CN110564877B

CN110564877B - Composition, kit and method for detecting mycoplasma ovipneumoniae by taking transketolase gene as target

Info

Publication number: CN110564877B
Application number: CN201910871216.8A
Authority: CN
Inventors: 李敏; 郝秀静; 金华; 马春骥; 王玉炯
Original assignee: Ningxia University
Current assignee: Ningxia University
Priority date: 2019-09-16
Filing date: 2019-09-16
Publication date: 2023-04-21
Anticipated expiration: 2039-09-16
Also published as: CN110564877A

Abstract

The invention discloses a composition, a kit and a method for detecting mycoplasma ovipneumoniae by taking a transketolase gene as a target. The detection target of the composition is a transketolase gene of mycoplasma ovipneumoniae, various different fragments in the gene can be aimed at, and experiments prove that the composition can be designed into various different specific combination situations so as to be applied to various amplification methods such as traditional PCR (polymerase chain reaction), basic RPA (reactive power amplification), nfo RPA (reactive power amplification), exo RPA (reactive power amplification) and the like, and experimental results can be observed by means of agarose gel electrophoresis, a lateral flow chromatography test strip and a constant temperature fluorescent amplification instrument. The invention explores the optimal reaction time and the optimal reaction temperature, the specificity, the sensitivity, the repeatability and the stability of the detection in the detection process, finds the optimal reaction condition, establishes the rapid detection method of the mycoplasma ovipneumoniae which has good specificity, high sensitivity and can stably and repeatedly, has the advantages of simple operation, convenience and time saving, and does not need large-scale experimental instruments and equipment.

Description

Composition, kit and method for detecting mycoplasma ovipneumoniae by taking transketolase gene as target

Technical Field

The invention relates to the technical field of molecular biology, in particular to a composition, a kit and a method for rapidly detecting mycoplasma ovipneumoniae.

Background

Mycoplasma ovipneumoniae (Mycoplasma pneumonia of sheep and goats, MPSG) is a high-contact infectious disease transmitted by air, spray, drinking water and the like, and the main clinical symptoms are wheezing, cough, hyperpyrexia, progressive emaciation, chronic proliferative interstitial pneumonia and the like. The pathogenic bacteria which are found to cause mycoplasma caprae pneumonia at present are mycoplasma caprae pneumonia (Mycoplasma ovipneumoniae, MO), mycoplasma caprae subspecies (Mycoplasma capricolum subsp. Capricolum, mcc), mycoplasma caprae subspecies (Mycoplasma mycoides subsp. Capri, mmc) and the like, wherein MO is one of common pathogenic bacteria, and the disease is widely distributed and popular in China, has higher infection rate and seriously affects the sheep farming industry, so that the establishment of a method for accurately detecting MO is of great importance, and has important significance for prevention and control of mycoplasma caprae pneumonia.

Current methods for detecting mycoplasma ovine pneumonia generally include the following. Culture is a direct evidence of the presence of pathogens and is a gold standard for MO detection. Once detected, diagnosis can be confirmed. The method can be classified into a general solid culture method and a rapid culture method. However, due to slow MO growth, the first separation from clinical samples generally requires 2-4 generations of blind transfer to see colonies on a solid medium through a microscope, and only a few days are required to obtain detection results, so that the detection rate is low, and the method has the defects of excessive time consumption, complex intermediate links, high requirements on culture conditions and the like, brings certain difficulty to the clinical separation of MO, and is not suitable for clinical rapid diagnosis. The serological detection technology has the advantages of higher specificity, better sensitivity, rapidness, easiness in operation and the like, is very suitable for rapid examination of clinical samples and large-scale epidemiological investigation, but mycoplasma pneumonia mostly have common antigens, and is easy to cause false positive experimental results. The immunohistochemical technology is a technology combining histology and immunology, and is characterized in that in situ of tissue cells, the corresponding antigen or antibody is positioned, qualitatively and quantitatively detected by means of visible markers through antigen-antibody specific binding reaction and histochemical chromogenic reaction, but when the disease is not serious or the deviation of a selected focus part is large, the existence of mycoplasma caprae is difficult to detect by immunohistochemistry. Among the numerous detection methods, the polymerase chain reaction is a simple and effective detection method. The PCR method has the advantages of rapid detection, high specificity and sensitivity, no living body of the detection sample, no influence of the immune function, the course of disease, the infection degree, the use of medicine treatment and the lack of reaching the serum detection level of the patient, and the early diagnosis and the correct selection of antibiotics are possible. Has positive significance for early and non-antibody-producing patients and infected patients with disappeared antibodies; is helpful for early diagnosis and timely treatment, has no cross reaction and radioactive pollution, and is easy to standardize. Although the detection of the polymerase chain reaction method is rapid, the method can replace a culture method in a certain sense, the high sensitivity of the method also makes the polymerase chain reaction method have higher requirements on experimental environment and instruments, and the method has the problems of high requirements on technical conditions, complex operation and difficult popularization, is difficult to develop in a basic laboratory, and has relatively high price.

