CN110499376A - It is composition, kit and the method for detecting target and carrying out Mycoplasma bovis detection with LppA gene - Google Patents
It is composition, kit and the method for detecting target and carrying out Mycoplasma bovis detection with LppA gene Download PDFInfo
- Publication number
- CN110499376A CN110499376A CN201910847999.6A CN201910847999A CN110499376A CN 110499376 A CN110499376 A CN 110499376A CN 201910847999 A CN201910847999 A CN 201910847999A CN 110499376 A CN110499376 A CN 110499376A
- Authority
- CN
- China
- Prior art keywords
- oligonucleotides
- gene
- lppa
- mycoplasma bovis
- composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
It is composition, kit and the method for detecting target and carrying out Mycoplasma bovis detection that the present invention, which is disclosed with LppA gene,.The detection target of composition of the invention is the LppA gene of Mycoplasma bovis, it can be for a variety of different fragments in the gene, and a variety of different specific combination situations can be designed to be applied to a variety of amplification methods such as normal PCR, basic RPA, nfo RPA and exo-RPA by experimental verification composition of the invention, in addition can carry out observation experiment result by agarose gel electrophoresis, flow measurement chromatograph test strip and constant temperature amplified fluorescence instrument.Group of the invention, which is combined, can accomplish Mycoplasma bovis type strain and the conservative and Mycoplasma bovis in wild strain kind and the specificity between other pathogenic species.Can establish that specificity is good, sensibility is high and can stablize duplicate Mycoplasma bovis rapid detection method based on composition of the invention, have it is easy to operate, it is convenient time saving, without large-scale experimental instrument and equipment.
Description
Technical field
The present invention relates to field of molecular biotechnology, carry out ox branch with LppA gene more particularly to one kind for detection target
Composition, kit and the method for substance detection.
Background technique
Mycoplasma bovis (Mycoplasma bovis, M.bovis) is under the jurisdiction of Prokaryota, Firmicutes, Mollicutes,
Mycoplasmas, Mycoplasmataceae, Mycoplasma are a kind of pathogen of main infection bovine respiratory, can persistent infection host,
Cause a variety of chronic diseases including ox pneumonia, such as mazoitis, tympanitis, dysgenesia, arthritis, meningitis and angle
Film conjunctivitis etc., these diseases are commonly referred to as Mycoplasma bovis related disease (Mycoplasma bovis associated
Disease, MbAD).
The method of detection Mycoplasma bovis generally comprises following at present.Cultivation is directly demonstrate,proved existing for detection pathogen
According to, be detect M.bovis goldstandard.Once detection, can make a definite diagnosis.General plate method and fast culture can be divided into
Method.However due to M.bovis slow growth, from clinical sample for the first time separation generally require 2~4 generation of blind passage could be by micro-
Mirror sees bacterium colony on solid medium, needs a few days that can just obtain testing result, and not only recall rate is low, but also there is time-consuming mistake
More, intermediate link complexity, condition of culture require the defects of high, bring certain difficulty to being clinically separated for M.bovis, uncomfortable
Close clinical quick diagnosis.Serologic detection technology has many advantages, such as that specificity is higher, sensitivity is preferable, quick, easily operated, non-
The often quick inspection and large-scale epidemiological survey of suitable clinical sample, but mycoplasma class has common antigen mostly,
It is easy to cause the experimental result of false positive.Immunohistochemistry technique is the technology that goalkeeper's histology is combined with immunology, be
Histocyte is in situ, is reacted by Ag-Ab specific binding reaction and Histochemical staining, by visible marker pair
Corresponding antigens or antibody positioned, qualitative and quantitative detection, but not heavy for the state of an illness or lesions position is selected deviation occur
When larger, immunohistochemistry is then difficult to detect the presence of M.bovis.In numerous detection methods, polymerase chain reaction is letter
Just and effective detection method.The detection of PCR method is quick, specific and sensibility is high, and detection sample needs not be living body, no
By patient immune function, the course of disease, gradient of infection, whether there is or not drug therapy is used and not up to measurable serum levels are influenced, make morning
Phase diagnosis and the correct of antibiotic are selected to possibility.The infected patient that early stage and the person that do not generate antibody and antibody have not disappeared has
Positive meaning；Help to early diagnose, treat in time, and cross reaction and radioactive pollution is not present, easily standardizes.Though
Right PCR method detection is quick, in some sense alternative cultivation, but its hypersensitivity also makes PCR method to experimental situation and instrument
Device requirement is relatively high, there is a problem that technical conditions requirement is high, complicated for operation, it is universal to be not easy, general laboratories are difficult to
Carry out, and price is also relatively high.
Summary of the invention
To solve at least partly technical problem in the prior art, the present invention provides a kind of quick, specific detection Niu Zhiyuan
Composition, kit and the method for body.Specifically, the present invention includes the following contents:
The first aspect of the present invention provides the composition for detecting Mycoplasma bovis comprising can be with Mycoplasma bovis
First oligonucleotides of LppA gene recombination, the second oligonucleotides and dissolution first oligonucleotides and the second oligonucleotides
Buffer.
