross at LppA gene 5 ' end, the second few core
The second area selective cross that thuja acid can be held with LppA gene 3 ', third oligonucleotides can be with the third area of LppA gene
Field selectivity hybridization.Wherein, the distance between first area and second area be between 50bp~2000bp, preferably 70~
1000bp, more preferable 100~500bp, such as 100~200bp.Third region is between first area and second area.
The second aspect of the present invention provides the kit for detecting Mycoplasma bovis, and it includes first aspect present invention
Composition.
Kit of the invention, which may also include, to be tried in the form of as defined in government organs with regulation manufacture, use or sale diagnosis
The relevant points for attention of agent box.The detail specifications of use, storage and troubleshooting can also be provided in kit.Kit may be used also
It is optionally located at suitable be preferred in the device of the robot manipulation of high throughput setting.
The component of kit of the present invention can provide as dry powder.When reagent and/or component are provided as dry powder, powder can pass through
Suitable solvent is added to restore to the original state.It is expected that the solvent may also be disposed in another container.Container would generally include at least one
Kind bottle, test tube, flask, bottle, syringe and/or other container means, wherein optional partially place solvent.Kit may be used also
Including the second container means to contain sterile, pharmaceutically acceptable buffer and/or other solvents.
In kit exist be more than a kind of component in the case where, the kit would generally also comprising can it is individually placed in addition
Component second, third or other other containers.In addition, can in a reservoir include the combination of each various ingredients.
Kit of the invention may also include holding or maintain the component of DNA, such as the reagent of anti-nucleolysis.Such group
Divide to be the nuclease of the protection for example or without RNase or with anti-RNase.Any composition as described herein or reagent can be
Component in kit.
The third aspect of the present invention provides the method for detecting Mycoplasma bovis, comprising the following steps:
(1) template of the biological sample from ox is provided；
(2) make template and composition anabolic reaction system, reacted at 34 DEG C~42 DEG C and obtain within 5~20 minutes amplification production
Object；
(3) contact amplified production with markd flow measurement chromatograph test strip, when all aobvious at detection line and nature controlling line
When showing red, determine the biological sample for positive sample, when be displayed in red at nature controlling line and detection line do not develop the color when, determine
The biological sample is negative sample, and test strips failure is proved when nature controlling line is not displayed in red.
Biological sample of the invention refers to body fluid or secretion from ox to be detected.Preferably, biological sample, which is originated from, suffers from
There is the ox of related disease.Wherein the example of body fluid includes but is not limited to cyst fluid, nose liquid and joint fluid, lotion etc..Life of the invention
Object sample is nose of an ox liquid or joint fluid.Substance as template can be DNA and be also possible to RNA.
Different from general PCR reaction, reaction system of the invention need to carry out in 34 DEG C~42 DEG C of temperature environment, and
And the reaction time also only needs 5~20 minutes, preferably 8~15 minutes.Most preferably in embodiment, reaction temperature of the invention is
39 DEG C, the reaction time is 10 minutes.
In an exemplary embodiment, reaction system of the invention (not including template) includes:
Mycoplasma bovis and mycoplasma agalactiae known in the art are in the 16S conventionally used for difference different plant species or strain
The whole genome sequence of rRNA, film surface lipoprotein family gene even relevant to mycoplasma pathogenic mechanism or even the two
On show great similitude.This brings great challenge for the specific detection of Mycoplasma bovis.The present invention passes through big
The analysis and screening of data are measured, therefrom discovery routine and antigenicity associated LppA gene, specific region especially therein can
To be used to design the primer target region of recombination polymerization amplified reaction.
Composition of the invention can be special in streptococcus pneumonia, Klebsiella, pseudomonas aeruginosa detection
M.bovis out, and these compositions not only can detecte out M.bovis type strain PG45 can also detect that M.bovis open country
Raw strain ltb and WWM.When these compositions are used for the detection of Mycoplasma bovis, it can accomplish conservative and ox in Mycoplasma bovis kind
Specificity between mycoplasma and other pathogenic species has excellent technical effect.