Disclosure of Invention

In order to solve at least part of the technical problems in the prior art, the invention provides a composition, a kit and a method for rapidly and specifically detecting mycoplasma ovitis. Specifically, the present invention includes the following:

in a first aspect of the invention there is provided a composition for detecting mycoplasma ovipneumoniae comprising a first oligonucleotide, a second oligonucleotide and optionally a third oligonucleotide capable of selectively hybridising to a transketolase gene of mycoplasma ovipneumoniae. Wherein the first oligonucleotide selectively hybridizes to a first region of the transketolase gene, the second oligonucleotide selectively hybridizes to a second region of the transketolase gene, the first region is located at a 5 'end side of the transketolase gene, the second region is located at a 3' end side of the transketolase gene, and a distance between the first region and the second region is between 50bp and 1000 bp.

The transketolase gene of the present invention is amplified from the entire genome of MO Y98, which is not disclosed in the present laboratory deposit, by an amplification reaction, and preferably has the sequence shown in SEQ ID No. 1. The inventors found that the transketolase gene of the present invention was not identical in sequence to the Genebank-recorded MO NM2010 group, with a similarity of 96.6%. Unlike known transketolase genes, the transketolase genes of the invention (in particular specific fragments of the genes) have excellent intraspecies conservation and interspecific specificity.

In the present invention, the length of the first oligonucleotide is generally 25 to 35nt, preferably 26 to 30nt. Preferably, the sequence of the first oligonucleotide is shown in SEQ ID No. 2. In the present invention, the length of the second oligonucleotide is generally 25 to 35nt, preferably 26 to 30nt. In certain embodiments, the 5' end of the second oligonucleotide is free of any modification. In a further embodiment, the 5' end of the second oligonucleotide of the invention is provided with a Biotin tag. Preferably, the second oligonucleotide has a sequence as shown in SEQ ID No.3 and carries a Biotin tag at the 5' end. In the present invention, the length of the third oligonucleotide is generally 40 to 55nt, preferably 40 to 50nt. The 5' end of the third oligonucleotide carries a detection label, such as a FAM fluorophore. The third oligonucleotide carries a terminating phosphate group at the 3' end. The third oligonucleotide contains a THF cleavage site in the middle of its sequence. Preferably, the third oligonucleotide has a sequence as shown in SEQ ID No.4 with FAM at the 5 'end, a terminating phosphate group at the 3' end and a THF cleavage site, e.g., idSp, intermediate the third oligonucleotide.

In the present invention, the first oligonucleotide is capable of selectively hybridizing to a first region on the 5 '-terminal side of the transketolase gene, the second oligonucleotide is capable of selectively hybridizing to a second region on the 3' -terminal side of the transketolase gene, and the third oligonucleotide is capable of selectively hybridizing to a third region of the transketolase gene. The "5' -terminal side" refers to a region near the 5' -end of the transketolase gene, and this region may be from the first nucleotide at the 5' -end or from a nucleotide further downstream than the 5' -end, and does not refer to the 5' -end of the transketolase gene alone. Similarly, the "3' -terminal side" has a similar meaning.

In the present invention, the distance between the first region and the second region is between 50bp and 2000bp, preferably 70 to 1000bp, more preferably 100 to 500bp, for example 100 to 200bp. Here, the distance refers to the distance between the last base at the 3 '-end of the first region and the first base at the 5' -end of the second region. In a preferred embodiment, the invention further comprises a third region, the third region being located between the first region and the second region. Here, there is preferably no overlap between the third region and the first region or the second region.

In certain embodiments, the compositions of the invention are compositions for use in PCR reactions. In this case, the present invention may include other components such as a buffer required for PCR reaction in addition to the first oligonucleotide and the second oligonucleotide.

In certain embodiments, the compositions of the invention are compositions for use in a recombinase polymerase amplification Reaction (RPA). In this case, the composition may be used directly at a constant temperature, and the reaction temperature is low, generally at a temperature of 34 to 42℃and the reaction time is only 5 to 20 minutes, preferably 12 to 18 minutes. In a most preferred embodiment, the reaction temperature of the present invention is 39℃and the reaction time is 15 minutes.

In a second aspect of the invention there is provided a kit for the detection of mycoplasma ovipneumoniae comprising a composition according to the first aspect of the invention. The composition has been described in detail hereinabove and will not be described in detail herein. Other parts of the kit of the invention are described below.

Kits of the invention may also include precautions related to regulating manufacturing, use, or marketing of the diagnostic kit in a form prescribed by a government agency. The kit may also be provided with detailed instructions for use, storage and troubleshooting. The kit may also optionally be provided in a suitable device, preferably for robotic operation in a high throughput setting.

In a third aspect of the invention, there is provided a method for detecting mycoplasma ovipneumoniae comprising the steps of:

(1) Providing a template of a biological sample derived from sheep;

(2) The template and the composition form a reaction system, and the reaction is carried out for 5 to 20 minutes at the temperature of between 34 and 42 ℃ to obtain an amplification product;

(3) Detecting the amplified product.

The biological sample of the present invention refers to a body fluid or secretion derived from a sheep to be detected. Preferably, the biological sample is derived from sheep suffering from the associated disease. Examples of body fluids include, but are not limited to, cyst fluid, nasal and joint fluids, milk, and the like. Preferably, the biological sample of the present invention is sheep nose fluid (nasal swab). The template substance may be DNA or RNA.

In certain embodiments, the methods of the invention comprise the step of a general PCR reaction. For example, a pre-denaturation step, a denaturation step, an annealing step, a circulation step, a final extension step, a heat-retaining step, and the like. These steps are known in the art.

In certain embodiments, the methods of the invention are quite different from the general polymerase chain reaction. In this case, the reaction system of the present invention is carried out at a constant temperature and the reaction temperature is low, and it is generally carried out in a temperature environment of 34℃to 42℃and the reaction time is only 5 to 20 minutes, preferably 12 to 18 minutes. In a most preferred embodiment, the reaction temperature of the present invention is 39℃and the reaction time is 15 minutes.

In an exemplary embodiment, the reaction system of the present invention (excluding the template) includes:

step (3) of the present invention is a step of detecting an amplification product. In certain embodiments, the step of detecting an amplification product of the present invention comprises the step of subjecting the second amplification product to agarose gel electrophoresis. In certain embodiments, the step of detecting an amplification product of the present invention comprises contacting the amplification product with a labeled lateral flow chromatography test strip, determining that the biological sample is a positive sample when red is displayed at both the detection line and the quality control line, determining that the biological sample is a negative sample when red is displayed at the quality control line and the detection line is not colored, and proving that the test strip is invalid when the quality control line is not displaying red. In certain embodiments, the detection amplification products of the present invention are detected by an exo isothermal fluorescent amplification instrument.

The transketolase gene of the present invention is a gene obtained by using the entire genome of MO Y98 which is not disclosed in the present laboratory. Specifically, the obtaining process is as follows: the sequence of the transketolase Gene of MO NM2010 is found in Genebank (Gene ID: 29942122). The transketolase gene of MO NM2010 was compared with the MO Y98 whole genome, thereby obtaining the transketolase gene of the present invention. The results of the sequence alignment of the transketolase gene with the known gene are shown in FIG. 14.

Transketolase is known to play an important role in the pentose phosphate cycle and the photosynthetic reduced pentose phosphate cycle. Are widely found in bacteria, yeasts, spinach and liver. The research of the invention finds that the obtained transketolase gene (specific fragment of the gene) has intraspecific conservation and interspecific specificity, and can especially meet the intraspecific conservation of MO and clinical strain SC01 and the interspecific specificity of pathogenic bacteria such as mycoplasma caprae subspecies PG3, mycoplasma caprae subspecies caprae standard strain F38, mycoplasma bovis standard strain PG45, mycoplasma agalactiae standard strain PG2, streptococcus pneumoniae, klebsiella, pseudomonas aeruginosa, serratia, salmonella bovis, escherichia coli, staphylococcus aureus, pasteurella and the like. Based on this finding, the present invention designs oligonucleotide sequences for specific regions of the gene for use in recombinase polymerase amplification reactions and PCR reactions.

The composition of the invention can detect not only the mycoplasma ovipneumoniae standard strain Y98 but also the clinical strain SC01. When the compositions are used for detecting MO, the conservation in mycoplasma hyopneumoniae species and the specificity between mycoplasma hyopneumoniae and other pathogenic bacteria can be achieved, and the compositions have excellent technical effects. In the preferred embodiment, the invention obtains an optimized reaction system with optimal reaction time and optimal reaction temperature, so that the specificity, sensitivity, repeatability and stability of detection are greatly improved, and a rapid detection method of mycoplasma ovipneumoniae with good specificity, high sensitivity and stable repeatability is established.

In addition, the method is simple to operate, convenient and time-saving when the MO is detected, large-scale experimental instrument equipment is not needed, the method is very suitable for rapid detection in the field or on site without any experimental foundation, and the method is worth popularizing and using.

In summary, the detection target of the composition of the invention is the transketolase gene of mycoplasma ovipneumoniae, and can be directed against various fragments in the gene, and experiments prove that the composition of the invention can be designed into various specific combination situations to be applied to various amplification methods such as traditional PCR, basic RPA, nfo RPA, exo RPA and the like, and experimental results can be observed by means of agarose gel electrophoresis, lateral flow chromatography test paper strips and a constant temperature fluorescence amplification instrument. The invention explores the optimal reaction time and the optimal reaction temperature, the specificity, the sensitivity, the repeatability and the stability of the detection in the detection process, finds the optimal reaction condition, establishes the rapid detection method of the mycoplasma ovipneumoniae which has good specificity, high sensitivity and can stably and repeatedly, has the advantages of simple operation, convenience and time saving, and does not need large-scale experimental instruments and equipment.

Drawings

Fig. 1: and (3) a first amplification reaction detection result diagram of the mycoplasma ovipneumoniae marker gene transketolase. M: molecular mass standard 1: mycoplasma ovipneumoniae standard strain Y98 2: mycoplasma ovipneumoniae SC01 strain 3: standard strain PG 34 of the mycoplasma caprae subspecies of the filamentous species: mycoplasma caprae subspecies caprae pneumonitis standard strain F38 5: mycoplasma bovis Standard strain PG45 6: mycoplasma agalactiae standard strain PG2 7: streptococcus pneumoniae 8: klebsiella 9: pseudomonas aeruginosa 10: serratia spp.11: salmonella bovis 12: coli 13: staphylococcus aureus 14: pasteurella C: no template control.

Fig. 2: schematic diagram of observation of time reaction gradient results of the second amplification reaction against transketolase gene. M: a DNA molecular mass standard; 1:0min;2:5min;3: for 10min;4:15min;5:20min;6:25min;7:30min;8:35min;9: for 40min;10:45min; c: template-free control.

Fig. 3: schematic diagram is observed for the result of the temperature reaction gradient of the second amplification reaction for transketolase gene. M: a DNA molecular mass standard; 1:34 ℃;2:35 ℃;3:36 ℃;4:37 ℃;5:38 ℃;6:39 ℃;7:40 ℃;8:41 ℃;9:42 ℃; c: no template control.

Fig. 4: schematic view of the observation of the result of the specific reaction against the second amplification reaction of the transketolase gene. M: molecular mass standard 1: mycoplasma ovipneumoniae standard strain Y98 2: mycoplasma ovipneumoniae SC01 strain 3: standard strain PG 34 of the mycoplasma caprae subspecies of the filamentous species: mycoplasma caprae subspecies caprae pneumonitis standard strain F38 5: mycoplasma bovis Standard strain PG45 6: mycoplasma agalactiae standard strain PG2 7: streptococcus pneumoniae 8: klebsiella 9: pseudomonas aeruginosa 10: serratia spp.11: salmonella bovis 12: coli 13: staphylococcus aureus 14: pasteurella C: no template control.

Fig. 5: schematic view of the observation of the result of the sensitive reaction against the second amplification reaction of the transketolase gene. M: a DNA molecular mass standard; 1: 1.9X10 ¹⁰ ；2：1.9×10 ⁹ ；3：1.9×10 ⁸ ；4：1.9×10 ⁷ ；5：1.9×10 ⁶ ；6：1.9×10 ⁵ ；7：1.9×10 ⁴ ；8：1.9×10 ³ ；9：1.9×10 ² ；10：1.9×10 ¹ ；11：1.9×10 ⁰ The method comprises the steps of carrying out a first treatment on the surface of the C: no template control.

Fig. 6: schematic of the observation of the results of the batch-to-batch reproducibility of the second amplification reaction for the transketolase gene.

Fig. 7: schematic of the observation of the in-batch reproducibility of the second amplification reaction for the transketolase gene.

Fig. 8: schematic diagram of observation of time reaction gradient results of the third amplification reaction against transketolase gene.

Fig. 9: schematic diagram is observed for the result of the temperature reaction gradient of the third amplification reaction for transketolase gene.

Fig. 10: schematic view of the result of the specific reaction against the third amplification reaction of transketolase gene.

Fig. 11: schematic view of the observation of the result of the sensitive reaction against the third amplification reaction of transketolase gene.

Fig. 12: schematic of the results of the batch-to-batch reproducibility of the third amplification reaction for the transketolase gene.

Fig. 13: schematic of the observation of the results of the in-batch reproducibility of the third amplification reaction for the transketolase gene.

Fig. 14: an alignment of the transketolase Gene of the present invention with the known Gene sequence of Gene ID 29942122.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in the present invention, it is understood that the upper and lower limits of the ranges and each intermediate value therebetween are specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control. Unless otherwise indicated, "%" is percent by weight.

Example 1

This example is a detection system for the first amplification reaction of a specific transketolase gene, i.e., a process of detecting a specific gene by a polymerase chain reaction. The method specifically comprises the following steps: (1) detection System for first amplification reaction of the present invention:

(2) Reaction conditions:

(3) Detection result: after the reaction, 5. Mu.L of the reaction product was collected and detected by agarose gel (1.5%) electrophoresis, and the detection results are shown in FIG. 1.

Example 2

This example is a detection system for a second amplification reaction of a specific gene transketolase, the basic (basic) RPA detection system. The method specifically comprises the following steps:

(1) The detection system of the second amplification reaction of the present invention:

mixing the reaction liquid, adding 1 mu L of template to be detected and 1.25 mu L of MgoAC, swirling, briefly centrifuging, and placing the reaction liquid into a water bath kettle at 39 ℃ for reaction for 20min. And (3) result detection: after the reaction, 5. Mu.L of the reaction product was collected and detected by agarose gel (1.5%) electrophoresis.

(2) Exploration of optimal reaction time

After the reaction system is established, the optimal reaction time is explored by setting a time gradient of 0 min-45 min, and positive standard plasmid 1.9x10 is used for determining the optimal reaction time ⁸ And (3) taking the copies/mu L as a template to carry out amplification reaction, taking out a reaction tube after the reaction is finished, placing the reaction tube on ice, and stopping the reaction. The detection results are shown in FIG. 2.

(3) Exploration of optimal reaction temperature

The reaction temperature gradient of 34-42 ℃ is set by taking 20min as the optimal reaction time, the reaction can be found in 34-42 ℃, and the detection result is shown in figure 3. As shown in FIG. 3, specific amplified bands were generated at 34℃to 42℃and were brighter, the optimal reaction temperature was selected at 39 ℃.

(4) Specificity of the assay

The specificity of the reaction was detected with 20min as the optimal reaction time and 39℃as the optimal reaction temperature, and the detection results were shown in FIG. 4, and only Mycoplasma ovipneumoniae standard strain Y98 and clinical strain SC01 could be detected, but the remaining pathogenic bacteria could not be detected, as shown in FIG. 4.

(5) Sensitivity of detection

On the premise of good specificity, cloning target fragment of transketolase geneThe copy number was calculated and 10-fold gradient dilution was performed, and it was found that the reaction of the present invention could be detected at a minimum of 10 ² The detection results of the copies/. Mu.L are shown in FIG. 5.

(6) Stability of detection

After exploring the specificity and sensitivity of the reaction, the stability of the reaction was examined. Therefore 1.9X10 were chosen ⁷ 、1.9×10 ⁶ 、1.9×10 ⁵ Three positive plasmid standard substances with different concentrations are repeated three times under the same condition, the repeated effect in the batch is observed, and the detection result of the stability in the batch is shown in figure 7; the above 3 positive plasmid standards with different concentrations were repeated three times in the same experiment, and the repeated effect between batches was observed, and the results of the batch-to-batch stability detection are shown in fig. 6.

Nasal swabs of a large-scale sheep farm in Ningxia regions are collected for 32 parts. 32 clinical samples are detected by using the second amplification system, and the detected positive samples are 14, compared with the traditional molecular biology detection method PCR, the detected coincidence rate is as high as 91%, which indicates that the second amplification system established by the experiment has good effect.

Example 3

This example is a system based on a third amplification reaction of a specific gene transketolase, nfo RPA.

The method comprises the following steps:

(1) The detection system of the present invention comprises:

first detection system:

among them, primer free Rehydration buffer is a known commercially available product.

A second detection system:

the base mixture contains all the enzymes and reagents necessary for the reaction, with the addition of templates and corresponding oligonucleotides. The reaction is started by adding, for example, 1.25. Mu.l of magnesium acetate (MgOAc) to the mixture system before the reaction. The amplified product is obtained after the reaction, and the product can be detected by using a side-flow chromatographic test strip with a label. When the detection product is combined with the test strip, the positive sample can display red at the detection line and the quality control line, while the negative sample can only display red at the command line, and when the quality control line does not display red, the test strip is proved to be invalid, so that the detection result is invalid.

(2) Exploration of optimal reaction time

The experimental conditions of the following recombinant polymerization amplification are selected by the transketolase gene, the following oligonucleotides are designed for the recombinant polymerization amplification reaction, so that a method for rapidly detecting MO is established, and the specific experimental process is as follows:

the sequence of the MTKF is as follows:

TAATTTCAAACTTGGAGCCTACTTAGCTC (comprising SEQ ID No. 2)

The sequence of MTKR is as follows:

(Biotin) TCCTTACTTCGAAAGCCAATTTCATCAAG (comprising SEQ ID No. 3) MTKP has the sequence as follows:

(FAM) ACCGGTAGTGAGTTAGGACTGGCAAAAGAA/idSp/TCGCTCAAAAGTTAG (P) (comprising SEQ ID No. 4).

The reaction system:

mixing the reaction liquid, adding into a reaction tube, fully mixing, adding 1 mu L of template to be detected and 1.25 mu L of MgOAC, swirling, briefly centrifuging, placing into a water bath kettle at 39 ℃, and reacting for 10min. After the reaction is finished, taking 5 mu L of reaction solution and 100 mu L of detection buffer solution, fully and uniformly mixing in a sterile 1.5mL centrifuge tube, and inserting a lateral flow chromatography test strip into the mixed solution to observe the reaction result.

After a reaction system is established, a time gradient reaction is set for 0-45 min to explore the optimal reaction time, and a macroscopic detection result on the lateral flow chromatographic test strip can be generated after the reaction is found for 5min, so that the reaction is more stable, and the optimal reaction time is set for 15min. The detection results are shown in FIG. 8.

(3) Exploration of optimal reaction temperature

The reaction temperature gradient of 34-42 ℃ is set by taking 15min as the optimal reaction time, the reaction can be found in 34-42 ℃, the detection result is shown in figure 9, and the red color of the detection line is darker at 39 ℃ in the reaction result, so that the optimal reaction temperature at 39 ℃ is selected.

(4) Specificity of the assay

The specificity of the reaction of the present invention was detected with 15min as the optimal reaction time and 39℃as the optimal reaction temperature, and the detection results are shown in FIG. 10, and only Mycoplasma ovipneumoniae standard strain Y98 and clinical strain SC01 could be detected, and the remaining pathogenic bacteria could not be detected, as in the detection results of PCR.

(5) Sensitivity of detection

On the premise of good specificity, the target fragment of transketolase gene is cloned, its copy number is calculated, and 10-time gradient dilution is implemented, so that the minimum detectable quantity of the invented reaction is 10 ¹ The detection results of the copies/. Mu.L are shown in FIG. 11.

(6) Stability of detection

After exploring the specificity and sensitivity of the reaction, the stability of the reaction was examined. Therefore 1.9X10 were chosen ⁷ 、1.9×10 ⁶ 、1.9×10 ⁵ Three positive plasmid standard substances with different concentrations are repeated three times under the same condition, the repeated effect in the batch is observed, and the detection result of the stability in the batch is shown in figure 13; the above 3 positive plasmid standards with different concentrations were repeated three times in the same experiment, and the repeated effect between batches was observed, and the results of the batch-to-batch stability detection are shown in fig. 12.

After the method is established, 32 clinical samples in the area are detected, 19 positive samples detected by the third amplification system are found, the clinical samples are detected by a traditional molecular biological detection method, and the coincidence rate of the detection result and the PCR detection result is found to be 94%.

Example 4

This example is a system based on a fourth amplification reaction of a specific fragment of the transketolase gene, exo RPA. The method comprises the following steps:

(1) The detection system of the invention is constructed by:

first detection system:

The base mixture contains all the enzymes and reagents necessary for the reaction, and only 1. Mu.L of template and corresponding oligonucleotides are added thereto. Before the reaction, for example, 1.25. Mu.l of magnesium acetate (MgOAc) at a concentration of 280mM is added to the mixture system to initiate the reaction. The reaction result is carried out in a constant temperature fluorescence amplification instrument, and the reaction can be detected in real time.

Specifically, the sequence of the first oligonucleotide MTKE F of this example is the same as that of (SEQ ID No. 2) in example 1.

The second oligonucleotide sequence MTKE R of this example is identical to (SEQ ID No. 3) of example 1.

The third oligonucleotide sequence PE of this embodiment may be at least one of the following two:

PE1: ACCGGTAGTGAGTTAGGACTGGCAAAAGAAG/i6FAMdT/C/idSp/C/iBHQ1dT/CAAAAGTTAGACCTA (comprising SEQ ID No.5 and having a modifying group i6FAMdT/C/idSp/C/iBHQ1dT between positions 31 to 32);

PE2: ATCCAAATTTTGCAATTTCACTTGAATTAGCT/i6FAMdT// idSp// iBHQ1dT/ACTTTTGGTTGAAAAG (comprising SEQ ID No.6 and having a modifying group i6FAMdT// idSp// iBHQ1dT between positions 32 and 33).

In one exemplary reaction system, it comprises:

mixing the reaction liquid, adding the mixture into a reaction tube, fully mixing, adding 1 mu L of template to be detected and 1.25 mu L of MgOAC, swirling, briefly centrifuging, and placing into a constant temperature fluorescence amplification instrument for reaction for 15min. The computer can be connected to observe the reaction result in real time.

According to the invention, by designing the specific primer and probe of the recombination, polymerization and amplification reaction of the specific gene transketolase, the optimal reaction time and the optimal reaction temperature, the specificity, the sensitivity, the repeatability and the stability of detection are all explored, the optimal reaction condition is found, and the MO rapid detection method which has good specificity, high sensitivity and can be stably repeated is established. The method for detecting MO, which is established by the invention, is simple to operate, convenient and time-saving, does not need large-scale experimental instrument equipment, is very suitable for personnel operation without any experimental foundation, and is worth popularizing and using.

While the invention has been described with reference to exemplary embodiments, it is to be understood that the invention is not limited to the disclosed exemplary embodiments. Various modifications or changes may be made to the exemplary embodiments of the present description without departing from the scope or spirit of the invention. The scope of the following claims is to be accorded the broadest interpretation so as to encompass all such modifications and equivalent structures and functions.

Sequence listing

<110> university of Ningxia

<120> composition, kit and method for detecting mycoplasma ovipneumoniae targeting transketolase gene

<130> BH1900188-1

<141> 2019-09-16

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1884

<212> DNA

<213> Mycoplasma ovipneumoniae

<400> 1

ttggaatcta aagaaaaagt tgataaattc aaaaaaaagt ttaaatatct tgaagaatta 60

agtgtaaatt ctctaagaat tcacagtaac gaagcaataa ataaagcaaa ttctggtcac 120

cctggcgttg caattagtgc ttcaaaaatg atttatgcac tttttcgtga tcatataaat 180

tttgacctca gtgatccaaa ctgaattaat cgcgaccgtt ttgttttgtc tgccggtcat 240

gcatcttcgc tttattatgc acttttatat agtttaggtt tattaaaaaa agaagatctt 300

gagaattttc ggcaaaaaaa ttcaaaaaca cctggacatc cagaatacgg tcacactgtt 360

ggagttgaag caacaactgg accacttggc caagggattg caatggccgt tggaatggct 420

cttgctcagt cacatttaaa tgcaaaattc aaagaaatta accactacac ctatgtaatt 480

tgcggggatg gtgatcttca ggagggaatt tcctatgagt cactttcact agcgggacat 540

ttaaaactta aaaatttcat tgttttgtat gactcaaatg atattcaact tgactcacca 600

gtaagcgttg tttttagcga aaatatgaaa caacgaattg aatctcaagg tttattttac 660

caattagttc caaaagatga tgtaaaattg atctcaaaag caatttcgaa ggcaaaagct 720

tcccgaagac caagttttat tgaaatcaaa actgttattg gtcaaggttc atctaaacaa 780

aacactaccg aagttcacgg tgctccgcta ggaggcgata ttgttaattt aaagaaaaat 840

cttaaatgaa aacacgaaga agatttttat cttgacccag aaattagcaa acattggcaa 900

aaaacacttg taaaaagaac tcaagctaaa aaagaagctt ttaaaatttc gccagaactt 960

gaagaatttt tacaaaaagg gcaaaatatt aatttggaaa ttgatttaga ccttcctaaa 1020

aatcaggcaa cccgggcaac atcgtcttta attcttgact atatttccaa aaaagttcct 1080

tattgaatcg gtggatcagc tgatttatca gtttcaacaa aagcaaaagg atcagatggt 1140

tattttagtg accaaaatta tcaaggtcga aatttaatgt ttggtgttcg cgaatttgca 1200

atgagtgcaa ttgcaaatgg aattgccctt cattcagttt tacgcccttt tgtttcaaca 1260

ttttttgtct ttgctgacta tttaaagcct gccttaagac tctcatcatt aatgaaattg 1320

ccagtaactt acatttttac tcacgactcc ttaatggttg gcgaagatgg accgacccac 1380

cagccaattg aacaacttgc aatgcttaga tcagttccta attttgctgt ctatcgtcct 1440

ggtgatgaaa atgaactaaa aggagcttac gaacttgctc ttgaaagcaa agataaacct 1500

tgtgcaataa ttttaactcg ccaaaatatc aaatcattta ctgaatcaaa ggataatttc 1560

aaacttggag cctacttagc tcaaaaaagt aaatcaaaat gagcaattat tactaccggt 1620

agtgagttag gactggcaaa agaagtcgct caaaagttag acctaaattt aatatcgcta 1680

tcaaattgac aaaatacacc aatttgagat ccaaattttg caatttcact tgaattagct 1740

tctacttttg gttgaaaagc acatgcaaaa tataattttg gtcatgatac ctttggaatg 1800

tcagcccctg cagaacacat tcttgatgaa attggctttc gaagtaagga tcttgttgaa 1860

aaaattaaaa aaattattgc ctaa 1884

<210> 2

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

taatttcaaa cttggagcct acttagctc 29

<210> 3

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

tccttacttc gaaagccaat ttcatcaag 29

<210> 4

<211> 45

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

accggtagtg agttaggact ggcaaaagaa tcgctcaaaa gttag 45

<210> 5

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

accggtagtg agttaggact ggcaaaagaa gcaaaagtta gaccta 46

<210> 6

<211> 48

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

atccaaattt tgcaatttca cttgaattag ctacttttgg ttgaaaag 48

Claims

1. A detection system for detecting mycoplasma ovipneumoniae by basicRPA, comprising a first oligonucleotide, a second oligonucleotide capable of hybridizing to a transketolase gene of mycoplasma ovipneumoniae, wherein: the first oligonucleotide is hybridized with a first region of the transketolase gene selectively, the second oligonucleotide is hybridized with a second region of the transketolase gene selectively, the first region is positioned at the 5 '-end side of the transketolase gene, the second region is positioned at the 3' -end side of the transketolase gene, and the distance between the first region and the second region is 50 bp-1000 bp;

the detection system further comprises: 2×reaction buffer, dNTPs, 10×basic E-mix, 20× core Reaction mix; the transketolase gene has intraspecies conservation and interspecific specificity, the gene sequence is shown as SEQ ID No.1, the sequence of the first oligonucleotide is shown as SEQ ID No.2, and the sequence of the second oligonucleotide is shown as SEQ ID No. 3.