LppA is the important antigen composition of Mycoplasma mycoides subsp.capri.For the albumen or its gene research compared with
It is few, and the function or its structure of albumen are focused in current research, for example, the secondary structure of protein molecular, hydrophilic region
And antigenic index.It is different from research of interest at present, present invention discover that LppA gene has kind interior conservative in Mycoplasma bovis
Property and its inter-species specificity, detect Mycoplasma bovis so as to high specific and sensibility.LppA gene of the invention has
Sequence shown in SEQ ID No.1.
In the present invention, the length of the first oligonucleotides is generally 35~45nt, preferably 35~40nt.In the present invention, the
The length of two oligonucleotides is generally 35~50nt, preferably 35~45nt.In certain embodiments, second oligonucleotides
5 ' the no any modifications in end.In a further embodiment, 5 ' ends of the second oligonucleotides of the invention are marked with Biotin.
Preferably, 5 ' ends of the second oligonucleotides are marked with Biotin.Preferably, the invention also includes third oligonucleotides, length
Degree is generally 40~55nt, preferably 40~50nt.5 ' ends of third oligonucleotides are with detection label, such as FAM fluorophor.
3 ' ends of third oligonucleotides are with termination phosphate group.Preferably, contain THF cleavage among the sequence of third oligonucleotides
Point.
In the present invention, the first oligonucleotides can be with the first area selective cross at LppA gene 5 ' end, the second few core
The second area selective cross that thuja acid can be held with LppA gene 3 '.In certain embodiments, the invention also includes thirds
Oligonucleotides can, hybridize with the third regioselectivity of LppA gene.The first area is located at the LppA gene
5 ' end sides, the second area are located at 3 ' end sides of the LppA gene.Wherein, nearest between first area and second area
Distance is between 50bp~2000bp, preferably 70~1000bp, more preferable 100~500bp, such as 100~200bp.Herein most
Close distance refers to that first area 3 ' holds the last one base and second area 5 ' to hold the distance between first base.Third area
Domain is between first area and second area.There is no weights preferably between first area or second area in third region herein
It is folded.
In certain embodiments, composition of the invention includes that the first oligonucleotides, the second oligonucleotides and third are few
Nucleotide, and the sequence of the first oligonucleotides is as shown in SEQ ID No.2, the sequence of the second nucleotide such as SEQ ID No.3 institute
Show, the sequence of third nucleotide as shown in SEQ ID No.4, and 5 ' end have FAM, 3 ' end with terminate phosphate group and
It is idSp between 31-32 bit base.
In certain embodiments, composition of the invention includes the first oligonucleotides and the second oligonucleotides, and first
The sequence of oligonucleotides is as shown in SEQ ID No.5, and the sequence of the second nucleotide is as shown in SEQ ID No.6.
It should be noted that " 5 ' end side " of the invention refers to the region close to LppA gene 5 ' end, which can be from
5 ' first nucleotide in end start, and not can also only refer to the 5 ' of LppA gene since some further downstream nucleotide of 5 ' ends
End.Similarly it is found that " 3 ' end side " also has similar meaning.
The second aspect of the present invention provides the kit for detecting Mycoplasma bovis, and it includes first aspect present invention
Composition.As described above, composition is described in detail, details are not described herein.Illustrate kit of the present invention below
Other parts.
Kit of the invention, which may also include, to be tried in the form of as defined in government organs with regulation manufacture, use or sale diagnosis
The relevant points for attention of agent box.The detail specifications of use, storage and troubleshooting can also be provided in kit.Kit may be used also
It is optionally located at suitable be preferred in the device of the robot manipulation of high throughput setting.
The third aspect of the present invention provides the method for detecting Mycoplasma bovis, comprising the following steps:
(1) template of the biological sample from ox is provided；
(2) make template and composition anabolic reaction system, reacted at 34 DEG C~42 DEG C and obtain within 5~20 minutes amplification production
Object；
(3) amplified production is detected.
In the present invention, detection amplified production may include the step of so that amplified production is carried out agarose gel electrophoresis.Certain
In embodiment, detection amplified production includes contacting amplified production with markd flow measurement chromatograph test strip, when detecting
When being all displayed in red at line and nature controlling line, determine that the biological sample for positive sample, is examined when being displayed in red at nature controlling line
When survey line does not develop the color, the biological sample is determined for negative sample, test strips failure is proved when nature controlling line is not displayed in red.
Biological sample of the invention refers to body fluid or secretion from ox to be detected.Preferably, biological sample, which is originated from, suffers from
There is the ox of related disease.Wherein the example of body fluid includes but is not limited to cyst fluid, nose liquid and joint fluid, lotion etc..Life of the invention
Object sample is nose of an ox liquid or joint fluid.Substance as template can be DNA and be also possible to RNA.
The method that method of the invention can be based on PCR.It can also be different from general PCR reaction.It is of the invention at this time
Method include so that reaction system is maintained process at a constant temperature, and reaction temperature is lower, generally need to be 34 DEG C~42
DEG C temperature environment in carry out, and the reaction time also only needs 5~20 minutes, preferably 8~15 minutes.Most preferably embodiment
In, reaction temperature of the invention is 39 DEG C, and the reaction time is 10 minutes.