Further, the present invention also optimizes reaction system, and obtains optimum reacting time and optimal reaction temperature, from
And greatly promote the specificity, sensibility, repeatability of detection with stability, foundation obtain specific good, sensibility it is high and
Duplicate M.bovis rapid detection method can be stablized.
In addition, the scheme established of the invention method when detecting M.bovis is easy to operate, and it is convenient time saving, without big
The experimental instrument and equipment of type is very suitable to personnel's operation of no any experiment basis in field or field quick detection, is worth
It promotes the use of.
Detailed description of the invention
Fig. 1: reaction result observation schematic of the invention.
Fig. 2: for the time response gradient map of gene LppA.
Fig. 3: for the thermotonus gradient map of gene LppA.
Fig. 4: for the specific reaction figure of gene LppA.M: molecular mass standard 1: Mycoplasma bovis type strain PG45 2:
Mycoplasma bovis wild strain Ltb 3: Mycoplasma bovis wild strain WWM 4: mycoplasma ovine pneumoniae type strain Y98 5: mycoplasma agalactiae
Type strain PG2 6: Mycoplasma mycoides subsp.capri type strain PG3 7: mycoplasma capri goat pneumonia subspecies type strain F38 8:
Pasteurella 9: staphylococcus aureus 10: Klebsiella 11: streptococcus pneumonia 12: Serratia fonticola 13: salmonella 14:
Escherichia coli 15: Pseudomonas aeruginosa 16: no template control.
Fig. 5: for the sensitive response figure of gene LppA.
Fig. 6: for batch interior repeated result figure of gene LppA.
Fig. 7: for gene LppA batch between repeated result figure.
Specific embodiment
The existing various exemplary embodiment that the present invention will be described in detail, the detailed description are not considered as to limit of the invention
System, and it is understood as the more detailed description to certain aspects of the invention, characteristic and embodiment.
It should be understood that it is to describe special embodiment that heretofore described term, which is only, it is not intended to limit this hair
It is bright.In addition, for the numberical range in the present invention, it is thus understood that specifically disclose the range upper and lower bound and they it
Between each median.Median and any other statement value in any statement value or stated ranges or in the range
Lesser range is also included in the present invention each of between interior median.These small range of upper and lower bounds can be independent
Ground includes or excludes in range.
Unless otherwise stated, all technical and scientific terms used herein has the routine in field of the present invention
The normally understood identical meanings of technical staff.Although the present invention only describes preferred method and material, of the invention
Implement or also can be used and similar or equivalent any method and material described herein in testing.The institute mentioned in this specification
There is document to be incorporated by reference into, to disclosure and description method relevant to the document and/or material.It is incorporated to any
When document conflicts, it is subject to the content of this specification.Unless otherwise stated, " % " is the percentage based on weight.
Since M.bovis and mycoplasma agalactiae homology are very high, the similarity of the two 16S rRNA up to 96%, so
It is extremely important for the specific detection of M.bovis to find other identifier gene.The present invention is not only examined when selection identifies gene
The conservative or homology of gene are considered, more importantly for primer when also contemplating recombination polymerization amplification (RPA) reaction
Particular requirement, thus discovery be directed to LppA gene, especially specific region therein design oligonucleotides can quickly, it is special
Detection M.bovis.
In addition, though being currently known in Mycoplasma bovis, there are a variety of conservative genes, but for the design of different conservative genes
Primer is general PCR primer or the custom primer for LAMP.These primers cannot be used under room temperature of the invention
Recombinate polymerization reaction.This is because the amplification carried out at normal temperature, the unwinding of DNA and PCR are entirely different.Tradition estimation is melted
Point is not suitable for this system.In addition, traditional PCR primer is due to curtailment, when for recombination polymerization reaction of the invention
Efficiency is too low.In addition, current probe is not suitable for reaction of the invention yet, the core of polymerase 5 ' -3 ' has especially been used at present
The probe system of phytase activity, such enzymatic activity react at all incompatible with of the invention.In conclusion for of the invention
Recombinating polymerization reaction, there is presently no corresponding primer or probe design standards.
