CN111172301A

CN111172301A - PCR fluorescence detection kit for clostridium difficile toxin B and application thereof

Info

Publication number: CN111172301A
Application number: CN201911372734.1A
Authority: CN
Inventors: 马东礼; 刘孝荣; 邢志浩; 姜含芳
Original assignee: Shenzhen Childrens Hospital
Current assignee: Shenzhen Childrens Hospital
Priority date: 2019-12-27
Filing date: 2019-12-27
Publication date: 2020-05-19

Abstract

The invention discloses a PCR fluorescence detection kit for clostridium difficile toxin B and application thereof, belonging to the technical field of biology. The kit mainly comprises a specific primer, a probe and a PCR reaction reagent, wherein the specific primer and the probe consist of clostridium difficile toxin B and the specific primer and the probe of an internal reference fragment. The kit can accurately detect clostridium difficile producing toxin B of different genotypes, is not influenced by sequences of other non-clostridium difficile, realizes high sensitivity and high specificity, solves the problem that the sensitivity and the specificity cannot be excellent in the current primer design, and simultaneously searches an optimal target sequence by adopting a cormorant biological big data mining system according to key technical parameters such as copy number, primer dimer, sequence space structure and the like, so that the detection efficiency and the accuracy are greatly improved.

Description

PCR fluorescence detection kit for clostridium difficile toxin B and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a PCR fluorescence detection kit for clostridium difficile toxin B and application thereof.

Background

Difficile is also called difficile, difficile or difficile, belongs to anaerobic bacteria and is generally parasitic in human intestinal tract. Anaerobic bacteria are those that grow better in an anaerobic environment than in an aerobic environment, whereas the human intestinal tract is a relatively anaerobic environment. If some antibiotics are excessively taken, the intestinal flora is unbalanced, and clostridium difficile can rapidly grow to cause inflammation and diarrhea. Difficile, which grows rapidly, produces large amounts of exotoxins a and B. Exotoxin a is an intestinal toxin that can attack mucosal cells resulting in bleeding. Exotoxin B is a cytotoxin, which cannot attack intact mucosal cells in vivo, but only destroys damaged mucosal cells, causing further damage to the mucosal cells. Most difficile bacteria produce both toxins.

Difficile is widely distributed in natural habitats such as water, soil, hay, sand, the intestines and feces of some large animals (cattle, donkeys and horses) and dogs, cats, rodents and humans. The feces of the infants often contain clostridium difficile which is a colonized flora in the intestinal tract of a newborn, about 50 percent of infants with the age of 12 months have clostridium difficile in the intestinal tract, and the bacteria carrying rate of children over 2 years is about 3 percent, and the frequency of the bacteria in healthy adults is low.

Difficile laboratory diagnostic methods are as follows: (1) culturing: the culture specificity of the strain is high, which is necessary for obtaining the strain and carrying out epidemiological investigation, but the detection period is long, the sensitivity is low, the equipment is expensive, and the operation of laboratory professionals is needed; (2) enzyme-linked immunoassay detection of cytotoxic antibodies: the method has the advantages of high speed and specificity of toxin antibody detection, poor repeatability and low sensitivity; (3) colloidal gold method for detecting antigen of cytotoxin: low sensitivity and poor reproducibility. The laboratory detection methods have the defects of poor sensitivity, low specificity, long detection period, high equipment requirement, poor repeatability and the like, so that false positives or false negatives often appear in the detection result, and misdiagnosis and missed diagnosis are caused.

Disclosure of Invention

In order to solve the technical problems, the invention provides a PCR fluorescence detection kit for clostridium difficile toxin B, which can specifically, sensitively, accurately and quickly detect the clostridium difficile toxin B in a body fluid sample.