In an exemplary embodiment, reaction system of the invention (not including template) includes:
Mycoplasma bovis and mycoplasma agalactiae known in the art conventionally used for difference different plant species or strain 16S rRNA,
Even equal table on film surface lipoprotein family gene relevant to mycoplasma pathogenic mechanism or even the whole genome sequence of the two
Great similitude is revealed.This brings great challenge for the specific detection of Mycoplasma bovis.The present invention passes through mass data
Analysis and screening, therefrom discovery is conventional with antigenicity associated LppA gene, and specific region especially therein can be used to
The primer target region of design recombination polymerization amplified reaction.
Composition of the invention can be special in streptococcus pneumonia, Klebsiella, pseudomonas aeruginosa detection
M.bovis out, and these compositions not only can detecte out M.bovis type strain PG45 can also detect that M.bovis open country
Raw strain ltb and WWM.When these compositions are used for the detection of Mycoplasma bovis, it can accomplish conservative and ox in Mycoplasma bovis kind
Specificity between mycoplasma and other pathogenic species is based on the discovery, weight of the present invention design for the specific region of the gene
The oligonucleotide sequence of group polymerization amplified reaction.
In preferred embodiments, present invention optimizes reaction systems, and obtain optimum reacting time and best anti-
Temperature is answered, so that the specificity of detection, sensibility, repeatability be made to greatly promote with stability, it is good, quick that foundation obtains specificity
Perception is high and can stablize duplicate M.bovis rapid detection method.
In addition, the scheme established of the invention method when detecting M.bovis is easy to operate, and it is convenient time saving, without big
The experimental instrument and equipment of type is very suitable to personnel's operation of no any experiment basis in field or field quick detection, is worth
It promotes the use of.
In conclusion the detection target of composition of the invention is the LppA gene of Mycoplasma bovis, the gene can be directed to
In a variety of different fragments, and a variety of specific combination situations of difference can be designed by experimental verification composition of the invention
It, in addition can be by Ago-Gel to be applied to a variety of amplification methods such as normal PCR, basic RPA, nfo RPA and exo-RPA
Electrophoresis, flow measurement chromatograph test strip and constant temperature amplified fluorescence instrument carry out observation experiment result.Group of the invention, which is combined, can accomplish ox
Mycoplasma type strain and the conservative and Mycoplasma bovis in wild strain kind and the specificity between other pathogenic species.Based on this hair
Bright composition can establish specificity it is good, sensibility is high and can stablize duplicate Mycoplasma bovis rapid detection method, have behaviour
Make simple, convenient time saving, the experimental instrument and equipment without large size.
Detailed description of the invention
Fig. 1: the first amplified reaction testing result figure of Mycoplasma bovis mark gene LppA.M: molecular mass standard 1: ox branch
Pathogens Standard strain PG45 2: Mycoplasma bovis wild strain Ltb 3: Mycoplasma bovis wild strain WWM 4: mycoplasma ovine pneumoniae type strain
Y98 5: mycoplasma agalactiae type strain PG2 6: Mycoplasma mycoides subsp.capri type strain PG3 7: mycoplasma capri goat pneumonia
Subspecies type strain F38 8: Pasteurella 9: staphylococcus aureus 10: Klebsiella 11: 12: Ju Quansha thunder of streptococcus pneumonia
Bacterium 13: salmonella 14: Escherichia coli 15: Pseudomonas aeruginosa 16: no template control.
Fig. 2: for the time response gradient result observation schematic of the second amplified reaction of LppA gene.M: molecular mass
Standard；1:0min；2:5min；3:10min；4:15min；5:20min；6:25min；7:30min；8:35min；9:40min；
10:45min；C: no template control.
Fig. 3: for the thermotonus gradient result observation schematic of the second amplified reaction of LppA gene.M:DNA molecule
Quality standard；1:34 DEG C；2:35 DEG C；3:36 DEG C；4:37 DEG C；5:38 DEG C；6:39 DEG C；7:40 DEG C；8:41 DEG C；9:42 DEG C；C: nothing
Template Controls.
Fig. 4: for the specific reaction result observation schematic of the second amplified reaction of LppA gene.M: molecular mass mark
Standard 1: Mycoplasma bovis type strain PG45 2: Mycoplasma bovis wild strain Ltb 3: Mycoplasma bovis wild strain WWM 4: pneumonia of sheep branch is former
Body type strain Y98 5: mycoplasma agalactiae type strain PG2 6: Mycoplasma mycoides subsp.capri type strain PG3 7: mycoplasma capri
Goat pneumonia subspecies type strain F38 8: Pasteurella 9: staphylococcus aureus 10: Klebsiella 11: streptococcus pneumonia 12:
Serratia fonticola 13: salmonella 14: Escherichia coli 15: Pseudomonas aeruginosa 16: no template control.
Fig. 5: for the sensitive response result observation schematic of the second amplified reaction of LppA gene.M:DNA molecule matter
Amount standard；1:6 × 1010；2:6 × 109；3:6 × 108；4:6 × 107；5:6 × 106；6:6 × 105；7:6 × 104；8:6 × 103；
9:6 × 102；10:6 × 101；10:6 × 100；C: no template control.