Embodiment
The present embodiment is the detection method of the invention based on specific gene LppA.It is specific as follows:
(1) building of detection architecture of the invention:
First detection architecture:
Wherein, Primer free Rehydration buffer is known commercially available product.
Second detection architecture:
Wherein basic mixture includes 5~20ng/ μ L recombinase, the 40~60ng/ μ L polymerase being dissolved in buffer
With 500~1000ng/ μ L single strand binding protein；Buffer includes ATP, dNTP, 25~50mM phosphocreatine, 2.7~4.3 μ g/
U creatine kinase, 2~6mM dithiothreitol (DTT) and 2~8% (w/v) polyethylene glycol, and pH is the dense of 6.0~9.0, NaCl or KCl
Spend 100nM.
Containing the whole enzymes and reagent needed for reacting in the basic mixture, template and corresponding widow need to only be added wherein
Nucleotide.The magnesium acetate (MgOAc) for needing addition such as 2.5 μ l concentration to be 280mM before the reaction is opened into mixture system
Dynamic reaction.Amplified production is obtained after reaction, product can be used and be detected with markd flow measurement chromatograph test strip at this time.Work as inspection
When surveying product in conjunction with test strips, positive sample can be all displayed in red at detection line and nature controlling line, and negative sample only can be
It accuses and is displayed in red at line, test strips failure is proved when nature controlling line is not displayed in red, be invalid testing result.Test paper detection
Shown in the result is shown in Figure 1.
(2) exploration of optimum reacting time
PCR can specificity detection M.bovis on the basis of, select gene LppA carry out downstream recombination polymerization amplification
Experiment condition, design following oligonucleotides carry out recombination polymerization amplified reaction, thus establish quickly detection M.bovis side
Method, specific experiment process are as follows:
The sequence of first oligonucleotides (LppA F) is as follows:
GAAAACATATGATTCATTATGCTAGACACACTTTAAA(SEQ ID No.1)
The sequence of first oligonucleotides (LppA R) is as follows:
(Biotin)TAGTAAGCGAGCCGTAAAACGGATAAACTATAGCTTTG(SEQ ID No.2)
The sequence of first oligonucleotides (LppAP) is as follows:
(FAM)CAAGCATAAATAATCCAAATAAGCTACGTTT/idSp/GTCAGGTATTT GTTTAC(P)(SEQ
ID No.3)。
Reaction system:
It is added in reaction tube and mixes well after above-mentioned reaction solution is mixed, the template to be measured and 1.25 μ L of 1 μ L is added
MgOAC, brief centrifugation after vortex, is put in 39 DEG C of water-baths, reacts 10min.After reaction, 2 μ L reaction solutions and 100 μ L are taken
Detection buffer mixes well in sterile 1.5mL centrifuge tube, and test strips are inserted into mixed liquor, can observing response knot
Fruit.
After establishing reaction system, setting 0min~45min time gradient, which is reacted, explores its optimum reacting time, discovery reaction
5min can produce macroscopic testing result, to keep reaction more stable, set 10min as optimum reacting time.Temperature
Gradient testing result is as shown in Figure 2.
(3) exploration of optimal reaction temperature
Using 10min as optimum reacting time, 34 DEG C~42 DEG C reaction temperature gradients are set, find it in 34 DEG C~42 DEG C
Can react, temperature gradient testing result as shown in figure 3, more demonstrate reaction of the invention be can at normal temperature into
Capable, the red of detection line is deeper at 39 DEG C in reaction result, so selecting at 39 DEG C to be optimal reaction temperature.
