CN113046455A - Primer probe group for detecting helicobacter pylori based on LFD-RMA method - Google Patents
Primer probe group for detecting helicobacter pylori based on LFD-RMA method Download PDFInfo
- Publication number
- CN113046455A CN113046455A CN202110452393.XA CN202110452393A CN113046455A CN 113046455 A CN113046455 A CN 113046455A CN 202110452393 A CN202110452393 A CN 202110452393A CN 113046455 A CN113046455 A CN 113046455A
- Authority
- CN
- China
- Prior art keywords
- helicobacter pylori
- lfd
- rma
- detection
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application belongs to the technical field of biological detection, and particularly relates to a primer probe group for detecting helicobacter pylori based on an LFD-RMA method, which comprises a primer pair for detecting the helicobacter pylori and a corresponding probe, wherein the 5' end of a downstream primer is marked by Biotin; the 5 'end of the probe is marked by FAM, the 31 st base T is replaced by THF (dSpacer), and the 3' end is modified by a blocking group C3-spacer; the amplification product size does not exceed 500 bp. The detection method is simple, noninvasive, rapid, high in accuracy and good in safety, and can be widely applied to rapid detection of helicobacter pylori.
Description
Technical Field
The application belongs to the technical field of biological detection, and particularly relates to a primer probe group for detecting helicobacter pylori based on an LFD-RMA method.
Background
Helicobacter Pylori (HP) is a gram-negative bacterium which is extremely viable, can survive in the strongly acidic environment of the stomach, is the only bacterium found to be able to survive in the stomach, and is the only host and source of infection. HP is the main reason for peptic ulcer occurrence and recurrence after treatment, and the detection rate of HP in patients with duodenal ulcer is as high as 95% -100%, and the detection rate of HP in patients with gastric ulcer is more than 70%. Meanwhile, HP can cause gastric cancer and gastric mucosa-associated lymphoid tissue lymphoma, and is definitely listed as a class I carcinogen by the world health organization. The infection rate of HP varies in all parts of the world, mainly depends on factors such as race difference, living environment, sanitary conditions, economic conditions, education degree, high-risk occupation (medical staff) and the like, but the total number of infected people is huge. The statistics of the adult infection rate in China are different, but the statistics is generally considered to be more than 50%. Most infected persons are asymptomatic and can be found only by relevant examination during physical examination; a small percentage of people will present with symptoms of dyspepsia; peptic ulcer may occur in 10% -20% of infected persons; less people develop gastric cancer or gastric mucosa-associated lymphoblastic lymphoma. Therefore, the rapid and accurate detection of HP infection is of great significance to public health.
At present, the detection of helicobacter pylori mainly comprises serum Hp antibody detection, urea breath test, excrement helicobacter pylori antigen detection and fluorescent quantitative PCR detection. The serum antibody test is generally used for epidemiological investigation of the infection rate of people because the previous infection or the infection can not be distinguished; the popularity of fecal Hp antigen detection is not yet very high; the urea breath test is widely used for clinically judging infection and rechecking after treatment at present, but antibiotics, bismuth agents and acid-inhibiting drugs are stopped or forbidden within 4 weeks before examination, and false positive easily occurs; the fluorescent quantitative PCR method is sensitive and efficient, but the cost is high, and the method is not suitable for popularization in primary hospitals.
The Recombinase Mediated Amplification (RMA) technology is a sensitive, specific, simple, fast and isothermal nucleic acid Amplification technology developed in recent years, and is considered as a nucleic acid detection technology capable of replacing PCR, and mainly depends on three enzymes, namely Recombinase, single-stranded DNA binding protein (SSB) and strand displacement DNA polymerase. The RMA reaction can be carried out at 37-42 ℃, the detection level can be reached within 30min in the whole process, and the rapid amplification of nucleic acid can be realized. The RMA technology can be combined with a lateral flow immunochromatography (LFD) technology to detect the amplification product, no special instrument and equipment are required, no complex sample treatment is required, and the result can be observed by naked eyes only by using lateral flow chromatography test paper, so that the rapid detection of the helicobacter pylori can be realized.
Disclosure of Invention
In order to solve the problems of the prior art, the application provides a primer probe group for detecting helicobacter pylori based on an LFD-RMA method, and the application is realized by the following scheme:
a primer probe group for detecting helicobacter pylori based on an LFD-RMA method comprises a primer pair for detecting helicobacter pylori and a corresponding probe, wherein the sequences of the primer and the probe are as follows:
HP-F：
5’-GGCGTGCCTAATACATGCAAGTCGAACGATGAA-3’；
HP-R：
5’-[Biotin]ATTGAGCAATATTCCCTACTGCTGCCTCCCGTA-3’；
HP-P：
5’-[FAM]AGGCTATGACGGGTATCCGGCCTGAGAGGG[dSpacer]GAACGGACACACTGGA[C3-spacer]-3’。
preferably, the 5' end of the downstream primer is labeled by Biotin; the 5 'end of the probe is marked by FAM, the 31 st base T is replaced by THF (dSpacer), and the 3' end is modified by a blocking group C3-spacer; the amplification product size does not exceed 500 bp.
A kit for detecting helicobacter pylori based on LFD-RMA method comprises: a detection tube containing an amplification reaction reagent, a buffer solution, magnesium acetate, standard positive plasmids, sterile double distilled water and a lateral flow chromatography detection test strip.
Preferably, the amplification reaction reagent is packaged in a single tube, is in a dry powder form, and comprises RMA primer pairs and detection probe sets with the final concentration of 10 muM, 100 ng/muL of escherichia coli RecA protein, 40 ng/muL of UvsY protein, 800 ng/muL of single-stranded binding protein GP32, 60 ng/muL of Bst polymerase and 80 ng/muL of endonuclease IV.
Preferably, the final concentration of the magnesium acetate is 100 mM.
Preferably, the buffer comprises the following components: 50mM Tris, 10% w/v polyethylene oxide, 2mM trehalose, 2.5mM mannitol, 10mM ATP, 2mM dNTPs, 1000ng/mL creatine kinase and 25mM phosphocreatine.
Preferably, the standard positive plasmid is a recombinant plasmid containing an HP gene fragment, and is used as a positive control for HP nucleic acid detection.
Preferably, the sterile double distilled water is used as a negative control, and the sterile double distilled water and standard positive plasmids are used together to test whether the corresponding reaction system and reaction conditions can normally react.
Preferably, the sample which can be detected by the kit is saliva, dental plaque, gastric mucosal tissue, gastric juice, intestinal juice, feces and the like.
A method for detecting helicobacter pylori based on an LFD-RMA method comprises the following steps:
(1) extracting DNA of a sample to be detected;
(2) designing a primer pair and a probe for HP detection;
(3) and adding the amplification reaction reagent in the kit to perform RMA amplification reaction by taking the extracted DNA of the sample to be detected as a template. The amplification reaction is carried out in a constant-temperature water bath kettle under the following reaction conditions: water bath at 40 deg.C for 5min, mixing, and water bath at 40 deg.C for 15 min;
(4) and (3) detecting an amplification product by using a lateral flow chromatography test strip: when the test strip has two color strips, one strip is positioned in the quality control area, and the other strip is positioned in the detection area, the result is positive, and the HP is contained in the sample; when only the quality control area of the test strip has a color strip and the detection area has no strip, the result is negative, which indicates that the sample does not contain HP.
Has the advantages that: (1) the operation is convenient, the detection time is short, the RMA amplification reaction can be completed within 30min at the temperature of 30-42 ℃, and the kit can be used for rapid diagnosis of HP infection;
(2) by combining RMA and LFD technologies, the isothermal in-vitro rapid amplification of HP nucleic acid can be realized, the visualization of a detection result can be realized, and the rapid detection of HP can be realized without special instruments and equipment;
(3) the detection sample can be saliva or feces, the sample collection is non-invasive and painless, and invasive sampling methods such as gastroscope are avoided, so that the sampling difficulty and the sampling pain can be reduced, and the detection time and the detection cost can be saved;
(4) and the closed tube detection avoids false positive and environmental pollution caused by cross contamination among samples.
Drawings
In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present application, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without creative efforts.
FIG. 1 sensitivity assay for detection of HP by LFD-RMA;
FIG. 2 LFD-RMA assay for HP detection specificity.
Number in the figure, 1: 2X 104copies/μL；2：2×103copies/μL；3：2×102copies/μL；4：2×101copies/μL；5：2copies/μL
Detailed Description
In order to make the objects, technical solutions and advantages of the present application more clear, embodiments of the present application will be described in further detail below.
Example 1
1. Preparation of Positive Standard plasmid
Extracting nucleic acid of HP as a template, carrying out PCR amplification on specific genes of the HP, carrying out 1% agarose gel electrophoresis on PCR amplification products, tapping and recovering, cloning and connecting to a pMD18-T vector, transforming to escherichia coli competent cells, screening with blue and white spots, selecting white colonies, and carrying out colony PCR verification. And (3) sending the positive recombinant bacteria to a company for sequencing, culturing the recombinant bacteria with correct sequencing overnight, and extracting plasmid DNA to obtain positive plasmids.
2. RMA primer and Probe design
Specific RMA primers and probes were designed based on the 16s rRNA gene of HP, as shown in Table 1:
TABLE 1 primer and Probe sequences
3. Establishment of RMA reaction System
Adding 42.5. mu.L of buffer solution and 5. mu.L of extracted nucleic acid of the sample to be detected into a detection tube containing the amplification reaction reagent, and uniformly mixing. Finally, 2.5. mu.L of 280mM magnesium acetate solution was added to the tube and mixed well. Placing the reaction tube in a constant-temperature water bath kettle for RMA reaction, wherein the reaction conditions are as follows: water bath at 40 deg.C for 5min, mixing, and water bath at 40 deg.C for 15 min; in each reaction, standard positive plasmids are used as positive control, and sterile double distilled water is used as negative control.
The amplification reaction reagent is packaged in a single tube and is in a dry powder form, and comprises RMA primer pairs and detection probe sets with final concentration of 10 mu M, 100 ng/mu L of escherichia coli RecA protein, 40 ng/mu L of UvsY protein, 800 ng/mu L of single-stranded binding protein GP32, 60 ng/mu L of Bst polymerase and 80 ng/mu L of endonuclease IV.
The final concentration of the magnesium acetate is 100 mM.
The buffer comprises the following components: 50mM Tris, 10% w/v polyethylene oxide, 2mM trehalose, 2.5mM mannitol, 10mM ATP, 2mM dNTPs, 1000ng/mL creatine kinase and 25mM phosphocreatine.
The standard positive plasmid is a recombinant plasmid containing an HP gene fragment and is used as a positive control for HP nucleic acid detection.
The sterile double distilled water is used as negative control, and the sterile double distilled water and standard positive plasmids are used together to test whether the corresponding reaction system and reaction conditions can normally react.
The sample which can be detected by the kit is saliva, dental plaque, gastric mucosal tissue, gastric juice, intestinal juice and excrement.
4. Operation and result interpretation of lateral flow chromatography test strip detection method
After the RMA amplification is finished, the reaction tube is placed in a disposable nucleic acid detection device containing a lateral flow chromatography test strip, and after 5min, the reaction tube is judged through the color development of the test strip. If the quality control line (C) and the detection line (T) are colored, judging that the reading result is positive; if only the quality control line develops color, the color is negative; if the quality control line does not develop color, the test strip is invalid.
5. Sensitivity analysis for detecting HP by LFD-RMA method
Standard positive plasmids were serially diluted 10-fold in PBS (including 2X 10)4、2×103、2×102、2×1012 copies/. mu.L) and LFD-RMA reaction was performed under the above reaction system conditions with sterile double distilled water as a negative control, and 3 times of experiments were repeated for each concentration. As can be seen from FIG. 1, the lowest detection limit of the LFD-RMA detection method is 2X 101copies/. mu.L. Namely, the sensitivity of the LFD-RMA method detection kit reaches 2 multiplied by 101copies/μL。
6. Specificity analysis for detecting HP by LFD-RMA method
In order to test the specificity of the LFD-RMA detection method, pathogen nucleic acid samples such as helicobacter pylori HP, escherichia coli, shigella, salmonella, vibrio cholerae and the like are selected, the LFD-RMA method is used for detection, sterile double distilled water is used as a negative control, and each test is repeated for 3 times. As can be seen from FIG. 2, only the HP positive template presents two lines of the quality control line (C) and the detection line (T), the detection result is positive, and the other viruses only have one line of the quality control line (C), and the detection result is negative. The result shows that the established LFD-RMA detection method has good specificity.
The above description is only exemplary of the present application and should not be taken as limiting the present application, as any modification, equivalent replacement, or improvement made within the spirit and principle of the present application should be included in the protection scope of the present application.
Sequence listing
<110> Ji nan Guo Yi Biotechnology Co., Ltd
<120> a primer probe group for detecting helicobacter pylori based on LFD-RMA method
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 33
<212> DNA
<213> Helicobacter pylori (Helicobacter pylori)
<400> 1
ggcgtgccta atacatgcaa gtcgaacgat gaa 33
<210> 2
<211> 33
<212> DNA
<213> Helicobacter pylori (Helicobacter pylori)
<400> 2
attgagcaat attccctact gctgcctccc gta 33
<210> 3
<211> 47
<212> DNA
<213> Helicobacter pylori (Helicobacter pylori)
<400> 3
aggctatgac gggtatccgg cctgagaggg tgaacggaca cactgga 47
Claims (6)
1. A primer probe group for detecting helicobacter pylori based on an LFD-RMA method is characterized by comprising a primer pair for detecting the helicobacter pylori and a corresponding probe, wherein the sequences of the primer and the probe are as follows:
HP-F：
5’-GGCGTGCCTAATACATGCAAGTCGAACGATGAA-3’；
HP-R：
5’-[Biotin]ATTGAGCAATATTCCCTACTGCTGCCTCCCGTA-3’；
HP-P：
5’-[FAM]AGGCTATGACGGGTATCCGGCCTGAGAGGG[dSpacer]GAACGGACACACTGGA[C3-spacer]-3’。
2. the primer probe set for detecting helicobacter pylori based on the LFD-RMA method as claimed in claim 1, wherein the 5' end of the downstream primer is labeled with Biotin; the 5 'end of the probe is marked by FAM, the 31 st base T is replaced by THF (dSpacer), and the 3' end is modified by a blocking group C3-spacer; the amplification product size does not exceed 500 bp.
3. The kit for detecting helicobacter pylori by LFD-RMA method according to claim 1, wherein the kit comprises a detection tube containing amplification reaction reagents, a buffer solution, magnesium acetate, standard positive plasmids, sterile double distilled water and a lateral flow chromatography detection test strip.
4. The kit for detecting helicobacter pylori based on LFD-RMA method according to claim 3, wherein the amplification reaction reagents are packaged in a single tube and are in a dry powder form, and the kit comprises RMA primer pairs and detection probe sets with final concentration of 10 μ M, 100ng/μ L of Escherichia coli RecA protein, 40ng/μ L of UvsY protein, 800ng/μ L of single-stranded binding protein GP32, 60ng/μ L of Bst polymerase and 80ng/μ L of endonuclease IV.
5. The kit for detecting helicobacter pylori according to the LFD-RMA method, according to claim 4, wherein said buffer comprises the following components: 50mM Tris, 10% w/v polyethylene oxide, 2mM trehalose, 2.5mM mannitol, 10mM ATP, 2mM dNTPs, 1000ng/mL creatine kinase and 25mM phosphocreatine.
6. The kit for detecting helicobacter pylori according to the LFD-RMA method, according to claim 5, wherein the sample that can be detected by the kit is saliva, dental plaque, gastric mucosal tissue, gastric juice, intestinal juice, feces, etc.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110452393.XA CN113046455A (en) | 2021-04-26 | 2021-04-26 | Primer probe group for detecting helicobacter pylori based on LFD-RMA method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110452393.XA CN113046455A (en) | 2021-04-26 | 2021-04-26 | Primer probe group for detecting helicobacter pylori based on LFD-RMA method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113046455A true CN113046455A (en) | 2021-06-29 |
Family
ID=76520557
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110452393.XA Pending CN113046455A (en) | 2021-04-26 | 2021-04-26 | Primer probe group for detecting helicobacter pylori based on LFD-RMA method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113046455A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113943822A (en) * | 2021-09-27 | 2022-01-18 | 山东第一医科大学(山东省医学科学院) | LAMP-LFD-based helicobacter pylori POCT detection kit and method |
| CN117625818A (en) * | 2023-11-30 | 2024-03-01 | 南京市第一医院 | Primer and probe combination for detecting helicobacter pylori infection based on RAA-LFD method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063191A (en) * | 2015-07-31 | 2015-11-18 | 苏州百源基因技术有限公司 | Specific primer and probe for real-time fluorescent quantitative PCR (polymerase chain reaction) detection on helicobacter pylori in mouth |
| CN112195220A (en) * | 2020-10-13 | 2021-01-08 | 济南国益生物科技有限公司 | Lateral flow chromatography-recombinase constant-temperature amplification method for rapid detection of nucleic acid |
-
2021
- 2021-04-26 CN CN202110452393.XA patent/CN113046455A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063191A (en) * | 2015-07-31 | 2015-11-18 | 苏州百源基因技术有限公司 | Specific primer and probe for real-time fluorescent quantitative PCR (polymerase chain reaction) detection on helicobacter pylori in mouth |
| CN112195220A (en) * | 2020-10-13 | 2021-01-08 | 济南国益生物科技有限公司 | Lateral flow chromatography-recombinase constant-temperature amplification method for rapid detection of nucleic acid |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113943822A (en) * | 2021-09-27 | 2022-01-18 | 山东第一医科大学(山东省医学科学院) | LAMP-LFD-based helicobacter pylori POCT detection kit and method |
| CN113943822B (en) * | 2021-09-27 | 2024-03-12 | 山东第一医科大学(山东省医学科学院) | LAMP-LFD-based helicobacter pylori POCT detection kit and method |
| CN117625818A (en) * | 2023-11-30 | 2024-03-01 | 南京市第一医院 | Primer and probe combination for detecting helicobacter pylori infection based on RAA-LFD method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Direct DNA amplification and restriction pattern analysis of Helicobacter pylori in patients with duodenal ulcer and their families | |
| CN113046455A (en) | Primer probe group for detecting helicobacter pylori based on LFD-RMA method | |
| CN107245531B (en) | Diarrhea pathogen multiple gene detection system and kit and application thereof | |
| Dolan et al. | The use of stool specimens reveals Helicobacter pylori strain diversity in a cohort of adolescents and their family members in a developed country | |
| CN107083446B (en) | Diarrhea pathogenic bacteria multiple gene detection system and kit and application thereof | |
| CN113249499A (en) | Salmonella typhi detection kit, and preparation method and application thereof | |
| US20060194206A1 (en) | Diagnostics of diarrheagenic escherichia coli (dec) and shigella spp | |
| US20110165576A1 (en) | molecular diagnostic kit for the detection of virulent strains of helicobacter pylori | |
| CN106987657B (en) | Primer combination for identifying bovine virus diarrhea virus and bovine rotavirus and application thereof | |
| CN111172301A (en) | PCR fluorescence detection kit for clostridium difficile toxin B and application thereof | |
| CN111518932A (en) | Diagnostic method and kit for detecting and judging drug resistance of helicobacter pylori by taking feces as sample | |
| EP0739987A2 (en) | Oligonucleotides for detecting Salmonella species and detection process using the same | |
| CN112760395A (en) | Primer probe set, kit and detection method for multiple detection of intestinal pathogenic bacteria based on fluorescence RMA method | |
| CN114574603A (en) | RPA-LFS detection primer probe combination of hemophilus capsulatus and hemophilus non-capsulatus and application thereof | |
| CN113755618A (en) | Method for detecting brucellosis of animals with high sensitivity | |
| CN112522446A (en) | Detection primer pair and kit for wild strain of porcine pseudorabies virus | |
| KR101437389B1 (en) | Primer set for Brucella canis strain-specific identification and method for detecting Brucella canis strain using the same | |
| WO2008140832A2 (en) | Method for rapid detection of clostridium botulinum | |
| CN114836581B (en) | Primer combination for detecting pathogens of digestive tract infectious diseases | |
| CN114480680B (en) | Primer group for detecting salmonella serotype antigen genotyping and application thereof | |
| CN113943822B (en) | LAMP-LFD-based helicobacter pylori POCT detection kit and method | |
| CN113186344A (en) | Primer probe set for detecting African swine fever virus ASFV based on LFD-RMA method | |
| CN107164562B (en) | Diarrhea-associated virus multiple gene detection system and kit and application thereof | |
| CN111996268A (en) | Vibrio alginolyticus double TaqMan probe real-time fluorescent quantitative PCR (polymerase chain reaction) detection kit and preparation method thereof | |
| CN118064614A (en) | Primer probe group for helicobacter pylori ERA detection and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210629 |
|
| RJ01 | Rejection of invention patent application after publication |