Fig. 6: for batch interior repeated result observation schematic of the second amplified reaction of LppA gene.
Fig. 7: for LppA gene the second amplified reaction batch between repeated result observation schematic.
Fig. 8: for the third amplified reaction result observation schematic of LppA gene.
Fig. 9: for the time response gradient result observation schematic of the third amplified reaction of LppA gene.
Figure 10: for the thermotonus gradient result observation schematic of the third amplified reaction of LppA gene.
Figure 11: for the specific reaction result observation schematic of the third amplified reaction of LppA gene.
Figure 12: for the sensitive response result observation schematic of the third amplified reaction of LppA gene.
Figure 13: for batch interior repeated result observation schematic of the third amplified reaction of LppA gene.
Figure 14: for LppA gene third amplified reaction batch between repeated result observation schematic.
Figure 15: for the fluoroscopic examination result figure of the 4th amplified reaction of LppA gene.In Figure 15, tube1: for Niu Zhiyuan
Body type strain PG45 tube2: Mycoplasma bovis wild strain Ltb tube3: Mycoplasma bovis wild strain WWM tube4: pneumonia of sheep branch
Pathogens Standard strain Y98 tube5: mycoplasma agalactiae type strain PG2 tube6: Mycoplasma mycoides subsp.capri type strain PG3
Tube7: mycoplasma capri goat pneumonia subspecies type strain F38 tube8: Pasteurella tube9: staphylococcus aureus
Tube10: Klebsiella tube11: streptococcus pneumonia tube12: Serratia fonticola tube13: salmonella tube14: large intestine
Bacillus tube 15: Pseudomonas aeruginosa tube 16: no template control.In the curve of Figure 15, first three curve is followed successively by from top to bottom
Tube1, tube2 and tube3.
Specific embodiment
The existing various exemplary embodiment that the present invention will be described in detail, the detailed description are not considered as to limit of the invention
System, and it is understood as the more detailed description to certain aspects of the invention, characteristic and embodiment.
It should be understood that it is to describe special embodiment that heretofore described term, which is only, it is not intended to limit this hair
It is bright.In addition, for the numberical range in the present invention, it is thus understood that specifically disclose the range upper and lower bound and they it
Between each median.Median and any other statement value in any statement value or stated ranges or in the range
Lesser range is also included in the present invention each of between interior median.These small range of upper and lower bounds can be independent
Ground includes or excludes in range.
Unless otherwise stated, all technical and scientific terms used herein has the routine in field of the present invention
The normally understood identical meanings of technical staff.Although the present invention only describes preferred method and material, of the invention
Implement or also can be used and similar or equivalent any method and material described herein in testing.The institute mentioned in this specification
There is document to be incorporated by reference into, to disclosure and description method relevant to the document and/or material.It is incorporated to any
When document conflicts, it is subject to the content of this specification.Unless otherwise stated, " % " is the percentage based on weight.
Since M.bovis and mycoplasma agalactiae homology are very high, the similarity of the two 16S rRNA is up to 96%, so seeking
Look for other identifier gene extremely important for the specific detection of M.bovis.The present invention not only considers when selection identifies gene
The conservative or homology of gene, so that discovery is directed to LppA gene, oligonucleotides is designed in specific region especially therein
Detection M.bovis that can be quick, special.
Still further, it was discovered that the primer of thus obtained recombination polymerization amplified reaction can be used for normal PCR reaction, and
With excellent amplification.This is general PCR primer from the primer known in the art for the design of different conservative genes
Or the custom primer for LAMP.The viewpoint that these primers cannot be used for the recombination polymerization reaction under room temperature is entirely different.
Embodiment 1
The present embodiment is the detection architecture for the first amplified reaction of specific gene LppA, that is, passes through polymerase chain type
React the process detected to specific gene.Wherein specifically include the following contents:
(1) detection architecture of the first amplified reaction of the invention:
(2) PCR reaction condition:
Wherein:
Lppa F:ACTCTTCAGAAATAACAGACACTTCATC(SEQ ID No.5)；
Lppa R:GAGTTGTCTGCATTAGTTGCGTAATC(SEQ ID No.6)。
(3) testing result: 5 μ L reaction products, Ago-Gel (1.5%) electrophoresis detection, detection are taken after reaction
Shown in the result is shown in Figure 1.
Embodiment 2
The present embodiment is the detection architecture for the second amplified reaction of specific gene LppA, i.e. basis (basic) RPA
Detection architecture.Wherein specifically include the following contents:
(1) building of detection architecture of the invention:
Lppa F:ACTCTTCAGAAATAACAGACACTTCATC(SEQ ID No.5)；
Lppa R:GAGTTGTCTGCATTAGTTGCGTAATC(SEQ ID No.6)。
The template to be measured and 1.25 μ L MgoAC of 1 μ L, brief centrifugation after vortex, by it are added after above-mentioned reaction solution is mixed
Reaction solution is put into 39 DEG C of water-baths, reacts 20min.As a result it detects: taking 5 μ L reaction products, Ago-Gel after reaction
(1.5%) electrophoresis detection.