(4) specificity detected
Using 10min as optimum reacting time, 39 DEG C are optimal reaction temperature, detect the specificity of reaction of the invention, are examined
Survey result as shown in Figure 4, it is identical as the testing result of PCR, it is only capable of detecting M.bovis type strain PG45 and wild strain Ltb
And WWM, it cannot detect remaining pathogenic bacteria.
(5) sensibility detected
Under the premise of specificity is good, the target fragment of LppA gene is cloned, calculates its copy number, and carry out 10 times of ladders
Degree dilution finds that the bottom line that reaction of the invention can detect is 3 × 101, testing result as shown in Figure 5, significantly larger than PCR
The 3 × 10 of method3。
(6) stability detected
After the specificity and sensibility for having probed into reaction, the stability of reaction need to be detected.Therefore selection 3 × 107、
3×106、3×105The positive plasmid standard items of three various concentrations, under identical conditions in triplicate, the interior repetition of observation batch
Effect, batch internal stability testing result is as shown in Figure 6；The positive plasmid standard items for taking above-mentioned 3 various concentrations, same
In experiment in triplicate, observation batch between repeating effect, batch between stability experiment result as shown in Figure 7.
After method for building up, my 5, area, 53, pasture clinical sample is detected, finds the detection sun of method of the invention
Property 22, sample, clinical sample is detected with traditional molecular biology for detection, discovery testing result and PCR detect
As a result coincidence rate is 94%.
The present invention polymerize the specific primer and probe of amplified reaction by the design recombination to specific gene LppA, right
Optimum reacting time is explored with optimal reaction temperature, the specificity of detection, sensibility, repeatability with stability, is looked for
Optimum reaction condition is arrived, the specificity of foundation is good, sensibility is high and can stablize duplicate M.bovis rapid detection method.
The method of detection M.bovis established by the present invention is easy to operate, convenient time saving, without large-scale experimental instrument and equipment, very
It is suitble to the personnel of no any experiment basis to operate, is worth of widely use.
Without departing substantially from the scope or spirit of the invention, the specific embodiment of description of the invention can be done more
Kind improvements and changes, this will be apparent to those skilled in the art.Other realities obtained by specification of the invention
Applying mode for technical personnel is apparent obtain.Present specification and embodiment are merely exemplary.
Sequence table
<110>Ningxia University
<120>for detecting the composition, kit and method of Mycoplasma bovis
<141> 2019-06-18
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 37
<212> DNA
<213> Artificial Sequence
<400> 1
gaaaacatat gattcattat gctagacaca ctttaaa 37
<210> 2
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 2
tagtaagcga gccgtaaaac ggataaacta tagctttg 38
<210> 3
<211> 48
<212> DNA
<213> Artificial Sequence
<400> 3
caagcataaa taatccaaat aagctacgtt tgtcaggtat ttgtttac 48
<210> 4
<211> 1152
<212> DNA
<213> Mycoplasma bovis
<400> 4
atgattaaaa gagtaactaa attattatct tcacaacttg taattttgcc tatggttctt 60
ccgttgttat cttctaaatg tgataaacaa actaataaca atgatagcaa ctcttcagaa 120
ataacagaca cttcatctaa ctactttgac gaaagagcca atctagcatc gcctgcaaca 180
ttacctagag aaatattggg tttatatccc tcattaatag gaagtacaat tcttaataat 240
cttaaattag aagcaaatag aaaacaaaat cctaactcag attacgcaac taatgcagac 300
aactctggct ttggattatt attcaaaaaa gagaaaaatc tttttattga tgaaatgccg 360
tcacttcata aagaattaga gaaaatattc tttaatttta atcctaaata tacttcaaaa 420
tatgaagcta aaatagtggc tgctggcttt aacgatcttg aaggcgaatt aactcttggc 480
attcaaattt tatatagacc tgatacagct attgaaaata ctaacaacaa tacctatttt 540
caaagtttta aatttactgg ctttagaaaa tttgacttaa caaacagcga taataatgtt 600
