CN110564877B - Composition, kit and method for detection of Mycoplasma pneumoniae ovis with transketolase gene as target - Google Patents

Abstract

The invention discloses a composition, a kit and a method for detecting ovine mycoplasma pneumoniae by using a transketolase gene as a target. The detection target of composition of the present invention is the transketolase gene of Mycoplasma ovis pneumoniae, can be aimed at multiple different fragments in this gene, and has verified through experiment that composition of the present invention can design multiple different specific combination situations to It is applied to various amplification methods such as traditional PCR, basic RPA, nfo RPA, and exo RPA. In addition, the experimental results can be observed with the help of agarose gel electrophoresis, lateral flow chromatography test strips, and constant temperature fluorescence amplification instrument. The present invention explores the optimum reaction time and optimum reaction temperature, detection specificity, sensitivity, repeatability and stability in the detection process, finds the optimum reaction conditions, and establishes a method with good specificity and high sensitivity. Furthermore, the stable and repeatable rapid detection method for Mycoplasma pneumoniae in sheep is simple in operation, convenient and time-saving, and does not require large-scale experimental instruments and equipment.

Description

Composition, kit and method for detecting Mycoplasma pneumoniae of ovis with transketolase gene as target

technical field

The invention relates to the technical field of molecular biology, in particular to a composition, a kit and a method for rapid detection of ovine mycoplasma pneumoniae.

Background technique

Mycoplasma pneumonia of sheep and goats (MPSG) is a highly contagious infectious disease transmitted through air, droplets, drinking water, etc. The main clinical symptoms are panting, coughing, high fever, progressive weight loss, and chronic proliferative stroma pneumonia etc. The pathogenic bacteria that have been found to cause mycoplasma pneumonia include Mycoplasma ovipneumoniae (Mycoplasma ovipneumoniae, MO), Mycoplasma capricolum subsp.capricolum (Mcc), Mycoplasma mycoides subsp.capri (Mmc) Among them, MO is one of the common pathogenic bacteria. The disease is widely distributed and popular in my country, and the infection rate is high, which seriously affects the sheep breeding industry. Therefore, it is very important to establish an accurate detection method for MO. control is important.

The current methods for detecting mycoplasma pneumonia in sheep generally include the following. The culture method is the direct evidence for detecting the presence of pathogens and is the gold standard for detecting MO. Once detected, it can be diagnosed. It can be divided into general solid culture method and rapid culture method. However, due to the slow growth of MO, the initial isolation from clinical samples generally requires 2 to 4 generations of blind passage before the colonies can be seen on the solid medium through the microscope, and it takes several days to get the test results. Not only the detection rate is low, but also time-consuming. Too many defects, complex intermediate links, and high requirements for culture conditions have brought certain difficulties to the clinical isolation of MO, and are not suitable for rapid clinical diagnosis. Serological detection technology has the advantages of high specificity, good sensitivity, rapidity, and easy operation. It is very suitable for rapid inspection of clinical samples and large-scale epidemiological investigations. However, most mycoplasma pneumoniae have common antigens, which may easily cause false positives. the experimental results. Immunohistochemical technology is a technology that combines histology and immunology. It is in situ on tissue cells, through antigen-antibody specific binding reaction and histochemical chromogenic reaction, with the help of visible markers to detect the corresponding antigen or antibody. Positioning, qualitative and quantitative detection, but when the disease is not serious or there is a large deviation in the selection of lesion sites, it is difficult to detect the existence of Mycoplasma ovis by immunohistochemistry. Among many detection methods, polymerase chain reaction is a simple and effective detection method. Polymerase chain reaction detection is rapid, specific and sensitive, and the detection sample does not need to be a living body, and is not affected by the patient's immune function, course of disease, degree of infection, whether or not drug treatment is used, and the level of serum detection has not been reached, enabling early diagnosis and the correct choice of antibiotics become possible. It has positive significance for patients who have not produced antibodies in the early stage and infected patients whose antibodies have disappeared; it is helpful for early diagnosis and timely treatment, and there is no cross-reaction and radioactive contamination, and it is easy to standardize. Although the polymerase chain reaction method is fast and can replace the culture method in a certain sense, its high sensitivity also makes the polymerase chain reaction method relatively demanding on the experimental environment and instruments, and there are high technical requirements, complicated operation, and It is not easy to popularize, and it is difficult for general grassroots laboratories to carry out, and the price is relatively high.

Contents of the invention

In order to solve at least part of the technical problems in the prior art, the present invention provides a composition, kit and method for rapid and specific detection of Mycoplasma ovis pneumonia. Specifically, the present invention includes the following:

In a first aspect of the present invention, there is provided a composition for detecting Mycoplasma ovis pneumoniae, which includes a first oligonucleotide capable of selectively hybridizing with the transketolase gene of Mycoplasma ovis pneumoniae, a second oligonucleotide and an optional The third oligonucleotide of choice. Wherein, the first oligonucleotide selectively hybridizes to the first region of the transketolase gene, and the second oligonucleotide selectively hybridizes to the second region of the transketolase gene, And the first region is located at the 5' end of the transketolase gene, the second region is located at the 3' end of the transketolase gene, the first region and the second region The distance between them is between 50bp and 1000bp.

The transketolase gene of the present invention is amplified from the undisclosed whole genome of MO Y98 preserved in our laboratory through amplification reaction, and it preferably has the sequence shown in SEQ ID No.1. The inventors found that the transketolase gene of the present invention is not completely identical to the sequence of the MO NM2010 group included in Genebank, with a similarity of 96.6%. Different from the known transketolase gene, the transketolase gene (especially the specific fragment of the gene) of the present invention has excellent intra-species conservation and inter-species specificity.

In the present invention, the length of the first oligonucleotide is generally 25-35 nt, preferably 26-30 nt. Preferably, the sequence of the first oligonucleotide is as shown in SEQ ID No.2. In the present invention, the length of the second oligonucleotide is generally 25-35 nt, preferably 26-30 nt. In certain embodiments, the 5' end of the second oligonucleotide is free of any modifications. In additional embodiments, the 5' end of the second oligonucleotide of the invention is labeled with Biotin. Preferably, the sequence of the second oligonucleotide is as shown in SEQ ID No.3, and has a Biotin mark at the 5' end. In the present invention, the length of the third oligonucleotide is generally 40-55 nt, preferably 40-50 nt. The 5' end of the third oligonucleotide carries a detection label, such as a FAM fluorophore. The 3' end of the third oligonucleotide has a terminating phosphate group. The third oligonucleotide contains a THF cleavage site in the middle of its sequence. Preferably, the sequence of the third oligonucleotide is as shown in SEQ ID No.4, with a FAM at the 5' end, a terminating phosphate group at the 3' end and THF in the middle of the third oligonucleotide Cleavage site, eg idSp.

In the present invention, the first oligonucleotide can selectively hybridize with the first region at the 5' end side of the transketolase gene, and the second oligonucleotide can hybridize with the second region at the 3' end side of the transketolase gene Selectively hybridizing, the third oligonucleotide is capable of selectively hybridizing to a third region of the transketolase gene. It should be noted that the "5' end side" refers to the region near the 5' end of the transketolase gene, which can start from the first nucleotide at the 5' end, or from a certain nucleotide further downstream of the 5' end. The nucleotide start does not refer only to the 5' end of the transketolase gene. In the same way, it can be seen that "3' end side" also has a similar meaning.

In the present invention, the distance between the first region and the second region is between 50bp-2000bp, preferably 70-1000bp, more preferably 100-500bp, for example 100-200bp. The distance here refers to the distance between the last base at the 3' end of the first region and the first base at the 5' end of the second region. In a preferred embodiment, the invention further comprises a third region, the third region being located between the first region and the second region. Here, preferably, there is no overlap between the third area and the first area or the second area.

In certain embodiments, a composition of the invention is a composition for use in a PCR reaction. In this case, in addition to the first oligonucleotide and the second oligonucleotide, the present invention may include other components such as a buffer required for the PCR reaction.

In certain embodiments, a composition of the invention is a composition for use in a recombinase polymerase amplification reaction (RPA). In this case, the composition can be directly used to carry out at a constant temperature, and the reaction temperature is relatively low. Generally, it needs to be carried out in a temperature environment of 34°C to 42°C, and the reaction time only needs to be 5 to 20 minutes, preferably 12 to 20 minutes. 18 minutes. In the most preferred embodiment, the reaction temperature of the present invention is 39° C., and the reaction time is 15 minutes.

The second aspect of the present invention provides a kit for detecting Mycoplasma pneumoniae of ovis, which comprises the composition of the first aspect of the present invention. In the above, the composition has been described in detail and will not be repeated here. Other parts of the kit of the present invention are described below.

The kits of the invention may also include notices in the form prescribed by governmental agencies regulating the manufacture, use or sale of diagnostic kits. The kit can also provide detailed instructions for use, storage and troubleshooting. The kit may optionally also be provided in a suitable device, preferably for robotic manipulation in a high throughput setting.

A third aspect of the present invention provides a method for detecting Mycoplasma pneumoniae, comprising the following steps:

(1) Provide a template for biological samples derived from sheep;

(2) Make the template and the composition form a reaction system, and react at 34°C to 42°C for 5 to 20 minutes to obtain an amplification product;

(3) Detection of amplification products.

The biological sample in the present invention refers to the body fluid or secretion derived from the sheep to be tested. Preferably, the biological sample is derived from a sheep suffering from the relevant disease. Examples of bodily fluids include, but are not limited to, cyst fluid, nasal and joint fluid, emulsion, and the like. Preferably, the biological sample of the present invention is sheep nasal fluid (nasal swab). The substance used as a template can be either DNA or RNA.

In certain embodiments, the methods of the invention include the step of a general PCR reaction. For example, pre-denaturation step, denaturation step, annealing step, cycling step, final extension step and incubation step, etc. These steps are known in the art.

In certain embodiments, the methods of the present invention are quite different from the general polymerase chain reaction. In this case, the reaction system of the present invention is carried out at a constant temperature, and the reaction temperature is relatively low. Generally, it needs to be carried out in a temperature environment of 34° C. to 42° C., and the reaction time only needs 5 to 20 minutes, preferably 12 to 20 minutes. 18 minutes. In the most preferred embodiment, the reaction temperature of the present invention is 39° C., and the reaction time is 15 minutes.

In an exemplary embodiment, the reaction system of the invention (excluding the template) comprises:

The step (3) of the present invention is a step of detecting the amplification product. In certain embodiments, the step of detecting the amplification product of the present invention comprises the step of subjecting the second amplification product to agarose gel electrophoresis. In certain embodiments, the step of detecting the amplification product of the present invention comprises contacting the amplification product with a labeled lateral flow chromatography test strip, and when red is displayed at both the detection line and the quality control line, it is determined that the The biological sample is a positive sample. When the quality control line shows red but the detection line does not develop color, it is determined that the biological sample is a negative sample. When the quality control line does not show red, it proves that the test strip is invalid. In some embodiments, the detection amplification product of the present invention is detected by an exo constant temperature fluorescence amplification instrument.

The transketolase gene of the present invention is the gene obtained by utilizing the unpublished MO Y98 whole genome of this laboratory. Specifically, its acquisition process is as follows: find the sequence (Gene ID: 29942122) of the transketolase gene of MO NM2010 in Genebank. The transketolase gene of MO NM2010 is compared with the whole genome of MO Y98, thereby obtaining the transketolase gene of the present invention. The sequence comparison result of the transketolase gene and known genes is shown in FIG. 14 .

Transketolase is known to be an enzyme that plays an important role in the pentose phosphate cycle and the photosynthetic reduced pentose phosphate cycle. Extensively present in bacteria, yeast, spinach and liver. The present invention's research finds that the obtained transketolase gene (the specific fragment of the gene) has intraspecies conservation and interspecies specificity, especially can satisfy the intraspecies conservation of MO and clinical strain SC01, and with mycoplasma mycoplasma Goat subspecies standard strain PG3, Mycoplasma capricoides goat pneumonia subspecies standard strain F38, Mycoplasma bovis standard strain PG45, Mycoplasma agalactiae standard strain PG2, Streptococcus pneumoniae, Klebsiella, Pseudomonas aeruginosa, Serratia japonica, Interspecies specificity of pathogenic bacteria such as Salmonella bovis, Escherichia coli, Staphylococcus aureus, and Pasteurella. Based on this discovery, the present invention designs an oligonucleotide sequence directed at a specific region of the gene, so as to be used in the recombinase polymerase amplification reaction and the PCR reaction.

The composition of the invention can not only detect the standard strain Y98 of the sheep Mycoplasma pneumoniae, but also can detect the clinical strain SC01. When these compositions are used for the detection of MO, the intraspecific conservation of Mycoplasma ovis pneumoniae and the specificity between Mycoplasma ovis pneumoniae and other pathogenic bacteria can be achieved, and have excellent technical effects. In a preferred embodiment, the present invention obtains an optimized reaction system with optimal reaction time and optimal reaction temperature, so that the specificity, sensitivity, repeatability and stability of detection are greatly improved, and specificity is established. A good, highly sensitive, stable and repeatable rapid detection method for Mycoplasma pneumoniae in ovis.

In addition, the method established in the present invention is simple to operate when detecting MO, convenient and time-saving, and does not require large-scale experimental equipment. It is very suitable for rapid detection in the field or on-site by personnel without any experimental basis, and is worthy of promotion and use.

In summary, the detection target of the composition of the present invention is the transketolase gene of Mycoplasma ovis pneumoniae, which can be aimed at a variety of different fragments in the gene, and it has been verified by experiments that the composition of the present invention can design a variety of Different specific combinations can be applied to various amplification methods such as traditional PCR, basic RPA, nfo RPA and exo RPA. In addition, agarose gel electrophoresis, lateral flow chromatography test strips and constant temperature fluorescence amplification instrument can be used to observe the experiment result. The present invention explores the optimum reaction time and optimum reaction temperature, detection specificity, sensitivity, repeatability and stability in the detection process, finds the optimum reaction conditions, and establishes a method with good specificity and high sensitivity. Moreover, the stable and repeatable rapid detection method for Mycoplasma pneumoniae in sheep is simple in operation, convenient and time-saving, and does not require large-scale experimental equipment.

Description of drawings

Fig. 1: Diagram of detection results of the first amplification reaction of the marker gene transketolase of Mycoplasma ovis pneumoniae. M: Molecular mass standard 1: Standard strain of Mycoplasma ovis pneumoniae Y98 2: Mycoplasma ovis pneumoniae SC01 strain 3: Standard strain of Mycoplasma goat subsp. : Mycoplasma agalactiae standard strain PG2 7: Streptococcus pneumoniae 8: Klebsiella 9: Pseudomonas aeruginosa 10: Serratia genus 11: Salmonella bovis 12: Escherichia coli 13: Staphylococcus aureus 14: Pasteurella C: No template control.

Figure 2: Schematic diagram for observing the time gradient results of the second amplification reaction of the transketolase gene. M: DNA molecular mass standard; 1:0min; 2:5min; 3:10min; 4:15min; 5:20min; 6:25min; 7:30min; 8:35min; Template comparison copy.

Fig. 3: Schematic diagram for observing the temperature response gradient results of the second amplification reaction of the transketolase gene. M: DNA molecular mass standard; 1: 34℃; 2: 35℃; 3: 36℃; 4: 37℃; 5: 38℃; 6: 39℃; 7: 40℃; 8: 41℃; 9:42 ℃; C: no template control.

Fig. 4: Schematic diagram for observing the specific reaction results of the second amplification reaction of the transketolase gene. M: Molecular mass standard 1: Standard strain of Mycoplasma ovis pneumoniae Y98 2: Mycoplasma ovis pneumoniae SC01 strain 3: Standard strain of Mycoplasma goat subsp. : Mycoplasma agalactiae standard strain PG2 7: Streptococcus pneumoniae 8: Klebsiella 9: Pseudomonas aeruginosa 10: Serratia genus 11: Salmonella bovis 12: Escherichia coli 13: Staphylococcus aureus 14: Pasteurella C: No template control.

Fig. 5: Schematic diagram for observing the results of the sensitivity reaction of the second amplification reaction of the transketolase gene. M: DNA molecular mass standard; 1: 1.9×10 ¹⁰ ; 2: 1.9×10 ⁹ ; 3: 1.9×10 ⁸ ; 4: 1.9×10 ⁷ ; 5: 1.9×10 ⁶ ; 6: 1.9×10 ⁵ ; 7 : 1.9×10 ⁴ ; 8: 1.9×10 ³ ; 9: 1.9×10 ² ; 10: 1.9×10 ¹ ; 11: 1.9×10 ⁰ ; C: no template control.

Figure 6: Schematic diagram for observing the repeatability results between batches of the second amplification reaction of the transketolase gene.

Fig. 7: Schematic diagram for observing the intra-batch repeatability results of the second amplification reaction of the transketolase gene.

Fig. 8: Schematic diagram for observing the time gradient results of the third amplification reaction of the transketolase gene.

Fig. 9: Schematic diagram for observing the temperature response gradient results of the third amplification reaction of the transketolase gene.

FIG. 10 : Schematic diagram for observing the specific reaction results of the third amplification reaction for the transketolase gene.

FIG. 11 : Schematic diagram for observing the results of the sensitivity reaction of the third amplification reaction of the transketolase gene.

Fig. 12: Schematic diagram for observing the results of the inter-batch repeatability of the third amplification reaction of the transketolase gene.

FIG. 13 : Schematic diagram for observing the intra-batch repeatability results of the third amplification reaction of the transketolase gene.

Fig. 14: the comparison figure of the gene sequence of transketolase gene of the present invention and known Gene ID: 29942122.

Detailed ways

Various exemplary embodiments of the present invention will now be described in detail. The detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features and embodiments of the present invention.

It should be understood that the terminology described in the present invention is only used to describe specific embodiments, and is not used to limit the present invention. In addition, regarding the numerical ranges in the present invention, it should be understood that the upper and lower limits of the range and every intermediate value therebetween are specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated value or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded from the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only the preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and/or materials in connection with which the documents are described. In case of conflict with any incorporated document, the contents of this specification control. "%" is a percentage by weight unless otherwise specified.

Example 1

This embodiment is a detection system for the first amplification reaction of a specific transketolase gene, that is, a process of detecting a specific gene by polymerase chain reaction. Wherein it specifically includes the following contents: (1) the detection system of the first amplification reaction of the present invention:

(2) Reaction conditions:

(3) Detection result: After the reaction, 5 μL of the reaction product was taken and detected by agarose gel (1.5%) electrophoresis, and the detection result is shown in FIG. 1 .

Example 2

This embodiment is a detection system for the second amplification reaction of specific gene transketolase, that is, a basic RPA detection system. Specifically, it includes the following:

(1) The detection system of the second amplification reaction of the present invention:

After the above reaction solution was mixed, 1 μL of the template to be tested and 1.25 μL of MgoAC were added, vortexed and briefly centrifuged, and the reaction solution was placed in a 39°C water bath for 20 minutes. Result detection: after the reaction, 5 μL of the reaction product was taken and detected by agarose gel (1.5%) electrophoresis.

(2) Exploration of the best response time

After establishing the reaction system, set a time gradient from 0 min to 45 min to explore the optimal reaction time. To determine the optimal time for the reaction, use the positive standard plasmid 1.9×10 ⁸ copies/μL as the template for the amplification reaction. After the reaction is complete, Remove the reaction tube and place it on ice to terminate the reaction. The test results are shown in Figure 2.

(3) Exploration of the optimum reaction temperature

Taking 20 min as the optimal reaction time, setting the reaction temperature gradient from 34°C to 42°C, it was found that the reaction can occur within 34°C to 42°C, and the test results are shown in Figure 3. As shown in Figure 3, specific amplification bands were produced at 34°C to 42°C, and the bands were brighter, so 39°C was selected as the optimal reaction temperature.

(4) Specificity of detection

Taking 20min as the optimal reaction time and 39°C as the optimal reaction temperature, the specificity of the detection reaction is shown in Figure 4. As shown in Figure 4, only the standard strain Y98 and clinical strain SC01 of Mycoplasma pneumoniae can be detected, but not The remaining pathogenic bacteria were detected.

(5) Sensitivity of detection

On the premise of good specificity, the target fragment of the transketolase gene was cloned, its copy number was calculated, and a 10-fold serial dilution was carried out. It was found that the minimum detectable limit of the reaction of the present invention was 10 ² copies/μL, and the detection result See Figure 5.

(6) Stability of detection

After exploring the specificity and sensitivity of the reaction, the stability of the reaction needs to be tested. Therefore, three positive plasmid standard samples with different concentrations of 1.9×10 ⁷ , 1.9×10 ⁶ , and 1.9×10 ⁵ were selected and repeated three times under the same conditions to observe the repeat effect within the batch. The test results of the stability within the batch are shown in Figure 7. Shown; get above-mentioned 3 positive plasmid standards of different concentrations, repeat three times in the same experiment, observe the repeated effect between batches, the test result of stability between batches is shown in Figure 6.

A total of 32 nasal swabs were collected from a large-scale sheep farm in Ningxia. Using the second amplification system to detect 32 clinical samples, 14 positive samples were detected. Compared with the traditional molecular biology detection method PCR, the detection coincidence rate was as high as 91%, indicating that the second amplification system established in this experiment The augmentation system works well.

Example 3

This embodiment is a system based on the third amplification reaction of specific gene transketolase, namely nfo RPA.

details as follows:

(1) detection system of the present invention comprises:

The first detection system:

Wherein, Primer free Rehydration buffer is a known commercially available product.

The second detection system:

This base mix contains all the enzymes and reagents needed for the reaction, and only the template and corresponding oligonucleotides need to be added to it. Before the reaction, for example, 1.25 μl of magnesium acetate (MgOAc) should be added to the mixture system to start the reaction. After the reaction, an amplification product is obtained, and the product can be detected using a labeled lateral flow chromatography test strip. When the test product is combined with the test strip, the positive sample will show red at both the test line and the quality control line, while the negative sample will only show red at the accusation line. When the quality control line does not show red, it proves that the test strip is invalid , which is an invalid test result.

(2) Exploration of the best response time

Select the transketolase gene to carry out the experimental conditions of the following recombinant polymerization amplification, design the following oligonucleotides to carry out the recombinant polymerization amplification reaction, so as to establish a method for rapid detection of MO, the specific experimental process is as follows:

The sequence of MTKF is as follows:

TAATTTCAAACTTGGAGCCTACTTAGCTC (contains SEQ ID No.2)

The sequence of MTKR is as follows:

The sequence of (Biotin)TCCTTACTTCGAAAGCCAATTTCATCAAG (comprising SEQ ID No.3) MTKP is as follows:

(FAM)ACCGGTAGTGAGTTAGGACTGGCAAAAGAA/idSp/TCGCTCAAAAAGTTAG(P) (contains SEQ ID No. 4).

reaction system:

After mixing the above reaction solution, add it to the reaction tube and mix well, add 1 μL of the template to be tested and 1.25 μL MgOAC, vortex and briefly centrifuge, put it in a 39 °C water bath, and react for 10 min. After the reaction, take 5 μL of the reaction solution and 100 μL of the detection buffer and mix them thoroughly in a sterile 1.5mL centrifuge tube. Insert a lateral flow chromatography test strip into the mixture to observe the reaction result.

After establishing the reaction system, set the time gradient reaction from 0 min to 45 min to explore the optimal reaction time. It is found that the detection results visible to the naked eye on the lateral flow chromatography test strip can be produced after 5 min of reaction. In order to make the reaction more stable, set 15 min as optimal reaction time. The test results are shown in Figure 8.

(3) Exploration of the optimum reaction temperature

Taking 15min as the optimal reaction time, setting the reaction temperature gradient from 34°C to 42°C, it was found that the reaction can occur within 34°C to 42°C, and the test results are shown in Figure 9. In the reaction results, the test line is red at 39°C Deeper, so choose 39 ℃ as the best reaction temperature.

(4) Specificity of detection

Taking 15min as the optimal reaction time, and 39°C as the optimal reaction temperature, the specificity of the reaction of the present invention is detected, and the detection results are shown in Figure 10, which is the same as the detection result of PCR, and only the standard strain Y98 of Mycoplasma ovis pneumonia can be detected As well as the clinical strain SC01, the remaining pathogenic bacteria could not be detected.

(5) Sensitivity of detection

On the premise of good specificity, clone the target fragment of transketolase gene, calculate its copy number, and carry out 10-fold serial dilution, it is found that the reaction of the present invention can detect the minimum limit of 10 ¹ copies/μL, and the detection result See Figure 11.

(6) Stability of detection

After exploring the specificity and sensitivity of the reaction, the stability of the reaction needs to be tested. Therefore, three positive plasmid standard substances with different concentrations of 1.9×10 ⁷ , 1.9×10 ⁶ , and 1.9×10 ⁵ were selected and repeated three times under the same conditions to observe the repeat effect within the batch. The results of the intra-batch stability test are shown in Figure 13. Shown; Get above-mentioned 3 positive plasmid standards of different concentrations, repeat three times in the same experiment, observe the repeated effect between batches, the stability test result between batches is shown in Figure 12.

After the method was established, 32 clinical samples in our district were detected, and 19 positive samples were found to be detected by the third amplification system of the present invention. The clinical samples were detected by traditional molecular biology detection methods, and the detection results were found to be consistent with PCR detection. The coincidence rate of the results was 94%.

Example 4

This embodiment is a system based on the fourth amplification reaction of a specific fragment of the transketolase gene, namely exo RPA. details as follows:

(1) Construction of the detection system of the present invention:

The first detection system:

Wherein, Primer free Rehydration buffer is a known commercially available product.

This basic mix contains all the enzymes and reagents required for the reaction, and only 1 μL of template and corresponding oligonucleotides need to be added to it. Before the reaction, for example, 1.25 μl of magnesium acetate (MgOAc) at a concentration of 280 mM should be added to the mixture system to start the reaction. The reaction result is carried out in a constant temperature fluorescence amplification instrument, which can detect the reaction in real time.

Specifically, the sequence of the first oligonucleotide MTKEF of this embodiment is identical to (SEQ ID No.2) in Example 1.

The second oligonucleotide sequence MTKER of the present embodiment is identical to (SEQ ID No.3) in embodiment 1.

The third oligonucleotide sequence PE of this embodiment can be at least one of the following two types:

PE1: ACCGGTAGTGAGTTAGGACTGGCAAAAGAAG/i6FAMdT/C/idSp/C/iBHQ1dT/CAAAAGTTAGACCTA (including SEQ ID No. 5, and having a modifying group i6FAMdT/C/idSp/C/iBHQ1dT between positions 31 and 32);

PE2: ATCCAAATTTTGCAATTTCACTTGAATTAGCT/i6FAMdT//idSp//iBHQ1dT/ACTTTTGGTTGAAAAG (includes SEQ ID No. 6 and has a modifying group i6FAMdT//idSp//iBHQ1dT between positions 32 and 33).

In an exemplary reaction system, it comprises:

After mixing the above reaction solution, add it to the reaction tube and mix well, add 1 μL of the template to be tested and 1.25 μL MgOAC, vortex and centrifuge briefly, and put it into a constant temperature fluorescence amplification instrument to react for 15 minutes. It can be connected to a computer to observe the reaction results in real time.

In the present invention, by designing specific primers and probes for recombinant polymerization amplification reaction of specific gene transketolase, the optimal reaction time and optimal reaction temperature, detection specificity, sensitivity, repeatability and stability All of them have been explored, and the optimal reaction conditions have been found, and a rapid detection method for MO with good specificity, high sensitivity, and stable repeatability has been established. The method for detecting MO established in the present invention is simple to operate, convenient and time-saving, does not require large-scale experimental equipment, is very suitable for personnel without any experimental basis, and is worthy of popularization and use.

While the present invention has been described with reference to exemplary embodiments, it is to be understood that the invention is not limited to the disclosed exemplary embodiments. Various adaptations or changes may be made to the illustrated exemplary embodiments of the present invention without departing from the scope or spirit of the present invention. The scope of the claims of the present invention should be based on the broadest interpretation to cover all modifications and equivalent structures and functions.

sequence listing

<110> Ningxia University

<120> Compositions, kits and methods for detecting Mycoplasma pneumoniae with transketolase gene as target

<130> BH1900188-1

<141> 2019-09-16

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1884

<212> DNA

<213> Mycoplasma ovipneumoniae

<400> 1

ttggaatcta aagaaaaagt tgataaattc aaaaaaaagt ttaaatatct tgaagaatta 60

agtgtaaatt ctctaagaat tcacagtaac gaagcaataa ataaagcaaa ttctggtcac 120

cctggcgttg caattagtgc ttcaaaaatg atttatgcac tttttcgtga tcatataaat 180

tttgacctca gtgatccaaa ctgaattaat cgcgaccgtt ttgttttgtc tgccggtcat 240

gcatcttcgc tttattatgc acttttatat agtttaggtt tattaaaaaa agaagatctt 300

gagaattttc ggcaaaaaaa ttcaaaaaca cctggacatc cagaatacgg tcacactgtt 360

ggagttgaag caacaactgg accacttggc caagggattg caatggccgt tggaatggct 420

cttgctcagt cacatttaaa tgcaaaattc aaagaaatta accactacac ctatgtaatt 480

tgcggggatg gtgatcttca ggagggaatt tcctatgagt cactttcact agcgggacat 540

ttaaaactta aaaatttcat tgttttgtat gactcaaatg atattcaact tgactcacca 600

gtaagcgttg tttttagcga aaatatgaaa caacgaattg aatctcaagg tttattttac 660

caattagttc caaaagatga tgtaaaattg atctcaaaag caatttcgaa ggcaaaagct 720

tcccgaagac caagttttat tgaaatcaaa actgttattg gtcaaggttc atctaaacaa 780

aacactaccg aagttcacgg tgctccgcta ggaggcgata ttgttaattt aaagaaaaat 840

cttaaatgaa aacacgaaga agatttttat cttgacccag aaattagcaa acattggcaa 900

aaaacacttg taaaaagaac tcaagctaaa aaagaagctt ttaaaatttc gccagaactt 960

gaagaatttt tacaaaaagg gcaaaatatt aatttggaaa ttgattaga ccttcctaaa 1020

aatcaggcaa cccgggcaac atcgtcttta attcttgact atatttccaa aaaagttcct 1080

tattgaatcg gtggatcagc tgatttca gtttcaacaa aagcaaaagg atcagatggt 1140

tattttagtg accaaaatta tcaaggtcga aatttaatgt ttggtgttcg cgaatttgca 1200

atgagtgcaa ttgcaaatgg aattgccctt cattcagttt tacgcccttt tgtttcaaca 1260

ttttttgtct ttgctgacta tttaaagcct gccttaagac tctcatcatt aatgaaattg 1320

ccagtaactt aatttttac tcacgactcc ttaatggttg gcgaagatgg accgacccac 1380

cagccaattg aacaacttgc aatgcttaga tcagttccta attttgctgt ctatcgtcct 1440

ggtgatgaaa atgaactaaa aggagcttac gaacttgctc ttgaaagcaa agataaacct 1500

tgtgcaataa ttttaactcg ccaaaatatc aaatcattta ctgaatcaaa ggataatttc 1560

aaacttggag cctacttagc tcaaaaaagt aaatcaaaat gagcaattat tactaccggt 1620

agtgagttag gactggcaaa agaagtcgct caaaagttag acctaaattt aatatcgcta 1680

tcaaattgac aaaatacacc aatttgagat ccaaattttg caatttcact tgaattagct 1740

tctacttttg gttgaaaagc acatgcaaaa tataattttg gtcatgatac ctttggaatg 1800

tcagcccctg cagaacacat tcttgatgaa attggctttc gaagtaagga tcttgttgaa 1860

aaaattaaaa aaattattgc ctaa 1884

<210> 2

<211> 29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

taatttcaaa cttggagcct acttagctc 29

<210> 3

<211> 29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tccttacttc gaaagccaat ttcatcaag 29

<210> 4

<211> 45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

accggtagtg agttaggact ggcaaaagaa tcgctcaaaa gttag 45

<210> 5

<211> 46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

accggtagtg agttaggact ggcaaaagaa gcaaaagtta gaccta 46

<210> 6

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atccaaattt tgcaatttca cttgaattag ctacttttgg ttgaaaag 48

Claims (1)

1. A detection system for detecting mycoplasma ovipneumoniae by basicRPA, comprising a first oligonucleotide, a second oligonucleotide capable of hybridizing to a transketolase gene of mycoplasma ovipneumoniae, wherein: the first oligonucleotide is hybridized with a first region of the transketolase gene selectively, the second oligonucleotide is hybridized with a second region of the transketolase gene selectively, the first region is positioned at the 5 '-end side of the transketolase gene, the second region is positioned at the 3' -end side of the transketolase gene, and the distance between the first region and the second region is 50 bp-1000 bp;

the detection system further comprises: 2×reaction buffer, dNTPs, 10×basic E-mix, 20× core Reaction mix; the transketolase gene has intraspecies conservation and interspecific specificity, the gene sequence is shown as SEQ ID No.1, the sequence of the first oligonucleotide is shown as SEQ ID No.2, and the sequence of the second oligonucleotide is shown as SEQ ID No. 3.

Images