(2) exploration of optimum reacting time
After establishing reaction system, setting 0min~45min time gradient, which is reacted, explores its optimum reacting time, discovery reaction
5min can start to generate amplified production, and 10min can form visible testing result, and 15min starts to react gradually stable, to make
It reacts more stable, sets 20min as optimum reacting time.Testing result is as shown in Figure 2.
(3) exploration of optimal reaction temperature
Using 20min as optimum reacting time, 34 DEG C~42 DEG C reaction temperature gradients are set, find it in 34 DEG C~42 DEG C
It can react, temperature gradient testing result is as shown in figure 3, have the generation of specific amplification band, and item at 34~42 DEG C
Band is brighter, selects at 39 DEG C to be optimal reaction temperature.
(4) specificity detected
Using 10min as optimum reacting time, 39 DEG C are optimal reaction temperature, detect the specificity of reaction of the invention, are examined
It surveys result and sees Fig. 4.As shown in figure 4, being only capable of detecting M.bovis type strain PG45 and wild strain Ltb and WWM, cannot detect
Remaining pathogenic bacteria out.
(5) sensibility detected
Under the premise of specificity is good, the target fragment of LppA gene is cloned, calculates its copy number, and carry out 10 times of ladders
Degree dilution finds that the bottom line that can be detected is 6 × 101, significantly larger than the 6 × 10 of PCR method3, testing result is as shown in Figure 5.
(6) stability detected
After the specificity and sensibility for having probed into reaction, the stability of reaction need to be detected.Therefore selection 6 × 107、
6×106、6×105The positive plasmid standard items of three various concentrations, under identical conditions in triplicate, the interior repetition of observation batch
Effect, batch internal stability testing result is as shown in Figure 6；The positive plasmid standard items for taking above-mentioned 3 various concentrations, in the same reality
In testing in triplicate, observation batch between repeating effect, batch between stability experiment result as shown in Figure 6.
After method for building up, my 5, area, 53, pasture clinical sample is detected, is detected and is detected using the second amplification system
Positive sample 17, clinical sample is compared with traditional molecular biology for detection PCR, detection coincidence rate is up to 96%.
The second amplification system for illustrating that this experiment is established works well.
Embodiment 3
The present embodiment is the system of the third amplified reaction based on specific gene LppA, i.e. nfo RPA.
It is specific as follows:
(1) building of detection architecture of the invention:
First detection architecture:
Wherein, Primer free Rehydration buffer is known commercially available product.
Containing the whole enzymes and reagent needed for reacting in the basic mixture, template and corresponding widow need to only be added wherein
Nucleotide.The magnesium acetate (MgOAc) for needing addition such as 1.25 μ l concentration to be 280mM before the reaction is opened into mixture system
Dynamic reaction.Amplified production is obtained after reaction, product can be used and be detected with markd flow measurement chromatograph test strip at this time.Work as inspection
When surveying product in conjunction with test strips, positive sample can be all displayed in red at detection line and nature controlling line, and negative sample only can be
It accuses and is displayed in red at line, test strips failure is proved when nature controlling line is not displayed in red, be invalid testing result.Test paper detection
As a result as shown in Figure 8.
(2) exploration of optimum reacting time
It selects LppA gene to carry out the experiment conditions of following recombination polymerization amplifications, designs following oligonucleotides and recombinate and gather
Amplified reaction is closed, so that the method for establishing quickly detection M.bovis, specific experiment process are as follows:
The sequence of LppA F is as follows:
GAAAACATATGATTCATTATGCTAGACACACTTTAAA (including SEQ ID No.2)
The sequence of LppA R is as follows:
(Biotin) TAGTAAGCGAGCCGTAAAACGGATAAACTATAGCTTTG (including SEQ ID No.3)
The sequence of LppA P is as follows:
(FAM) CAAGCATAAATAATCCAAATAAGCTACGTTT/idSp/GTCAGGTATTT GTTTAC (P) (includes
SEQ ID No.4)。
Reaction system:
It is added in reaction tube and mixes well after above-mentioned reaction solution is mixed, the template to be measured and 1.25 μ L of 1 μ L is added
MgOAC, brief centrifugation after vortex, is put in 39 DEG C of water-baths, reacts 10min.After reaction, 2 μ L reaction solutions and 100 μ L are taken
Detection buffer mixes well in sterile 1.5mL centrifuge tube, flow measurement chromatograph test strip is inserted into mixed liquor, i.e. observable
Reaction result.
After establishing reaction system, setting 0min~45min time gradient, which is reacted, explores its optimum reacting time, discovery reaction
5min can produce macroscopic testing result, to keep reaction more stable, set 10min as optimum reacting time.Detection
As a result as shown in Figure 9.
(3) exploration of optimal reaction temperature
Using 10min as optimum reacting time, 34 DEG C~42 DEG C reaction temperature gradients are set, find it in 34 DEG C~42 DEG C
It can react, testing result is as shown in Figure 10, and more demonstrating reaction of the invention can carry out at normal temperature.Instead
The red of detection line is deeper when answering 39 DEG C in result, so selecting at 39 DEG C to be optimal reaction temperature.