ttaaaactaa aatttgacaa tcaaaattta gccaacatat ctaaaaaatg aagaaaacat 660
atgattcatt atgctagaca cactttaaaa aaagctatga ctgaaaatac ttcacttgca 720
agcataaata atccaaataa gctacgtttt gtcaggtatt tgtttacacc gcatttttta 780
ctaagtgaaa tacctttgaa tattaaagat gatacaaaca tttataacat taaagataat 840
aatttgactc tttttgatgt attttctcgt gaccacaaag ctatagttta tccgttttac 900
ggctcgctta ctagttttga tgatattttc gatataccaa ataatgattc tgttaagttt 960
gacatataca aaaattctga aaataaagaa atcttaaaaa ttactattaa ccttactata 1020
gtgccagggg ttcaaaatat atacacaaat attgaaagaa gcactaaaga caagaagaag 1080
gtgacattta gttttcaagt cgaagctcct tttgatgaat tattgcctga taataatcct 1140
gttgataatt aa 1152
Claims (10)
1. a kind of for detecting the composition of Mycoplasma bovis, which is characterized in that including can be miscellaneous with the LppA gene of Mycoplasma bovis
The first oligonucleotides, the second oligonucleotides and the third oligonucleotides handed over, in which:
The first area selective cross of first oligonucleotides and the LppA gene, second oligonucleotides with it is described
The third regioselectivity of the second area selective cross of LppA gene, the third oligonucleotides and the LppA gene is miscellaneous
It hands over, and the first area is located at 5 ' ends of the LppA gene, the second area is located at 3 ' ends of the LppA gene, institute
The distance between first area and the second area are stated between 50bp~2000bp, the third region is located at described first
Between region and the second area.
2. according to claim 1 for detecting the composition of Mycoplasma bovis, which is characterized in that first oligonucleotides
Length be 35~45nt；The length of second oligonucleotides is 35~50nt, and its 5 ' end is marked with Biotin；It is described
The length of third oligonucleotides is 40~55nt, and its 5 ' end, with detectable group, 3 ' ends, which have, terminates phosphate group and position
THF cleavage site among the third oligonucleotides.
3. according to claim 2 for detecting the composition of Mycoplasma bovis, which is characterized in that first oligonucleotides
Sequence as shown in SEQ ID No.1, the sequence of second oligonucleotides as shown in SEQ ID No.2, and 5 ' end have
Biotin label, the sequence of the third oligonucleotides have FAM as shown in SEQ ID No.3, and at 5 ' ends, have at 3 ' ends
Terminate phosphate group and between 31-32 bit base be idSp.
4. according to claim 3 for detecting the composition of Mycoplasma bovis, which is characterized in that further comprise recombination
Enzyme, polymerase and single strand binding protein.
5. according to claim 3 for detecting the composition of Mycoplasma bovis, which is characterized in that further include buffering
Liquid, the buffer includes energy matter, dithiothreitol (DTT) and polyethylene glycol, and pH is the concentration of 6.0~9.0, NaCl or KCl
In 0~200nM, and the energy matter includes NTP/dNTP, phosphocreatine and creatine kinase.
6. according to claim 5 for detecting the composition of Mycoplasma bovis, which is characterized in that further comprise acetic acid
Salt.
7. a kind of for detecting the kit of Mycoplasma bovis, which is characterized in that including described in any one according to claim 1~6
Composition.
8. a kind of method for detecting Mycoplasma bovis, which comprises the following steps:
(1) template of the biological sample from ox is provided；
(2) make the template and described in any item composition anabolic reaction systems according to claim 1~6,34 DEG C~42
It reacts the reaction system 5~20 minutes and obtains amplified production；
(3) contact the amplified production with markd flow measurement chromatograph test strip, when all aobvious at detection line and nature controlling line
When showing red, determine the biological sample for positive sample, when be displayed in red at nature controlling line and detection line do not develop the color when, determine
The biological sample is negative sample, and test strips failure is proved when nature controlling line is not displayed in red.