In order to achieve the purpose, the invention adopts the following technical scheme: a reference sequence of C.difficile toxin B (GenBank: NC-009089.1, sequence full length 7100bp, highly conserved) was downloaded in the International authoritative database GenBank nucleic acid database (Nucleotide) using an autonomously developed "cormorant" bioinformatics data mining system. The reference sequence is used as a template to establish a candidate short fragment library, fragment specificity and sensitivity evaluation, primer design, primer performance evaluation, clinical sample verification and the like, and on the basis, a PCR fluorescence detection kit for the clostridium difficile toxin B with high sensitivity and accuracy, strong specificity, low cost and larger detection flux is developed. The innovation of the invention is that: 1) the kit can accurately detect clostridium difficile producing toxin B with different genotypes, is not influenced by sequences of other clostridium difficile, realizes high sensitivity and high specificity, and solves the difficult problem that the sensitivity and specificity cannot be both excellent in the current primer design; 2) the cormorant biological big data mining system adopted by the invention searches the optimal target sequence according to key technical parameters such as copy number, primer dimer, sequence space structure and the like, so that the detection efficiency and accuracy are greatly improved.

The PCR fluorescence detection kit for clostridium difficile toxin B comprises a reaction solution A and a reaction solution B, wherein the reaction solution A comprises two pairs of primers and two probes: the toxin B primer pair SEQ ID NO.1 and SEQ ID NO.2 and the corresponding FAM labeled probe SEQ ID NO. 3; the internal reference fragment primer pair SEQ ID NO.4 and SEQ ID NO.5 and the corresponding HEX-labeled probe SEQ ID NO. 6. Wherein HEX and FAM are fluorescent groups, and TAMRA is a quenching group. The reaction solution B contained a hot start enzyme and UNG enzyme.

The invention provides a negative quality control product and a positive quality control product. The negative quality control product is physiological saline, and the positive quality control product is engineering bacterial suspension for cloning the clostridium difficile toxin B gene.

The DNA sequence of the reference fragment SEQ ID NO.7 is as follows:

TCACAAGCAGGAGTGTGCCAGGAGAAGGCCAAACCATCCAGTGCCGGTGGTTTGACCACGAGGAGTGCATCCTGCACGGAGTCACTGAGCTCGTGACCTCCACGCTGCTCGTCCCCTGCGCTATCGAGAGGGCACTCTCTGTGTCTCAGCTGGTGCCGCTGGCGCAGAGTGTTTTGGGCCCCTTAAAGCTCAGCATGGCTGGTTCTGGAGAGATGGAAAAGAGAAAGGATTTCCCCCATTTGGGTGCCTCGGGCATGTGGAGGAAGGTGGTCCGGCGAACGAAGCAGGGCTGCGTGAAGGGGATCTGATAACCCACGTCAACGGAGAGCCAGTCCATGG

the combination of primers and probes was as follows:

the upstream primer of the target fragment of the toxin B is SEQ ID NO. 1: 5'-GGTGTAAGTTTAGGTGCAGCAAT-3', respectively;

downstream primer of toxin B target segment SEQ ID NO. 2: 5'-TGATTGCAGTTGTAGCTGTTGT-3', respectively;

probe of toxin B target fragment SEQ ID NO. 3:

5’-FAM-TGGGTCACTCGTTTCACTTAGCTCT-TAMRA-3’；

the upstream primer of the internal reference fragment is SEQ ID NO. 4: 5'-GGCATGTGGAGGAAGGTGGT-3', respectively;

downstream primer of internal reference fragment SEQ ID NO. 5: 5'-CCATGGACTGGCTCTCCGTT-3', respectively;

probe of internal reference fragment SEQ ID NO. 6: 5 '-HEX-ACGCAGCCCTGCTTCGTTCGCCG-TAMRA-3'.

The two pairs of primers and probes can be used for carrying out double fluorescence PCR amplification on the toxin B specific target fragment and the internal reference fragment on the clostridium difficile genome at the same time.

The invention also provides an application of the kit, which comprises the following steps:

(1) extracting DNA of a sample to be detected;

(2) adding PCR reaction solution A and PCR reaction solution B in a certain proportion by using sample DNA to be detected as template, wherein reaction solution A comprises 12.5mM Tris-HCl, pH9.0, 50mM KCl, 0.125%

X-100、3.125mM MgCl₂0.44625mM dATP, 0.44625mM dGTP, 0.44625mM dCTP, 0.78125mM dUTP, the two pairs of primers SEQ ID NO.1 and 2, 4 and 5, both at a concentration of 0.3 to 0.7. mu.M, and the two probes SEQ ID NO.3, 6, both at a concentration of 0.14 to 0.16. mu.M; reaction solution B contained 20mMTris-HCl、100mM KCl、0.1mM EDTA、1mM DTT、50％Glycerine、0.5％

20. 1-3U/mu L hot start enzyme and 0.1-0.3U/mu LUNG enzyme, and performing PCR amplification on a negative quality control product and a positive quality control product;

(3) and (5) judging the result according to the Ct value.