(4) specificity detected
Using 10min as optimum reacting time, 39 DEG C are optimal reaction temperature, detect the specificity of reaction of the invention, are examined
It surveys shown in the result is shown in Figure 11, it is identical as the testing result of PCR, it is only capable of detecting M.bovis type strain PG45 and wild strain Ltb
And WWM, it cannot detect remaining pathogenic bacteria, it was demonstrated that its specificity is good.
(5) sensibility detected
Under the premise of specificity is good, the target fragment of LppA gene is cloned, calculates its copy number, and carry out 10 times of ladders
Degree dilution finds that the bottom line that reaction of the invention can detect is 3 × 101, testing result is as shown in Figure 12.
(6) stability detected
After the specificity and sensibility for having probed into reaction, the stability of reaction need to be detected.Therefore selection 3 × 107、
3×106、3×105The positive plasmid standard items of three various concentrations, under identical conditions in triplicate, the interior repetition of observation batch
Effect, batch internal stability testing result is as shown in Figure 13；The positive plasmid standard items for taking above-mentioned 3 various concentrations, same
In experiment in triplicate, the repeating effect between observation batch, between batch shown in stability experiment the result is shown in Figure 14.
After method for building up, my 5, area, 53, pasture clinical sample is detected, finds third amplification system of the invention
Detection positive sample 22, clinical sample is detected with traditional molecular biology for detection, find testing result
Coincidence rate with PCR testing result is 94%.
Embodiment 4
The present embodiment is the system of the 4th amplified reaction based on specific gene LppA, i.e. exo-RPA.
It is specific as follows:
(1) building of detection architecture of the invention:
First detection architecture:
Wherein, Primer free Rehydration buffer is known commercially available product.
Containing whole enzymes and reagent needed for reaction in the basic mixture, 1 μ L template and corresponding need to only be added wherein
Oligonucleotides.Need to be added magnesium acetate (MgOAc) that such as 1.25 μ l concentration are 280mM before the reaction to mixture system
Middle starting reaction.Reaction result carries out in constant temperature amplified fluorescence instrument, can real-time detection reaction.
Specifically, the Lppa F in the sequence Yu embodiment 1 of the first oligonucleotides LppA F of the present embodiment:
ACTCTTCAGAAATA ACAGACACTTCATC (SEQ ID No.5) is identical.
The second oligonucleotide sequence LppA R and the Lppa R in embodiment 1 of the present embodiment:
GAGTTGTCTGCATTAGTTGCGTAATC (SEQ ID No.6) is identical.
The third oligonucleotide sequence LppA P of the present embodiment is as follows: TACCTAGAGAAA
TATTGGGTTTATATCCCTCA/i6FAMdT/T/idSp/A/iBHQ1dT/AGGAAGTACA ATTCTT (includes SEQ ID
No.7, and there is modification group i6FAMdT/T/idSp/A/iBHQ1dT between the 33rd to 34).
In a kind of exemplary reaction system, it includes:
It is added in reaction tube and mixes well after above-mentioned reaction solution is mixed, the template to be measured and 1.25 μ L of 1 μ L is added
MgOAC, brief centrifugation after vortex, is put into constant temperature amplified fluorescence instrument and reacts 15min.Computer, real-time observing response can be connected
As a result.Specificity as shown in Figure 15, can only amplify Mycoplasma bovis type strain PG45, wild strain LTb and wild strain WWM.
The present invention polymerize the specific primer and probe of amplified reaction by the design recombination to specific gene LppA, right
Optimum reacting time is explored with optimal reaction temperature, the specificity of detection, sensibility, repeatability with stability, is looked for
Optimum reaction condition is arrived, the specificity of foundation is good, sensibility is high and can stablize duplicate M.bovis rapid detection method.
The method of detection M.bovis established by the present invention is easy to operate, convenient time saving, without large-scale experimental instrument and equipment, very
It is suitble to the personnel of no any experiment basis to operate, is worth of widely use.
Although describing the present invention by reference to exemplary implementation scheme, however, it is to be understood that the present invention is not limited to disclosed examples
Property embodiment.It, can be to the exemplary embodiment party of description of the invention without departing substantially from the scope or spirit of the invention
Case makes a variety of adjustment or change.The scope of the claims of the invention should be covered all modifications and is equal based on widest explanation
Structure and function.