9. the method according to claim 8 for detecting Mycoplasma bovis, which is characterized in that the reaction system includes:
10. the method according to claim 9 for detecting Mycoplasma bovis, which is characterized in that the reaction temperature is 39
DEG C, the reaction time is 10 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910560295.0A CN110229919B (en) | 2019-06-26 | 2019-06-26 | Compositions, kits and methods for detecting mycoplasma bovis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910560295.0A CN110229919B (en) | 2019-06-26 | 2019-06-26 | Compositions, kits and methods for detecting mycoplasma bovis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110229919A true CN110229919A (en) | 2019-09-13 |
| CN110229919B CN110229919B (en) | 2023-07-25 |
Family
ID=67857279
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910560295.0A Active CN110229919B (en) | 2019-06-26 | 2019-06-26 | Compositions, kits and methods for detecting mycoplasma bovis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110229919B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110499376A (en) * | 2019-09-09 | 2019-11-26 | 宁夏大学 | It is composition, kit and the method for detecting target and carrying out Mycoplasma bovis detection with LppA gene |
| CN110564877A (en) * | 2019-09-16 | 2019-12-13 | 宁夏大学 | Composition, kit and method for detecting mycoplasma ovipneumoniae by using transketolase gene as target |
| CN110763843A (en) * | 2019-11-06 | 2020-02-07 | 华中农业大学 | Mycoplasma bovis double-antibody sandwich ELISA (enzyme-Linked immuno sorbent assay) detection kit and application thereof |
| CN111349637A (en) * | 2020-03-15 | 2020-06-30 | 中国农业科学院兰州兽医研究所 | Mycoplasma capricolum goat pneumonia subspecies specific protein and indirect ELISA kit |
| CN115976254A (en) * | 2022-10-05 | 2023-04-18 | 浙江农林大学 | RPA-LFD primer and detection method for plant pathogenic fusarium oxysporum |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868167A (en) * | 2017-03-23 | 2017-06-20 | 山东师范大学 | Primer, probe and kit for field quick detection Mycoplasma bovis |
| CN109536625A (en) * | 2018-12-12 | 2019-03-29 | 中国农业科学院兰州兽医研究所 | A kind of the iiPCR detection method and detection kit of Mycoplasma bovis |
-
2019
- 2019-06-26 CN CN201910560295.0A patent/CN110229919B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868167A (en) * | 2017-03-23 | 2017-06-20 | 山东师范大学 | Primer, probe and kit for field quick detection Mycoplasma bovis |
| CN109536625A (en) * | 2018-12-12 | 2019-03-29 | 中国农业科学院兰州兽医研究所 | A kind of the iiPCR detection method and detection kit of Mycoplasma bovis |
Non-Patent Citations (3)
| Title |
|---|
| HELMUT H等: "detection and differentiation of Ruminant Mycoplasmas", 《PCR DETECTION OF MICROBIAL PATHOGENS》 * |
| 李建等: "牛支原体TaqMan实时荧光定量PCR检测方法的建立", 《中国兽医学报》 * |
| 肖淦文等: "牛支原体、巴氏杆菌A型和化脓隐秘杆菌多重PCR快速检测方法的建立", 《中国奶牛》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110499376A (en) * | 2019-09-09 | 2019-11-26 | 宁夏大学 | It is composition, kit and the method for detecting target and carrying out Mycoplasma bovis detection with LppA gene |
| CN110499376B (en) * | 2019-09-09 | 2023-07-25 | 宁夏大学 | Composition, kit and method for detecting mycoplasma bovis by taking LppA gene as detection target |
| CN110564877A (en) * | 2019-09-16 | 2019-12-13 | 宁夏大学 | Composition, kit and method for detecting mycoplasma ovipneumoniae by using transketolase gene as target |
| CN110564877B (en) * | 2019-09-16 | 2023-04-21 | 宁夏大学 | Composition, kit and method for detecting mycoplasma ovipneumoniae by taking transketolase gene as target |
| CN110763843A (en) * | 2019-11-06 | 2020-02-07 | 华中农业大学 | Mycoplasma bovis double-antibody sandwich ELISA (enzyme-Linked immuno sorbent assay) detection kit and application thereof |
| CN111349637A (en) * | 2020-03-15 | 2020-06-30 | 中国农业科学院兰州兽医研究所 | Mycoplasma capricolum goat pneumonia subspecies specific protein and indirect ELISA kit |
| CN111349637B (en) * | 2020-03-15 | 2023-05-12 | 中国农业科学院兰州兽医研究所 | Mycoplasma caprae and subspecies pneumoniae specific proteins and indirect ELISA kit |
| CN115976254A (en) * | 2022-10-05 | 2023-04-18 | 浙江农林大学 | RPA-LFD primer and detection method for plant pathogenic fusarium oxysporum |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110229919B (en) | 2023-07-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110229919A (en) | For detecting the composition, kit and method of Mycoplasma bovis | |
| US9080204B2 (en) | Compositions and methods for rapid, real-time detection of influenza a virus (H1N1) Swine 2009 | |
| AU2007338604B2 (en) | Biological organism identification product and methods | |
| US7309589B2 (en) | Sensitive detection of bacteria by improved nested polymerase chain reaction targeting the 16S ribosomal RNA gene and identification of bacterial species by amplicon sequencing | |
| CN106834506A (en) | A kind of LAMP primer group of quick detection bacterium polymyxins drug resistant gene mcr 1, kit and detection method | |
| CN110396557A (en) | A kind of specific HPV nucleic acid detection method based on CRISPR/Cas12a | |
| CN106191239A (en) | A kind of real-time PCR detection mycoplasma pneumoniae nucleic acid and the primer of medicament-resistant mutation, probe, method and test kit | |
| CN116004874A (en) | Primer combination and kit for detecting Chlamydia psittaci based on isothermal amplification method | |
| CN110257539B (en) | Compositions, kits and methods for detecting mycoplasma ovipneumoniae | |
| Loens et al. | Development of conventional and real-time NASBA® for the detection of Legionella species in respiratory specimens | |
| CN103451309B (en) | Mycobacterium detection kit and using method thereof | |
| CN104520438A (en) | Methods for measuring polymerase activity useful for sensitive, quantitative measurements of any polymerase extension activity and for determining the presence of viable cells | |
| CN110499376A (en) | It is composition, kit and the method for detecting target and carrying out Mycoplasma bovis detection with LppA gene | |
| Brey et al. | Design and development of an internal control plasmid for the detection of Mycobacterium avium subsp. paratuberculosis using real-time PCR | |
| Abdeldaim et al. | PCR detection of Haemophilus influenzae from respiratory specimens | |
| CN110257555A (en) | The quick detection monitoring method of one boar common transmittable disease cause of disease | |
| Lin et al. | Genome-wide mutagenesis in Borrelia burgdorferi | |
| CN110564877B (en) | Composition, kit and method for detecting mycoplasma ovipneumoniae by taking transketolase gene as target | |
| KR20200048082A (en) | Kit for diagnosing infection due to orientia tsutsugamushi | |
| CN110055345A (en) | Primer sets and its application | |
| CN109234408A (en) | A kind of primer, probe and the method for the mutation of detection aedes albopictus drug resistance gene | |
| BR102014031946A2 (en) | Method and kit for identification and molecular differentiation of salmonella pullorum and salmonella gallinarum | |
| CN118006834A (en) | RAA primer probe combination for detecting candida otophylla and rapid detection method | |
| CN117070647A (en) | Compositions for pathogen detection based on high throughput amplicon sequencing | |
| CN116970725A (en) | Constant-temperature amplification rapid detection method for staphylococcus aureus SasG gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Hao Xiujing Inventor after: Li Min Inventor after: Han Yang Inventor after: Ma Chunji Inventor before: Li Min Inventor before: Hao Xiujing Inventor before: Han Yang Inventor before: Ma Chunji |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |