CN110229919B

CN110229919B - Compositions, kits and methods for detecting mycoplasma bovis

Info

Publication number: CN110229919B
Application number: CN201910560295.0A
Authority: CN
Inventors: 郝秀静; 李敏; 韩杨; 马春骥
Original assignee: Ningxia University
Current assignee: Ningxia University
Priority date: 2019-06-26
Filing date: 2019-06-26
Publication date: 2023-07-25
Anticipated expiration: 2039-06-26
Also published as: CN110229919A

Abstract

The invention discloses a composition, a kit and a method for detecting mycoplasma bovis. According to the invention, accurate detection of mycoplasma bovis is completed by designing the specific primer and probe of the LppA gene of mycoplasma bovis, and the primer and probe combination can achieve conservation in mycoplasma bovis standard strains and wild strains and specificity between mycoplasma bovis and other pathogenic bacteria. The invention explores the optimal reaction time and the optimal reaction temperature, the specificity, the sensitivity, the repeatability and the stability of the detection in the detection process, finds the optimal reaction condition, establishes the quick detection method of mycoplasma bovis which has good specificity, high sensitivity and can stably repeat, has the advantages of simple operation, convenience and time saving, does not need large-scale experimental instrument equipment, and is very suitable for personnel operation without any experimental foundation.

Description

Compositions, kits and methods for detecting mycoplasma bovis

Technical Field

The invention relates to the technical field of molecular biology, in particular to a composition, a kit and a method for quickly detecting mycoplasma bovis.

Background

Mycoplasma bovis (m.bovis), belonging to the kingdom of prokaryotes, phylum firmicutes, class mollicutes, order Mycoplasma, family Mycoplasma, genus Mycoplasma, is a pathogen that primarily infects the respiratory tract of cattle and is capable of continuously infecting the host, causing a variety of chronic diseases including bovine pneumonia, such as mastitis, otitis media, reproductive disorders, arthritis, meningitis, and keratoconjunctivitis, etc., which are often referred to as Mycoplasma bovis-associated diseases (Mycoplasma bovis associated disease, mbAD).

Current methods for detecting mycoplasma bovis generally include the following. The culture method is a direct evidence for the detection of the presence of pathogens and is a gold standard for the detection of m. Once detected, diagnosis can be confirmed. The method can be classified into a general solid culture method and a rapid culture method. However, because M.bovis grows slowly, the first separation from clinical samples generally needs 2-4 generations of blind transmission to see colonies on a solid medium through a microscope, and detection results can be obtained only by a few days, so that the detection rate is low, and the defects of excessive time consumption, complex intermediate links, high requirements on culture conditions and the like exist, so that certain difficulty is brought to the clinical separation of M.bovis, and the method is not suitable for clinical rapid diagnosis. The serological detection technology has the advantages of higher specificity, better sensitivity, rapidness, easiness in operation and the like, is very suitable for rapid examination of clinical samples and large-scale epidemiological investigation, but most mycoplasma have common antigens, and are easy to cause false positive experimental results. The immunohistochemical technology is a technology combining histology and immunology, and is characterized in that in situ of tissue cells, the corresponding antigen or antibody is positioned, qualitatively and quantitatively detected by means of visible markers through antigen-antibody specific binding reaction and histochemical chromogenic reaction, but when the disease is not serious or the deviation of a selected focus part is large, the existence of M.bovis is difficult to detect by immunohistochemistry. Among the numerous detection methods, the polymerase chain reaction is a simple and effective detection method. The PCR method has the advantages of rapid detection, high specificity and sensitivity, no living body of a detection sample, no influence of the immune function, the course of disease, the infection degree, the presence or absence of drug treatment and the lack of reaching the serum detection level of a patient, and the early diagnosis and the correct selection of antibiotics are possible. Has positive significance for early and non-antibody-producing patients and infected patients with disappeared antibodies; is helpful for early diagnosis and timely treatment, has no cross reaction and radioactive pollution, and is easy to standardize. Although the PCR method is rapid in detection, and can replace a culture method in a certain sense, the high sensitivity of the PCR method also makes the requirements of the PCR method on experimental environments and instruments relatively high, and the PCR method has the problems of high requirements on technical conditions, complex operation and difficult popularization, is difficult to develop in a basic laboratory, and has relatively high price.

Disclosure of Invention

In order to solve at least part of the technical problems in the prior art, the invention provides a composition, a kit and a method for rapidly and specifically detecting mycoplasma bovis. Specifically, the present invention includes the following:

in a first aspect of the invention, there is provided a composition for detecting mycoplasma bovis comprising a first oligonucleotide, a second oligonucleotide and a third oligonucleotide capable of hybridizing to the LppA gene of mycoplasma bovis.

In the present invention, the length of the first oligonucleotide is generally 35 to 45nt, preferably 35 to 40nt. Preferably, the sequence of the first oligonucleotide is shown in SEQ ID No. 1. In the present invention, the length of the second oligonucleotide is generally 35 to 50nt, preferably 35 to 45nt, and it has a Biotin label at the 5' end. Preferably, the second oligonucleotide has a sequence as shown in SEQ ID No.2 and carries a Biotin tag at the 5' end. In the present invention, the length of the third oligonucleotide is generally 40 to 55nt, preferably 40 to 50nt. The 5' end of the third oligonucleotide carries a detection label, such as a FAM fluorophore. The third oligonucleotide carries a terminating phosphate group at the 3' end. The third oligonucleotide contains a THF cleavage site in the middle of its sequence. Preferably, the third oligonucleotide has the sequence shown in SEQ ID No.3, with FAM at the 5 'end, terminating phosphate at the 3' end and idSp between bases 31-32.

In the present invention, the first oligonucleotide is capable of selectively hybridizing to a first region of the 5 'end of the LppA gene, the second oligonucleotide is capable of selectively hybridizing to a second region of the 3' end of the LppA gene, and the third oligonucleotide is capable of selectively hybridizing to a third region of the LppA gene. Wherein the distance between the first region and the second region is between 50bp and 2000bp, preferably 70 to 1000bp, more preferably 100 to 500bp, for example 100 to 200bp. The third region is located between the first region and the second region.

In a second aspect of the invention there is provided a kit for detecting mycoplasma bovis comprising the composition of the first aspect of the invention.

Kits of the invention may also include precautions related to regulating manufacturing, use, or marketing of the diagnostic kit in a form prescribed by a government agency. The kit may also be provided with detailed instructions for use, storage and troubleshooting. The kit may also optionally be provided in a suitable device, preferably for robotic operation in a high throughput setting.

The components of the kit of the invention may be provided as a dry powder. When the reagents and/or components are provided as dry powders, the powders may be restored by the addition of a suitable solvent. It is contemplated that the solvent may also be disposed in another container. The container will typically include at least one vial, test tube, flask, bottle, syringe, and/or other container means, with the solvent optionally being placed in aliquots. The kit may further comprise a second container means for containing a sterile, pharmaceutically acceptable buffer and/or other solvent.

Where more than one component is present in a kit, the kit will also typically contain a second, third or other additional container in which additional components may be placed separately. In addition, combinations of various components may be included in the container.

Kits of the invention may also include components that retain or maintain DNA, such as agents that are resistant to degradation by nucleic acids. Such components may be, for example, either RNase-free or nuclease with protection against RNase. Any of the compositions or reagents described herein may be a component in a kit.

In a third aspect of the invention, there is provided a method for detecting mycoplasma bovis comprising the steps of:

(1) Providing a template of a biological sample derived from a bovine;

(2) The template and the composition form a reaction system, and the reaction is carried out for 5 to 20 minutes at the temperature of between 34 and 42 ℃ to obtain an amplification product;

(3) And (3) enabling the amplified product to be in contact with a flow measurement chromatography test strip with a mark, judging that the biological sample is a positive sample when red is displayed at the detection line and the quality control line, judging that the biological sample is a negative sample when red is displayed at the quality control line and the detection line is not colored, and judging that the test strip is invalid when the quality control line is not red.

The biological sample of the present invention refers to body fluids or secretions derived from the cattle to be tested. Preferably, the biological sample is derived from a cow suffering from a related disease. Examples of body fluids include, but are not limited to, cyst fluid, nasal and joint fluids, milk, and the like. The biological sample of the invention is bovine nasal fluid or joint fluid. The template substance may be DNA or RNA.

Unlike the general PCR reaction, the reaction system of the present invention needs to be carried out in a temperature environment of 34℃to 42℃and the reaction time is only 5 to 20 minutes, preferably 8 to 15 minutes. In a most preferred embodiment, the reaction temperature of the present invention is 39℃and the reaction time is 10 minutes.

In an exemplary embodiment, the reaction system of the present invention (excluding the template) includes:

it is known in the art that mycoplasma bovis and mycoplasma agalactiae exhibit great similarity in the 16S rRNA conventionally used to distinguish between different species or strains, even the membrane surface lipoprotein family genes associated with mycoplasma pathogenesis, or even in the whole genome sequence of both. This presents a great challenge for the specific detection of mycoplasma bovis. The invention discovers that the LppA gene related to antigenicity conventionally, in particular a specific region thereof, can be used for designing a primer target region of a recombinant polymerization amplification reaction through analysis and screening of a large amount of data.

The composition of the invention can specifically detect M.bovis in streptococcus pneumoniae, klebsiella and pseudomonas aeruginosa, and can detect not only M.bovis standard strain PG45 but also M.bovis wild strain ltb and WWM. When the composition is used for detecting mycoplasma bovis, the conservation in mycoplasma bovis species and the specificity between mycoplasma bovis and other pathogenic bacteria can be achieved, and the composition has excellent technical effects.

Furthermore, the invention optimizes the reaction system and obtains the optimal reaction time and the optimal reaction temperature, thereby greatly improving the specificity, sensitivity, repeatability and stability of the detection and establishing an M.bovis rapid detection method which has good specificity, high sensitivity and can stably and repeatedly.

In addition, the method is simple to operate, convenient and time-saving when the established scheme is used for detecting the M.bovis, large-scale experimental instrument equipment is not needed, and the method is very suitable for rapid detection in the field or on site without any experimental foundation and is worthy of popularization and use.

Drawings

Fig. 1: the reaction results of the present invention are schematically observed.

Fig. 2: time response gradient plot for gene LppA.

Fig. 3: temperature response gradient map for gene LppA.

Fig. 4: specific response pattern for gene LppA. M is a molecular mass standard 1, a mycoplasma bovis standard strain PG45 2, a mycoplasma bovis wild strain Ltb 3, a mycoplasma bovis wild strain WWM 4, a mycoplasma ovis standard strain Y98 5, a mycoplasma lactis standard strain PG2 6, a mycoplasma filiformis goat subspecies standard strain PG37, a mycoplasma caprine subspecies caprine pneumonitis standard strain F38, pasteurella 9, staphylococcus aureus 10, klebsiella 11, streptococcus pneumoniae 12, serratia spp 13, salmonella 14, escherichia coli 15, pseudomonas aeruginosa 16 and a template-free control.

Fig. 5: sensitivity response pattern for gene LppA.

Fig. 6: graph of results of in-batch reproducibility against gene LppA.

Fig. 7: graph of results of batch-to-batch reproducibility against gene LppA.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in the present invention, it is understood that the upper and lower limits of the ranges and each intermediate value therebetween are specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control. Unless otherwise indicated, "%" is percent by weight.

Since M.bovis has high homology with Mycoplasma agalactiae, the similarity of 16S rRNA of the M.bovis and Mycoplasma agalactiae can reach 96%, so that searching other marker genes is very important for the specific detection of M.bovis. The invention not only considers the conservation or homology of the gene when selecting the marker gene, but also considers the specific requirement for the primer during the Recombination and Polymerization Amplification (RPA) reaction, thereby finding that the design of the oligonucleotide aiming at the LppA gene, especially the specific region in the LppA gene, can rapidly and specifically detect M.bovis.

In addition, although it is currently known that there are a plurality of conserved genes in Mycoplasma bovis, primers designed for different conserved genes are either general PCR primers or conventional primers used for LAMP. None of these primers can be used in the recombinant polymerization reaction at normal temperature of the present invention. This is because amplification at normal temperature is completely different from PCR in melting of DNA. The conventionally estimated melting point is not suitable for this system. In addition, conventional PCR primers are inefficient for use in the recombinant polymerization reaction of the present invention due to insufficient length. Furthermore, current probes are not suitable for the reactions of the present invention, particularly probe systems currently employing polymerase 5'-3' nuclease activity, which is not compatible with the reactions of the present invention at all. In view of the above, there is no corresponding primer or probe design criteria for the recombinant polymerization reaction of the present invention.

Examples

This example is a detection method of the present invention based on the specific gene LppA. The method comprises the following steps:

(1) The detection system of the invention is constructed by:

first detection system:

among them, primer free Rehydration buffer is a known commercially available product.

A second detection system:

wherein the base mix comprises 5-20 ng/. Mu.L of recombinase, 40-60 ng/. Mu.L of polymerase and 500-1000 ng/. Mu.L of single-stranded binding protein dissolved in a buffer; the buffer solution contains ATP, dNTP, 25-50 mM creatine phosphate, 2.7-4.3 mug/U creatine kinase, 2-6 mM dithiothreitol and 2-8% (w/v) polyethylene glycol, and the pH is 6.0-9.0, and the concentration of NaCl or KCl is 100nM.

The base mixture contains all the enzymes and reagents necessary for the reaction, with the addition of templates and corresponding oligonucleotides. Before the reaction, for example, 2.5. Mu.l of magnesium acetate (MgOAc) at a concentration of 280mM are added to the mixture system to initiate the reaction. The amplified product is obtained after the reaction, and the product can be detected by using a flow-measuring chromatographic test strip with a mark. When the detection product is combined with the test strip, the positive sample can display red at the detection line and the quality control line, while the negative sample can only display red at the command line, and when the quality control line does not display red, the test strip is proved to be invalid, so that the detection result is invalid. The test paper detection result is shown in figure 1.

(2) Exploration of optimal reaction time

On the basis that PCR can specifically detect M.bovis, the experimental conditions for downstream recombinant polymerization amplification of gene LppA are selected, and the following oligonucleotides are designed for the recombinant polymerization amplification reaction, so that a method for rapidly detecting M.bovis is established, wherein the specific experimental process is as follows:

the sequence of the first oligonucleotide (LppA F) is as follows:

GAAAACATATGATTCATTATGCTAGACACACTTTAAA(SEQ ID No.1)

the sequence of the first oligonucleotide (LppA R) is as follows:

(Biotin)TAGTAAGCGAGCCGTAAAACGGATAAACTATAGCTTTG(SEQ ID No.2)

the sequence of the first oligonucleotide (LppAP) is as follows:

(FAM)CAAGCATAAATAATCCAAATAAGCTACGTTT/idSp/GTCAGGTATTTGTTTAC(P)(SEQ ID No.3)。

the reaction system:

mixing the reaction liquid, adding into a reaction tube, fully mixing, adding 1 mu L of template to be detected and 1.25 mu L of MgOAC, swirling, briefly centrifuging, placing into a water bath kettle at 39 ℃, and reacting for 10min. After the reaction, 2 mu L of the reaction solution and 100 mu L of the detection buffer solution are taken and fully and uniformly mixed in a sterile 1.5mL centrifuge tube, and a test strip is inserted into the mixed solution, so that the reaction result can be observed.

After a reaction system is established, the optimal reaction time is explored by setting a time gradient reaction for 0-45 min, and a macroscopic detection result can be generated after the reaction is found for 5min, so that the reaction is more stable, and the optimal reaction time is set to be 10min. The temperature gradient test results are shown in FIG. 2.

(3) Exploration of optimal reaction temperature

The reaction temperature gradient of 34-42 ℃ is set by taking 10min as the optimal reaction time, the reaction can be carried out at 34-42 ℃, the temperature gradient detection result is shown in figure 3, and the reaction can be carried out at normal temperature, and the red color of the detection line is darker at 39 ℃ in the reaction result, so that the optimal reaction temperature at 39 ℃ is selected.

(4) Specificity of the assay

The specificity of the reaction of the present invention was detected with an optimal reaction time of 10min and an optimal reaction temperature of 39℃as shown in FIG. 4, and only M.bovis standard strain PG45 and wild strains Ltb and WWM could be detected, and the remaining pathogenic bacteria could not be detected, as in the PCR detection.

(5) Sensitivity of detection

On the premise of good specificity, the target fragment of LppA gene is cloned, the copy number is calculated, and 10-time gradient dilution is carried out, so that the minimum detectable limit of the reaction of the invention is 3 multiplied by 10 ¹ As shown in FIG. 5, the detection result is far higher than that of the PCR method by 3×10 ³ 。

(6) Stability of detection

After exploring the specificity and sensitivity of the reaction, the stability of the reaction was examined. Therefore, 3×10 is selected ⁷ 、3×10 ⁶ 、3×10 ⁵ Three positive plasmid standard substances with different concentrations are repeated three times under the same condition, the repeated effect in the batch is observed, and the detection result of the stability in the batch is shown in figure 6; the above 3 positive plasmid standards with different concentrations were taken and repeated three times in the same experiment, and the repeated effect between batches was observed, and the results of the batch stability experiment are shown in fig. 7.

After the method is established, 53 clinical samples of 5 pastures in the I area are detected, 22 positive samples are detected by the method, the clinical samples are detected by a traditional molecular biological detection method, and the coincidence rate of the detection result and the PCR detection result is 94%.

The invention searches the optimal reaction time and the optimal reaction temperature, the specificity, the sensitivity, the repeatability and the stability of detection by designing the specific primer and the probe of the recombination, polymerization and amplification reaction of the specific gene LppA, finds the optimal reaction condition, and establishes the M.bovis rapid detection method which has good specificity, high sensitivity and can stably and repeatedly. The method for detecting the M.bovis is simple to operate, convenient and time-saving, does not need large-scale experimental instrument equipment, is very suitable for personnel operation without any experimental foundation, and is worthy of popularization and use.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples are exemplary only.

Sequence listing

<110> university of Ningxia

<120> compositions, kits and methods for detecting mycoplasma bovis

<141> 2019-06-18

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 37

<212> DNA

<213> Artificial Sequence

<400> 1

gaaaacatat gattcattat gctagacaca ctttaaa 37

<210> 2

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 2

tagtaagcga gccgtaaaac ggataaacta tagctttg 38

<210> 3

<211> 48

<212> DNA

<213> Artificial Sequence

<400> 3

caagcataaa taatccaaat aagctacgtt tgtcaggtat ttgtttac 48

<210> 4

<211> 1152

<212> DNA

<213> Mycoplasma bovis

<400> 4

atgattaaaa gagtaactaa attattatct tcacaacttg taattttgcc tatggttctt 60

ccgttgttat cttctaaatg tgataaacaa actaataaca atgatagcaa ctcttcagaa 120

ataacagaca cttcatctaa ctactttgac gaaagagcca atctagcatc gcctgcaaca 180

ttacctagag aaatattggg tttatatccc tcattaatag gaagtacaat tcttaataat 240

cttaaattag aagcaaatag aaaacaaaat cctaactcag attacgcaac taatgcagac 300

aactctggct ttggattatt attcaaaaaa gagaaaaatc tttttattga tgaaatgccg 360

tcacttcata aagaattaga gaaaatattc tttaatttta atcctaaata tacttcaaaa 420

tatgaagcta aaatagtggc tgctggcttt aacgatcttg aaggcgaatt aactcttggc 480

attcaaattt tatatagacc tgatacagct attgaaaata ctaacaacaa tacctatttt 540

caaagtttta aatttactgg ctttagaaaa tttgacttaa caaacagcga taataatgtt 600

ttaaaactaa aatttgacaa tcaaaattta gccaacatat ctaaaaaatg aagaaaacat 660

atgattcatt atgctagaca cactttaaaa aaagctatga ctgaaaatac ttcacttgca 720

agcataaata atccaaataa gctacgtttt gtcaggtatt tgtttacacc gcatttttta 780

ctaagtgaaa tacctttgaa tattaaagat gatacaaaca tttataacat taaagataat 840

aatttgactc tttttgatgt attttctcgt gaccacaaag ctatagttta tccgttttac 900

ggctcgctta ctagttttga tgatattttc gatataccaa ataatgattc tgttaagttt 960

gacatataca aaaattctga aaataaagaa atcttaaaaa ttactattaa ccttactata 1020

gtgccagggg ttcaaaatat atacacaaat attgaaagaa gcactaaaga caagaagaag 1080

gtgacattta gttttcaagt cgaagctcct tttgatgaat tattgcctga taataatcct 1140

gttgataatt aa 1152

Claims

1. A composition for detecting mycoplasma bovis comprising a first oligonucleotide, a second oligonucleotide, and a third oligonucleotide capable of hybridizing to the LppA gene of mycoplasma bovis, wherein:

the first oligonucleotide is hybridized with a first region of the LppA gene selectively, the second oligonucleotide is hybridized with a second region of the LppA gene selectively, the third oligonucleotide is hybridized with a third region of the LppA gene selectively, the first region is positioned at the 5 'end of the LppA gene, the second region is positioned at the 3' end of the LppA gene, the distance between the first region and the second region is 50 bp-2000 bp, the third region is positioned between the first region and the second region, the sequence of the first oligonucleotide is shown as SEQ ID No.1, the sequence of the second oligonucleotide is shown as SEQ ID No.2, the sequence of the third oligonucleotide is shown as SEQ ID No.3, the 5 'end of the sequence of the second oligonucleotide is provided with a Biotin tag, the 5' end of the sequence of the third oligonucleotide is provided with a FAM, and the sequence of the third oligonucleotide is provided with a phosphate group at the 3 'end and the Sp is between the 3' end and 31-32.

2. The composition for detecting mycoplasma bovis of claim 1, further comprising a recombinase enzyme, a polymerase, and a single-chain binding protein.

3. The composition for detecting mycoplasma bovis of claim 1, further comprising a buffer, the buffer comprising an energy substance, dithiothreitol, and polyethylene glycol, and having a pH of 6.0-9.0, a concentration of nacl or KCl within 0-200 nm, and the energy substance comprising NTP/dNTP, creatine phosphate, and creatine kinase.

4. The composition for detecting mycoplasma bovis according to claim 3, further comprising acetate.

5. A kit for detecting mycoplasma bovis, comprising a composition according to any one of claims 1-4.

6. Use of a reagent in the preparation of a kit for detecting mycoplasma bovis, characterized in that said reagent comprises a composition according to any one of claims 1-4, said detection comprising the steps of:

(1) Providing a template of a biological sample derived from a bovine;

(2) Forming a reaction system by the template and the composition according to any one of claims 1-4, and reacting the reaction system at 34-42 ℃ for 5-20 minutes to obtain an amplification product;

(3) And (3) enabling the amplification product to be in contact with a flow measurement chromatography test strip with a mark, judging that the biological sample is a positive sample when red is displayed at a detection line and a quality control line, judging that the biological sample is a negative sample when red is displayed at the quality control line and the detection line is not colored, and judging that the test strip is invalid when the quality control line is not red.

7. The use according to claim 6, wherein the reaction system comprises:

10mmoL/L first oligonucleotide 1.2. Mu.L

10mmoL/L second oligonucleotide 1.2. Mu.L

10mmoL/L third oligonucleotide 0.6. Mu.L

Buffer 14.75. Mu.L

ddH ₂ O 6.6μL。

8. The use according to claim 7, wherein the reaction temperature is 39 ℃ and the reaction time is 10 minutes.