Sequence table
<110>Ningxia University
It<120>is composition, kit and the method for detecting target and carrying out Mycoplasma bovis detection with LppA gene
<130> BH1900189-1
<141> 2019-09-09
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1152
<212> DNA
<213> Mycoplasma bovis
<400> 1
atgattaaaa gagtaactaa attattatct tcacaacttg taattttgcc tatggttctt 60
ccgttgttat cttctaaatg tgataaacaa actaataaca atgatagcaa ctcttcagaa 120
ataacagaca cttcatctaa ctactttgac gaaagagcca atctagcatc gcctgcaaca 180
ttacctagag aaatattggg tttatatccc tcattaatag gaagtacaat tcttaataat 240
cttaaattag aagcaaatag aaaacaaaat cctaactcag attacgcaac taatgcagac 300
aactctggct ttggattatt attcaaaaaa gagaaaaatc tttttattga tgaaatgccg 360
tcacttcata aagaattaga gaaaatattc tttaatttta atcctaaata tacttcaaaa 420
tatgaagcta aaatagtggc tgctggcttt aacgatcttg aaggcgaatt aactcttggc 480
attcaaattt tatatagacc tgatacagct attgaaaata ctaacaacaa tacctatttt 540
caaagtttta aatttactgg ctttagaaaa tttgacttaa caaacagcga taataatgtt 600
ttaaaactaa aatttgacaa tcaaaattta gccaacatat ctaaaaaatg aagaaaacat 660
atgattcatt atgctagaca cactttaaaa aaagctatga ctgaaaatac ttcacttgca 720
agcataaata atccaaataa gctacgtttt gtcaggtatt tgtttacacc gcatttttta 780
ctaagtgaaa tacctttgaa tattaaagat gatacaaaca tttataacat taaagataat 840
aatttgactc tttttgatgt attttctcgt gaccacaaag ctatagttta tccgttttac 900
ggctcgctta ctagttttga tgatattttc gatataccaa ataatgattc tgttaagttt 960
gacatataca aaaattctga aaataaagaa atcttaaaaa ttactattaa ccttactata 1020
gtgccagggg ttcaaaatat atacacaaat attgaaagaa gcactaaaga caagaagaag 1080
gtgacattta gttttcaagt cgaagctcct tttgatgaat tattgcctga taataatcct 1140
gttgataatt aa 1152
<210> 2
<211> 37
<212> DNA
<213> Artificial Sequence
<400> 2
gaaaacatat gattcattat gctagacaca ctttaaa 37
<210> 3
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 3
tagtaagcga gccgtaaaac ggataaacta tagctttg 38
<210> 4
<211> 48
<212> DNA
<213> Artificial Sequence
<400> 4
caagcataaa taatccaaat aagctacgtt tgtcaggtat ttgtttac 48
<210> 5
<211> 28
<212> DNA
<213> Artificial Sequence
<400> 5
actcttcaga aataacagac acttcatc 28
<210> 6
<211> 26
<212> DNA
<213> Artificial Sequence
<400> 6
gagttgtctg cattagttgc gtaatc 26
<210> 7
<211> 48
<212> DNA
<213> Artificial Sequence
<400> 7
tacctagaga aatattgggt ttatatccct caaggaagta caattctt 48
Claims (10)
1. a kind of for detecting the composition of Mycoplasma bovis, which is characterized in that including can be miscellaneous with the LppA gene of Mycoplasma bovis
The buffer of the first oligonucleotides, the second oligonucleotides and dissolution first oligonucleotides and the second oligonucleotides handed over,
In:
The first area selective cross of first oligonucleotides and the LppA gene, second oligonucleotides with it is described
The second area selective cross of LppA gene, and the first area is located at 5 ' end sides of the LppA gene, described second
Region is located at 3 ' end sides of the LppA gene, the distance between the first area and the second area 50bp~
Between 2000bp.
2. according to claim 1 for detecting the composition of Mycoplasma bovis, which is characterized in that the sequence of the LppA gene
Column are as shown in SEQ ID No.1.
3. according to claim 1 for detecting the composition of Mycoplasma bovis, which is characterized in that the pH of the buffer is
6.9~7.0, and the concentration of first oligonucleotides and second oligonucleotides in the buffer is respectively
0.5~1 μm of ol/L.
4. according to claim 1 for detecting the composition of Mycoplasma bovis, which is characterized in that further comprise third widow
Nucleotide, and the third oligonucleotides hybridizes with the third regioselectivity of the LppA gene, the third region is located at
Between the first area and the second area.
5. according to claim 4 for detecting the composition of Mycoplasma bovis, which is characterized in that first oligonucleotides
Length be 35~45nt；The length of second oligonucleotides is 35~50nt, and its 5 ' end is marked with Biotin；It is described
The length of third oligonucleotides is 40~55nt, and its 5 ' end, with detectable group, 3 ' ends, which have, terminates phosphate group and position
THF cleavage site among the third oligonucleotides.
6. according to claim 5 for detecting the composition of Mycoplasma bovis, which is characterized in that first oligonucleotides
Sequence as shown in SEQ ID No.2, the sequence of second oligonucleotides is as shown in SEQ ID No.3, the SEQ ID
Shown in No.4, and there is THF cleavage site among the third oligonucleotides the 31st to 32.
7. a kind of for detecting the kit of Mycoplasma bovis, which is characterized in that including described in any one according to claim 1~6
Composition.
8. a kind of method for detecting Mycoplasma bovis, which comprises the following steps:
(1) template of the biological sample from ox is provided；
(2) make the template and described in any item composition anabolic reaction systems according to claim 1~6,34 DEG C~42
It reacts the reaction system 5~20 minutes and obtains amplified production；
(3) amplified production is detected.
9. according to the method described in claim 8, it is characterized in that, the detection amplified production includes that amplified production is made to carry out fine jade
The step of sepharose electrophoresis.