Further, in the step (2), the reaction solution A contains two pairs of primers SEQ ID No.1 and 2, 4 and 5 with the concentration of 0.5 μ M, and two probes SEQ ID No.3 and 6 with the concentration of 0.15625 μ M; the PCR reaction solution B contained hot-start enzyme and UNG enzyme at concentrations of 2U/. mu.L and 0.2U/. mu.L, respectively.

Further, the volume ratio of the sample DNA to be detected to the reaction solution A and the reaction solution B is 3: 16: 1.

further, the parameters of the PCR amplification procedure are as follows:

120s at 50 ℃, 1 cycle;

600s at 95 ℃ for 1 cycle;

95 ℃, 15s, 55 ℃, 45s (fluorescence collected), 40 cycles;

37 ℃, 20s, 1 cycle.

Further, the negative quality control product is physiological saline, and the positive quality control product is engineering bacterial suspension for cloning clostridium difficile toxin B genes.

The construction process of the engineering bacterium for cloning the clostridium difficile toxin B gene is as follows:

1. amplification of a fragment of interest

① Takara Taq^TMHot Start Version (Lot # AIG1122A) the target fragment was amplified as described in Table 1

TABLE 1

PCR parameters

300s at 95 ℃ for 1 cycle;

95 ℃, 15s, 55 ℃, 30s, 72 ℃, 30s, 40 cycles;

72 ℃, 300s, 1 cycle;

37 ℃, 20s, 1 cycle.

and thirdly, agarose gel electrophoresis verification is carried out.

2. 3' end of the blunt-ended DNA fragment plus "A" reaction

Construction of engineering bacteria Using Takara DNA A-Tailing Kit

first, 50. mu.L of the reaction solution "A" was added to a microcentrifuge tube in the amount shown in Table 2.

TABLE 2

Name of reagent	Amount of the composition used
		10×A-Tailing Buffer	5μL
dNTP Mixture	4μlL
		A-Tailing Enzyme	0.5μL
Terminal smoothing DNA fragment	0.5～5μg
		Sterilized water	up to 50μL

② reaction for 20 minutes at 72 ℃.

and standing in ice for 1-2 minutes.

Ligation transformation of A-labeling DNA fragment and T vector

prepare DNA solution in a microcentrifuge tube according to Table 3, the total amount is 5. mu.L.

TABLE 3

Name of reagent	Amount of the composition used
		pMD18-T Vector*	1μL
A-labeling DNA solution of the above 1- (iii)	0.1～0.3pmol
		Sterilized water	up to 5μL

pMD18-T Vector was the same preparation as CodeNo.6011, and 1. mu.L (50ng) of this T Vector was about 0.03 pmol.

② adding 5 mu L (equivalent) Solution I

Solution I is a component of Code No.6022 DNA Ligation Kit Ver.2.1.

③ 16 ℃ for 30 minutes.

Room temperature (25 ℃) also allowed the ligation reaction to proceed normally, but the reaction efficiency was slightly reduced.

The ligation reaction proceeded normally even in 5 minutes, but the reaction efficiency was slightly decreased.

When cloning is performed on a long fragment DNA (2kb or more), the ligation reaction time is required to be extended to several hours.

(10. mu.L) was added to 100. mu.L of JM109 competent cells, and left on ice for 30 minutes.

heating at 42 deg.C for 45 seconds, and then placing in ice for 1 minute.

sixthly, adding 890 mu L of SOC culture medium, and carrying out shaking culture at 37 ℃ for 60 minutes.

seventhly, culturing on an L-agar plate culture medium containing X-Gal, IPTG and Amp to form a single colony, and counting white colonies and blue colonies.

and eighthly, selecting white colonies, and confirming the length of the inserted fragment in the carrier by using a PCR method.

ninthly, detecting the bacterial strain with the correct size of the inserted fragment by a PCR method, namely the engineering bacteria for cloning the B gene of the clostridium difficile toxin, and preserving the bacterial strain.

Drawings

FIG. 1 is a temperature profile of PCR amplification conditions in example 1.

FIG. 2 is a PCR amplification graph of FAM-labeled probes of the primer set 1 and the probe set 1 in example 1.

FIG. 3 is a graph showing the PCR amplification curves of HAX-labeled probes in the sample set consisting of primer set 1 and probe set 1 in example 1.

FIG. 4 is a PCR amplification graph of FAM-labeled probes of the sample of the primer set 2 and the probe set 2 in example 1.

FIG. 5 is a graph showing the PCR amplification curves of HAX-labeled probes in the sample set of primer set 2 and probe set 2 in example 1.

FIG. 6 is a PCR amplification graph of FAM-labeled probes of the primer pair 3 and probe 3 sets in example 1.

FIG. 7 is a graph showing the PCR amplification curves of HAX-labeled probes in the sample set of primer pair 3 and probe 3 in example 1.

FIG. 8 is a temperature profile of PCR amplification conditions in example 2.

FIG. 9 is a PCR amplification graph of negative sample FAM-labeled probe in example 2.

FIG. 10 is a PCR amplification graph of the HEX-labeled probe of the negative sample in example 2.

FIG. 11 is a PCR amplification graph of positive sample FAM-labeled probe in example 2.

FIG. 12 is a PCR amplification graph of positive sample HEX-labeled probe in example 2.

Detailed Description

Example 1

Screening of PCR (polymerase chain reaction) fluorescence detection kit primers for clostridium difficile toxin B

1. Sample collection

And taking the diarrhea feces, and timely inspecting. 16 samples were collected, and all clinical samples were obtained from the child hospital in Shenzhen city.

2. Sample extraction

(1) Taking internal reference fragment (2X 10)⁴copes/mL)10 μ l was added to 500 μ l of sample treatment solution (10mM Tris-HCl, pH 8.0; 6M guanidine hydrochloride; 25mM NaOH; 1% TritonX-100; 1% NP-40; 1mM EDTA);

(2) taking 100-200 mg of a fecal sample, if the sample is liquid, sucking 0.15-0.20 ml of the sample, adding 500 mu l of sample treatment liquid, shaking and uniformly mixing, and carrying out constant temperature treatment at 100 ℃ for 10 minutes;

(3) centrifuge at 12,000g for 5 minutes;

(4) adding 200 mul of absolute ethyl alcohol into 400 mul of supernatant, and mixing uniformly;

(5) transferring the suspension into a centrifugal column, centrifuging for 1 minute at 12,000g, and arranging a new collecting pipe in the centrifugal column;

(6) mu.l of inhibitor-removing solution (20mM Tris-HCl, pH 6.8, 4M guanidine hydrochloride, 40% C)₂H₃OH) is added into a centrifugal column, 12,000g is centrifuged for 1 minute, and a new collection tube is arranged in the centrifugal column;

(7) mu.l of ion-depleted solution (20mM Tris-HCl, pH 8.0; 20mM NaCl; 75% C)₂H₃OH) is added into a centrifugal column, 12,000g is centrifuged for 1 minute, and a new collection tube is arranged in the centrifugal column;

(8) centrifuge the column-collection tube at room temperature for 1 minute at 12,000g to remove the remaining ethanol;

(9) the column was placed in a clean 1.5ml centrifuge tube, 50. mu.l of an eluent (10mM Tris-HCl, pH 8.0; 1mM EDTA) was carefully added from directly above the column, and after standing at room temperature for 2min, 12,000g of the column was centrifuged for 1 minute, and the fecal DNA extract (specimen) was obtained in the centrifuge tube and used.

3. Primer screening

3 primer pairs and 3 probes are designed in the laboratory, and the combination of the primer pairs and the probes is as follows:

(1) primer pair 1 and probe 1 sequences:

upstream primer 1 of toxin B target fragment SEQ ID NO. 1: 5'-GGTGTAAGTTTAGGTGCAGCAAT-3', respectively;

downstream primer 1 of toxin B target fragment SEQ ID NO. 2: 5'-TGATTGCAGTTGTAGCTGTTGT-3', respectively;

probe 1 of the toxin B target fragment SEQ ID NO. 3:

5’-FAM-TGGGTCACTCGTTTCACTTAGCTCT-TAMRA-3’；

(2) primer pair 2 and probe 2 sequences:

upstream primer 2 of toxin B target fragment SEQ ID No. 8: 5'-GGATTTGTGACTGTAGGCGAT-3', respectively;

downstream primer 2 of toxin B target fragment SEQ ID No. 9: 5'-ACACCTGTTTGTAACACTCCAC-3', respectively;

probe 2 for the toxin B target fragment SEQ ID NO. 10:

5’-FAM-TCTCTCCAATTGAAGCAGCTCCACCA-TAMRA-3’；

(3) primer pair 3 and probe 3 sequences:

upstream primer 3 of toxin B target fragment SEQ ID NO. 11: 5'-GATTTGTGACTGTAGGCGAT-3', respectively;

downstream primer 3SEQ ID No.12 of toxin B target fragment: 5'-ACACTCCACTTTGGTTGAAA-3', respectively;

probe 3 for the toxin B target fragment SEQ ID NO. 13:

5’-FAM-GGTGGAGCTGCTTCAATTGGAGAGACA-TAMRA-3’；

4. sample adding system

The PCR reaction solution included the PCR reaction solution A, PCR, reaction solution B. Wherein the reaction solution A comprises 12.5mM Tris-HCl, pH9.0, 50mM KCl, 0.125%

X-100、3.125mM MgCl₂0.44625mM dATP, 0.44625mM dGTP, 0.44625mM dCTP, 0.78125mM dUTP, two pairs of primers SEQ ID NO.1 and 2, 4 and 5, both at a concentration of 0.5. mu.MProbes SEQ ID NO.3 and 6, at a concentration of 0.15625. mu.M; reaction solution B comprises 20mM Tris-HCl, 100mM KCl, 0.1mM EDTA, 1mM DTT, 50% Glycerin, 0.5%

20. 2U/. mu.L of hot start enzyme, 0.2U/. mu.LUNG enzyme.

The sample adding system is as follows:

the PCR reaction solution A has 3 combinations: (1) comprises two groups of primer pairs SEQ ID NO.1 and 2, 4 and 5 and two probes SEQ ID NO.3 and 6; (2) comprises two groups of primer pairs SEQ ID NO.8 and 9, 4 and 5 and two probes SEQ ID NO.10 and 6; (3) comprises two groups of primer pairs SEQ ID NO.11 and 12, 4 and 5 and two probes SEQ ID NO.13 and 6.

The PCR reaction solution B comprises a hot start enzyme and UNG enzyme.

5. Fluorescent PCR reaction

Corresponding to the sample adding system, the components in the kit are respectively added into a PCR reaction tube for PCR amplification reaction, and the specific reaction steps are as follows:

120s at 50 ℃, 1 cycle;

600s at 95 ℃ for 1 cycle;

95 ℃, 15s, 55 ℃, 45s (fluorescence collected), 40 cycles;

37 ℃, 20s, 1 cycle.

(see attached FIG. 1)

6. Determination of results (based on Ct value and amplification Curve morphology)

7. And (3) detection results:

the internal reference (HAX) of the three combinations of the primer pair 1 and the probe 1 group, the primer pair 2 and the probe 2 group and the primer pair 3 and the probe 3 group can be amplified normally to present a normal S-shaped curve (see the attached figures 3, 5 and 7); for amplification of toxin B target gene, the curves presented by the primer pair 1 and probe 1 group show better linear relationship relative to other two primer pairs and two probes (see figures 2, 4 and 6), so primer pair 1 and probe 1 are selected as the primer pair and probe used in the kit.

Example 2

Evaluation of specificity and sensitivity of PCR (polymerase chain reaction) fluorescence detection kit for clostridium difficile toxin B

1. Sample preparation:

(1) positive samples: culturing engineering bacteria for cloning C.difficile toxin B gene and extracting plasmid, measuring concentration with Qubit, calculating its concentration, and diluting the plasmid with AE buffer at 10-fold dilution to 1.0 × 10⁵copies/mL～1.0×10²Four copies/mL concentration gradients.

(2) Negative samples: physiological saline, and nucleic acids of Escherichia coli, Salmonella group, enterococcus faecium, and enterococcus faecalis (bacteria obtained by culturing feces, as confirmed by mass spectrometry and Sanger sequencing).

2. Sample adding system:

X-100、3.125mM MgCl₂0.44625mM dATP, 0.44625mM dGTP, 0.44625mM dCTP, 0.78125mM dUTP, two pairs of primers SEQ ID No.1 and 2, 4 and 5, both at a concentration of 0.5. mu.M, and two probes SEQ ID No.3, 6, both at a concentration of 0.15625. mu.M; reaction solution B comprises 20mM Tris-HCl, 100mM KCl, 0.1mM EDTA, 1mM DTT, 50% Glycerin, 0.5%

20. 2U/. mu.L of hot start enzyme, 0.2U/. mu.LUNG enzyme.

The sample adding system is as follows:

negative sample well

Component name	Composition of matter	Addition of
			PCR reaction solution A	Primer and probe	16μl
PCR reaction solution B	Hot start enzyme, UNG enzyme	1μl
			Negative sample	Physiological saline and nucleic acid of bacteria	3μL
Total volume		20μL

Positive sample well

Component name	Composition of matter	Addition of
			PCR reaction solution A	Primer and probe	16μl
PCR reaction solution B	Hot start enzyme, UNG enzyme	1μl
			Positive sample	4 concentrations of recombinant plasmid	3μL
Total volume		20μL

3. And (3) fluorescent PCR reaction:

120s at 50 ℃, 1 cycle;

600s at 95 ℃ for 1 cycle;

95 ℃, 15s, 55 ℃, 45s (fluorescence collected), 40 cycles;

37 ℃, 20s, 1 cycle.

(see the attached figure 8)

4. Determination of result (according to Ct value)

5. And (3) detection results:

on the premise of ensuring that the PCR positive quality control product is positive (see figure 10), the amplification curve of the negative sample is notThe kit shows an S-shaped curve (see figure 9), and the amplification curves of the four bacteria are consistent and negative, so that the primer pair and the probe of the kit have strong specificity; under the condition that the PCR positive quality control product is positive, the positive sample is 1.0 multiplied by 10⁵copies/mL～1.0×10²The copies/mL has good linear relation, and the sensitivity can reach 1.0 multiplied by 10²copies/mL, FIG. 11 is the amplification curve of toxin B target gene, and FIG. 12 is the amplification curve of internal reference.

Example 3

PCR fluorescence detection kit and PCR fluorescence detection method for clostridium difficile toxin B

Comparison experiment of clostridium difficile glutamate dehydrogenase antigen and toxin detection kit (enzyme linked immunosorbent assay)

1. Sample collection

And taking the diarrhea feces, and timely inspecting. 97 samples were collected in total, and all clinical samples were obtained from the child hospital in Shenzhen city.

2.

The operation flow of the clostridium difficile glutamate dehydrogenase antigen and toxin detection kit (enzyme linked immunosorbent assay) (national food and drug administration, No. 2014, No. 3403929):

(1) all reagents and the corresponding number of reaction plates were left at room temperature before use.

(2) A small test tube is prepared and labeled for each sample, optionally with external quality control if necessary.

(3) Diluent (black dropper capped bottle) was taken and 750. mu.L (2 nd scale from tip) of the diluent was added to each fecal sample tube.

(4) One drop of conjugate (red capped bottle) was added dropwise to each tube.

(5) One disposable plastic pipette (provided with the kit) was used for each sample, and the scale of the pipette was incremented by 25. mu.L, 400. mu.L, and 500. mu.L.

(6) All samples, whether viscous or not, were mixed thoroughly and the samples were allowed to suspend evenly before pipetting.

(7) One reaction plate is taken from each sample, and one reaction plate is taken for external positive control or negative control according to needs. The aluminum foil bags containing the reaction plates should be left at room temperature before opening. It should be used immediately after opening. Each reaction plate should be marked and placed on the platform in the direction so that the "c.diff COMPLETE" print is at the bottom of the reaction plate and the small sample well is at the top right corner.

(8) Each diluted sample tube was tightly capped and mixed thoroughly. The sample is mixed by vortexing or inverting the tube. When the patient sample or positive control has been added to the diluent/conjugate, it can be incubated at room temperature for an additional period of up to 24 hours before being added to the reaction plate.

(9) Using a new pipette, 5400. mu.L of the sample mixture was pipetted into the sample well of the reaction plate (well in the upper right corner of the reaction plate). When the sample is added to the sample hole, the pipette tip and the reaction window (large hole in the middle of the reaction plate) are ensured to be in a certain angle.

(10) The reaction plate was incubated at room temperature for 15 minutes and the sample would diffuse through the reaction plate by siphoning and the wet zone would diffuse to the reaction window.

(11) After incubation, 300 μ L of wash buffer (white dropper capped vial) was added to the reaction window. After 10 minutes the test results were observed and recorded.

3. In the detection of the PCR fluorescence detection kit for clostridium difficile toxin B, a primer pair 1 and a probe 1 are selected as a primer pair and a probe used by the kit, and the specific detection method is shown in example 1.

4. The result of the detection

In 97 stool samples: (1) the kit used by the invention detects 49 toxin B genes as positive and 48 toxin B genes as negative; (2) 26 positive clostridium difficile toxins A/B are detected by an antigen method, and 71 negative clostridium difficile toxins A/B are detected;

and (3) comparing the results: the sensitivity of the exotoxin A/B detected by the enzyme-linked immunosorbent assay is 42.8 percent, and the specificity is 89.6 percent; the invention can well improve the sensitivity and specificity of detection and avoid missed diagnosis and misdiagnosis.

Example 4

The comparison experiment between the PCR fluorescence detection kit for clostridium difficile toxin B and the nucleic acid (DNA) detection kit for clostridium difficile (real-time fluorescence PCR method) is carried out

1. Sample collection

2. Clostridium Difficile Nucleic Acid (DNA) detection kit (real-time fluorescence PCR method) (national instruments 20153404032) operational procedures:

(1) the cartridge and the sample processing solution are removed from the package.

(2) The swab was briefly placed into the unformed fecal sample. The swab need not be completely soaked.

(3) The swab is inserted into a vial containing a sample processing fluid.

(4) The swab tube is held close to the vial rim, the swab is lifted a few millimetres from the bottom of the treatment solution vial, the tube is pressed against the vial rim and broken off. Ensure that the swab is short enough to allow the cover to be closed tightly.

(5) The lid was closed and vortexed at high speed for 10 seconds.

(6) And opening the detection box cover. Using a clean pipette, the entire sample reagent is transferred into the "S" chamber of the xpetc.

(7) And covering the detection box cover.

(8) The detection was carried out on the machine according to the GeneXpert System operating Manual.

4. And (3) detection results:

in 97 stool samples: (1) the invention detects 49 positive toxins B and 48 negative toxins B; (2) the detection of a clostridium Difficile Nucleic Acid (DNA) detection kit (a real-time fluorescence PCR method) reports that 48 toxins B are positive and 49 toxins B are negative. Using a kit with a certificate of registration (clostridium Difficile Nucleic Acid (DNA) detection kit (real-time fluorescence PCR method)) as a gold standard, compare as follows:

the sensitivity of the obtained kit is 97.91%; the specificity is 95.91%, and the comparison shows that the kit has extremely high sensitivity and specificity. The clostridium difficile nucleic acid detection kit needs to be provided with a special instrument, only can operate a plurality of reactions each time, and is expensive.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> Shenzhen city children hospital

<120> PCR fluorescence detection kit for clostridium difficile toxin B and application thereof

<130>2019.11.28

<141>2019-12-27

<160>13

<170>SIPOSequenceListing 1.0

<210>1

<211>23

<212>DNA

<213> Artificial sequence ()

<400>1

ggtgtaagtt taggtgcagc aat 23

<210>2

<211>22

<212>DNA

<213> Artificial sequence ()

<400>2

tgattgcagt tgtagctgtt gt 22

<210>3

<211>25

<212>DNA

<213> Artificial sequence ()

<400>3

tgggtcactc gtttcactta gctct 25

<210>4

<211>20

<212>DNA

<213> Artificial sequence ()

<400>4

ggcatgtgga ggaaggtggt 20

<210>5

<211>20

<212>DNA

<213> Artificial sequence ()

<400>5

ccatggactg gctctccgtt 20

<210>6

<211>23

<212>DNA

<213> Artificial sequence ()

<400>6

acgcagccct gcttcgttcg ccg 23

<210>7

<211>339

<212>DNA

<213> Artificial sequence ()

<400>7

tcacaagcag gagtgtgcca ggagaaggcc aaaccatcca gtgccggtgg tttgaccacg 60

aggagtgcat cctgcacgga gtcactgagc tcgtgacctc cacgctgctc gtcccctgcg 120

ctatcgagag ggcactctct gtgtctcagc tggtgccgct ggcgcagagt gttttgggcc 180

ccttaaagct cagcatggct ggttctggag agatggaaaa gagaaaggat ttcccccatt 240

tgggtgcctc gggcatgtgg aggaaggtgg tccggcgaac gaagcagggc tgcgtgaagg 300

ggatctgata acccacgtca acggagagcc agtccatgg 339

<210>8

<211>21

<212>DNA

<213> Artificial sequence ()

<400>8

ggatttgtga ctgtaggcga t 21

<210>9

<211>22

<212>DNA

<213> Artificial sequence ()

<400>9

acacctgttt gtaacactcc ac 22

<210>10

<211>26

<212>DNA

<213> Artificial sequence ()

<400>10

tctctccaat tgaagcagct ccacca 26

<210>11

<211>20

<212>DNA

<213> Artificial sequence ()

<400>11

gatttgtgac tgtaggcgat 20

<210>12

<211>20

<212>DNA

<213> Artificial sequence ()

<400>12

acactccact ttggttgaaa 20

<210>13

<211>27

<212>DNA

<213> Artificial sequence ()

<400>13

ggtggagctg cttcaattgg agagaca 27

Claims

1. A PCR fluorescence detection kit for Clostridium difficile toxin B comprises specific primers, probes and PCR reaction reagents, wherein the specific primers and the probes consist of specific primers and probes for Clostridium difficile toxin B and internal reference fragments, and the PCR fluorescence detection kit is characterized in that the specific primers and the probes have the following sequences:

probe of toxin B target fragment SEQ ID NO. 3:

5’-FAM-TGGGTCACTCGTTTCACTTAGCTCT-TAMRA-3’；

2. Use of a PCR fluorimetric detection kit of clostridium difficile toxin B according to claim 1.

3. The use according to claim 2, comprising the steps of:

(1) extracting DNA of a sample to be detected;

X-100、3.125mM MgCl₂0.44625mM dATP, 0.44625mM dGTP, 0.44625mM dCTP, 0.78125mM dUTP, two pairs of primers SEQ ID No.1 and 2, 4 and 5, both at a concentration of 0.3-0.7. mu.M, and two probes SEQ ID No.3, 6, both at a concentration of 0.14-0.16. mu.M; reaction solution B contained 20mM Tris-HCl, 100mM KCl, 0.1mM EDTA, 1mM DTT, 50% Glycerin, 0.5%

20. 1-3U/muL hot start enzyme and 0.1-0.3U/muL UNG enzyme, and performing PCR amplification on a negative quality control product and a positive quality control product;

(3) and (5) judging the result according to the Ct value.

4. The use according to claim 3, wherein the volume ratio of the sample DNA to be tested to the reaction solution A and the reaction solution B is 3: 16: 1.

5. the use according to claim 3, wherein in the step (2), the reaction solution A contains two pairs of primers SEQ ID No.1 and 2, 4 and 5 at a concentration of 0.5. mu.M, and two probes SEQ ID No.3 and 6 at a concentration of 0.15625. mu.M; the PCR reaction solution B contained hot-start enzyme and UNG enzyme at concentrations of 2U/. mu.L and 0.2U/. mu.L, respectively.

6. Use according to claim 3, wherein the parameters of the PCR amplification procedure are as follows:

120s at 50 ℃, 1 cycle;

600s at 95 ℃ for 1 cycle;

95 ℃, 15s, 55 ℃, 45s, 40 cycles;

37 ℃, 20s, 1 cycle.

7. The use of claim 3, wherein the negative quality control substance is physiological saline and the positive quality control substance is an engineered bacterial suspension for cloning the B gene of Clostridium difficile.