10. according to the method described in claim 8, it is characterized in that, the detection amplified production includes making amplified production and band
Markd flow measurement chromatograph test strip contact, when being all displayed in red at detection line and nature controlling line, determines the biological sample
For positive sample, when being displayed in red at nature controlling line and detection line does not develop the color, determine the biological sample for negative sample, when
Test strips failure is proved when nature controlling line is not displayed in red.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910847999.6A CN110499376B (en) | 2019-09-09 | 2019-09-09 | Composition, kit and method for detecting mycoplasma bovis by taking LppA gene as detection target |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910847999.6A CN110499376B (en) | 2019-09-09 | 2019-09-09 | Composition, kit and method for detecting mycoplasma bovis by taking LppA gene as detection target |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110499376A true CN110499376A (en) | 2019-11-26 |
| CN110499376B CN110499376B (en) | 2023-07-25 |
Family
ID=68591490
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910847999.6A Active CN110499376B (en) | 2019-09-09 | 2019-09-09 | Composition, kit and method for detecting mycoplasma bovis by taking LppA gene as detection target |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110499376B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868167A (en) * | 2017-03-23 | 2017-06-20 | 山东师范大学 | Primer, probe and kit for field quick detection Mycoplasma bovis |
| CN110229919A (en) * | 2019-06-26 | 2019-09-13 | 宁夏大学 | For detecting the composition, kit and method of Mycoplasma bovis |
-
2019
- 2019-09-09 CN CN201910847999.6A patent/CN110499376B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868167A (en) * | 2017-03-23 | 2017-06-20 | 山东师范大学 | Primer, probe and kit for field quick detection Mycoplasma bovis |
| CN110229919A (en) * | 2019-06-26 | 2019-09-13 | 宁夏大学 | For detecting the composition, kit and method of Mycoplasma bovis |
Non-Patent Citations (2)
| Title |
|---|
| J.B. BASHIRUDDIN 等: "Evaluation of PCR systems for the identification and differentiation of Mycoplasma agalactiae and Mycoplasma bovis:A collaborative trial", 《EVALUATION OF PCR SYSTEMS FOR THE IDENTIFICATION AND DIFFERENTIATION OF MYCOPLASMA AGALACTIAE AND MYCOPLASMA BOVIS:A COLLABORATIVE TRIAL》 * |
| 陈嘉等: "Leachii支原体PCR检测方法的建立与应用", 《中国预防兽医学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110499376B (en) | 2023-07-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fenollar et al. | Molecular diagnosis of bloodstream infections caused by non-cultivable bacteria | |
| Oliveira et al. | Characterization of the diversity of Haemophilus parasuis field isolates by use of serotyping and genotyping | |
| CN110229919B (en) | Compositions, kits and methods for detecting mycoplasma bovis | |
| Emanuel et al. | Detection of Francisella tularensis within infected mouse tissues by using a hand-held PCR thermocycler | |
| CN105420379A (en) | Real-time fluorescence quantification PCR detecting kit for cow mycoplasma and special primers and TaqMan probe thereof | |
| CN110453011A (en) | A kind of method and application based on CRISPR/Cas12a fast accurate detection African swine fever virus | |
| CN108048584A (en) | The brucellar probe of RAA Fluorometric assays and kit | |
| CN112899383B (en) | Yersinia pestis detection kit based on real-time fluorescence RPA technology and application thereof | |
| CN106191239A (en) | A kind of real-time PCR detection mycoplasma pneumoniae nucleic acid and the primer of medicament-resistant mutation, probe, method and test kit | |
| CN110016512A (en) | The multiple fluorescence quantitative PCR detection kit and method of three kinds of bovine respiratory pathogen are detected simultaneously | |
| CN106834506A (en) | A kind of LAMP primer group of quick detection bacterium polymyxins drug resistant gene mcr 1, kit and detection method | |
| CN110373485A (en) | A kind of ureaplasma urealyticum, three joint inspection kit of chlamydia trachomatis and gonococcus | |
| CN110396557A (en) | A kind of specific HPV nucleic acid detection method based on CRISPR/Cas12a | |
| CN109234419A (en) | Bacillus anthracis double fluorescent quantitative PCR detection kit and detection method | |
| CN109306372A (en) | A kind of method nest-type PRC detection or/and identify brucella | |
| CN111088380A (en) | Brucella LF-RPA detection primer, probe and detection kit | |
| US7960106B2 (en) | Diagnostic method and products useful therein | |
| CN110257539A (en) | For detecting the composition, kit and method of mycoplasma ovine pneumoniae | |
| Tabibnejad et al. | The optimization of molecular detection of clinical isolates of Brucella in blood cultures by eryD transcriptase gene for confirmation of culture-negative samples | |
| CN110499376A (en) | It is composition, kit and the method for detecting target and carrying out Mycoplasma bovis detection with LppA gene | |
| CN116004874A (en) | Primer combination and kit for detecting Chlamydia psittaci based on isothermal amplification method | |
| CN114438238B (en) | Primer for detecting infectious endocarditis pathogen and digital PCR kit | |
| Loens et al. | Development of conventional and real-time NASBA® for the detection of Legionella species in respiratory specimens | |
| CN104789657A (en) | Method for detecting bartonella elizabethae with TaqMan real-time fluorescent quantitative PCR | |
| CN108048586A (en) | A kind of detection method of ox kind Brucella sp attenuated vaccine strain S19 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |