CN114574603A - RPA-LFS detection primer probe combination of hemophilus capsulatus and hemophilus non-capsulatus and application thereof - Google Patents

Abstract

The invention discloses an RPA-LFS detection primer probe combination of capsular type and non-capsular type haemophilus influenzae and application thereof; the primer probe combination has good specificity, has no cross amplification to other strains, can detect the haemophilus influenzae with the concentration of 1CFU/ul, and has detection sensitivity which is not interfered by other pathogenic bacteria. The results of the study and the double PCR detection are consistent, and 203 parts of Haemophilus influenzae and 63 parts of Haemophilus influenzae capsular type are detected from 209 parts of samples respectively, and the detection rates are 97.1% and 63.2% respectively. RPA-LFS has the same practical applicability as duplex PCR. The research successfully establishes an RPA-LFS detection method for detecting the capsular type and non-capsular type haemophilus influenzae based on Omp6 and BexA genes, provides a scheme for the subsequent rapid detection of haemophilus influenzae, and ensures the timely diagnosis and antibiotic treatment of patients.

Description

RPA-LFS detection primer probe combination of hemophilus influenzae with capsular type and non-capsular type and application thereof

Technical Field

The invention relates to an RPA-LFS detection primer probe combination of capsular type and non-capsular type haemophilus influenzae and application thereof.

Background

Haemophilus influenzae (Haemophilus influenzae, h. influenzae) is a group of gram-negative bacteria. Haemophilus influenzae can be classified into capsular type and non-capsular type, and capsular type Haemophilus influenzae can be classified into 6 types according to serological experimental results, namely a type, b type, c type, d type, e type and f type. Researches show that the serotype distribution in different regions is very different, wherein the most pathogenic Haemophilus influenzae type b can cause serious meningitis, sepsis and the like. In some developed countries, conventional immunization with h.influenzae type b conjugate vaccines has been used and significantly reduces the incidence of diseases associated with h.influenzae type b, but the incidence in most countries is still high. At present, the traditional bacteria culture method is a gold standard for detecting haemophilus influenzae, but haemophilus influenzae is fastidious bacteria, the requirement on culture sample nutrition is high, special growth factors are needed besides an anaerobic environment, the culture time is long, and the operation procedures are complicated, so the separation rate of the haemophilus influenzae culture is always low. This undoubtedly delays the diagnosis and treatment time of the patient and accelerates the deterioration of the disease, and a method of rapidly and accurately detecting Haemophilus influenzae and enabling the identification of the type of Haemophilus influenzae is imminent.

With the rapid development of molecular diagnostic techniques, PCR technology has been widely applied to the detection of various microorganisms. The TIAN Guo Zhong establishes a PCR method for detecting haemophilus influenzae based on 16S RNA gene. The method detected Haemophilus influenzae sensitivity of 97.53%, but the method failed to identify Haemophilus influenzae of both capsular and non-capsular types. J. VAN KETEL and the like establish a PCR detection method for detecting capsular type and non-capsular type haemophilus influenzae based on Omp6 and bexA genes, and the PCR method capable of distinguishing different types of haemophilus influenzae is successfully established according to the fact that the bexA gene of capsular related protein exists only in capsular type haemophilus influenzae and the Omp6 gene exists in all haemophilus influenzae. But this method relies on expensive instrumentation and specialized operating technicians. Qilong Cao et al established the MCDA-LFB (the multiple cross displacement amplification and nanoparticle-based latex flow biosensor) method for detecting Haemophilus influenzae based on Omp6 gene, the method can react for 1h at 58-65 ℃, and the method combines the colloidal gold test strip to quickly detect Haemophilus influenzae. Although this method does not depend on expensive equipment, it involves the risks of complicated primer design, long reaction time, and false positives.

Recombinase Polymerase Amplification (RPA) technology is a recently emerging isothermal amplification technology that has better specificity, sensitivity, and operational portability than other technologies. RPA opens double chains by recombinase and combines the primer with the target segment, and the polymerase Bsu with strand displacement activity recognizes the 3' end of the primer for stable amplification, and a large amount of amplification products can be obtained only by reacting for 20min at 30-45 ℃. Thus, the technique is not dependent on sophisticated instrumentation and specialized operators. The RPA amplification product can be detected by gel electrophoresis, fluorescence detection, and colloidal gold test strip. Different from gel electrophoresis, fluorescence detection methods and the like, the colloidal gold test strip realizes detection of an amplification product by utilizing an antigen-antibody combination principle. An amplification product with labels at both ends is obtained by adding a probe with FITC labeled at the 5 'end into an RPA reaction system and labeling Biotin at the 5' end of a reverse primer. And detecting the amplification product by using a test strip of a specific marker, and realizing the purpose of detecting the amplification product according to whether the detection line is developed. The combination of the RPA technology and the colloidal gold test strip further increases the site-specific detection characteristics of the technology. Currently, RPA-LFS has been used in the detection of various pathogens, such as: staphylococcus aureus, bacillus cereus, listeria monocytogenes, and the like.

Disclosure of Invention

The invention establishes a method for rapidly identifying pod type and non-pod type haemophilus influenzae based on Omp6 gene and bexA gene by utilizing RPA-LFS technology, and the method meets the requirements of rapid, sensitive and portable fixed-point detection.

In order to distinguish between haemophilus influenzae capsular and non-capsular types, two pairs of primers (table 1) were designed in the conserved regions of Omp6 gene and bexA gene, respectively, each pair being used to detect non-enveloped haemophilus influenzae and haemophilus capsulatus. The amplification efficiency of the amplification strips of omp6-F1/R1 and bexA-F2/R2 is higher. Subsequent experiments were then performed on omp6-F1/R1 and bexA-F2/R2.

Table 1: primer design sheet

In order to improve the specificity and the sensitivity, corresponding probes are designed at the target regions of the primer pairs omp6-F1/R1 and bexA-F2/R2. Although the introduction of the probe can reduce the generation of primer dimer, false positive signals are still unavoidable. False positive signals are mainly due to the formation of dimers between the probe and the reverse primer that have stable amplification ability. We analyzed the dimers formed between the designed probes and the reverse primers using Primer Premier 5 software, each probe and the corresponding reverse Primer having a certain complementary segment, either covering the THF site or exposing the 3' -OH end of the reverse Primer. These dimers can be stably amplified by polymerase Bsu, and thus, false positive signals are continuously amplified. Research has shown that RPA can tolerate some base mismatches without affecting amplification efficiency, and many studies have successfully applied this theory to the establishment of the RPA-LFS method. Therefore, to avoid false positives, we introduced mismatched bases on the probe and the forward and reverse primers to reduce the generation of dimers between the probe and the reverse primer. The principle of introducing mismatched bases is: 1. the probe and the reverse primer have no more than 3 continuous complementary bases; 2. the complementary regions of the probe and primer do not cover the THF site; 3. the 3' end of the reverse primer is complementary to the probe for no more than 3 bases, 4. interchange of A-G and T-C is preferably used. By introducing mismatches, we successfully screened for appropriate probes and reverse primers.

To verify that bexA-F3/R1B/P can only amplify haemophilus influenzae capsulatus, while omp6-F3/R1B/P can amplify all non-haemophilus influenzae. The collected 10 noncapsule haemophilus influenzae strains and 10 capsular haemophilus influenzae strains were amplified by two primers corresponding to the two genes, respectively (both verified by conventional culture methods). As shown in FIGS. 2A and B, omp6-F3/R1B/P can detect all non-enveloped Haemophilus influenzae, while bexA-F3/R1B/P can detect only enveloped Haemophilus influenzae, demonstrating that bexA-F3/R1B/P and omp6-F3/R1B/P primers can correctly identify enveloped and non-enveloped Haemophilus influenzae. And the omp6-F3/R1B/P can only amplify the non-specificity of the haemophilus influenzae to other pathogens, and 23 pathogens are selected for interspecies specificity verification. The results showed that only haemophilus influenzae showed red bands on both the detection and control lines, while the other 23 pathogens showed red bands only on the control line.

The invention has the following beneficial effects:

the method of the invention has higher sensitivity and specificity, and the primer design is simple, and does not depend on expensive instruments and equipment. The research solves the problem of false positive caused by primer dimer by introducing mismatch on the probe and the primer on the premise of not influencing the amplification efficiency of the primer. In order to accurately judge the typing of the haemophilus influenzae, which is easy for subsequent antibiotic treatment, specific forward and reverse primers and probes are respectively designed on Omp6 and BexA genes, so that the haemophilus influenzae with a capsular type and a non-capsular type can be respectively screened out. Meanwhile, the specificity of the primer on the Omp6 gene is verified, and the result shows that the primer has good specificity and has no cross amplification to other strains. In order to verify the sensitivity of the two pairs of primers, standard capsular type and non-capsular type haemophilus influenzae are detected respectively, and 10 equal parts of the haemophilus influenzae inactivated bacterial liquid with different concentrations are added⁵CFU of streptococcus pneumoniae, and the result shows that the method can detect 1CFU/ul of haemophilus influenzae, and the detection sensitivity is not interfered by other pathogenic bacteria. The detection results of clinical samples show that the research is consistent with the results of double PCR detection, 203 parts of haemophilus influenzae and 63 parts of haemophilus capsulatus are detected from 209 parts of samples respectively, and the detection rates are 97.1% and 63.2% respectively. RPA-LFS and double PCRHas the same practical applicability. The research successfully establishes an RPA-LFS detection method for detecting the capsular type and non-capsular type haemophilus influenzae based on Omp6 and BexA genes, provides a scheme for the subsequent rapid detection of haemophilus influenzae, and ensures the timely diagnosis and antibiotic treatment of patients.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the principles of the invention and not to limit the invention. In the drawings:

FIG. 1 shows the screening of primers and probes;

FIG. 2 shows the authentication of omp6-F3/R1B/P and bexA-F3/R1B/P for both capsular and non-capsular influenza viruses;

FIG. 3 shows specific detection of OMP6-F3/R1B/P using RPA-LFS;

fig. 4 shows the detection limit of the RPA-LFS system.

Detailed Description

The preferred embodiments of the present invention will be described in conjunction with the accompanying drawings, and it should be understood that they are presented herein only to illustrate and explain the present invention and not to limit the present invention.

Examples

Bacterial strains and genomic template preparation

Non-capsular Haemophilus influenzae (ATCC No.49247) and capsular Haemophilus influenzae (ATCC 9334) were purchased from Korea Hakko technologies, Inc., Shanghai. 10 strains of Haemophilus influenzae (Non-Podoconisis) and 10 strains of Haemophilus influenzae (Podoconiosis) were isolated from the sputum. Other 23 common pathogens were provided by the laboratory to verify the specificity of the Omp6 gene-based RPA-LFS method, including Acinetobacter calcoaceticus, Acinetobacter rockii, Acinetobacter hemolyticus, Acinetobacter cinnabarinus, Acinetobacter johnsonii, Candida albicans, Enterobacter cloacae, enterococcus faecalis, Escherichia coli O157, Mycobacterium tuberculosis H37Ra strain, Pseudomonas aeruginosa, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus hemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Staphylococcus wowenus, stenotrophin, Microphagus pulmonalis, Staphylococcus pneumoniaeStreptococcus pneumoniae, viridans streptococcus, klebsiella pneumoniae, acinetobacter baumannii. 209 sputum samples of suspected haemophilus influenzae infected patients were collected from each hospital in cloudband city and peripheral hospitals, such as the first-person hospital in cloudband city, the second-person hospital in cloudband city, the third-person hospital in cloudband city, the first-person hospital in Huaian city, and the resident hospital. All bacterial strains or samples were incubated at 100 ℃ for 10 minutes before being used as templates. If not specified, then 10⁵CFU/mL of 1. mu.L of heat-treated culture served as template.

RPA primer

Two pairs of RPA primers based on the conserved sequences of Omp6 and BexA genes, respectively, were designed using Primer Premier 5.0 software (Premier Biosoft International, Calif., USA). For the primers, after entering the sequence of the specific targeting region, the parameters are set as follows: the size of the product is set to 100bp-300 bp. The size of the primer is set to be 30bp-35 bp. The obtained primer pair will be discarded if there is complementary pairing of more than three consecutive bases at the 3' end. The species specificity of the sequences of primers and probes was then confirmed using Primer-BLAST on the NCBI website (https:// www.ncbi.nlm.nih.gov/tools/Primer-BLAST).

RPA reaction

According to manufacturer's instructions, use

The Liquid DNA Amplification Kit (twist Dx Inc., Maidenhead, UK) was subjected to the RPA reaction. A50. mu.L reaction system contained 25. mu.L of 2 × reaction buffer, 5. mu.L of 10 × Basic e-mix, 2.5. mu.L of 20 × core mix, 2.4. mu.L of 10. mu.M forward primer, 2.4. mu.L of 10. mu.M reverse primer, and 9.2. mu.L distilled water. 2.5. mu.L of 280mM magnesium acetate and 1. mu.L of template were added to the lid of the reaction tube. After brief centrifugation, the reaction mixture was incubated at 37 ℃ for 30 minutes. The RPA amplification product was purified using a PCR clean kit (shanghaiming biotechnology limited, shanghai, china) and subjected to electrophoresis on a 2% agarose gel.

RPA-LFS probe design

Using Primer Premier 5 software to design specific probes between the forward and reverse Primer targeting sequences of Omp6 and bexA genes, respectively, formation of dimers, hairpin structures, etc. between the probes and the reverse Primer is theoretically avoided as much as possible. The design principle is as follows: (1) the size of the probe is 46-51bp, the GC content is 20-80%, and the Tm is 57-80 ℃; (2) the maximum hairpin score was 9 and the maximum primer-dimer score was set to 9. The maximum poly-X is set to 5 and the other parameters are set to default values; (3) the 5 'end of the probe is marked by FITC, the 3' end is blocked by SpC3, the base in the middle of the probe is changed into Tetrahydrofuran (THF), and at least 30bp base is arranged in front of the THF site, and at least 15bp base is arranged behind the THF site; (4) the 5' end of the reverse primer was labeled with biotin.

RPA-LFS reaction

Use of

The DNA Amplification nfo Kit (twist Dx) established the RPA-LFS reaction. The reaction mixture consisted of 29.5. mu.L of rehydration buffer, 2.1. mu.L of 10. mu.M forward primer, 2.1. mu.L of 10. mu.M reverse primer, 0.6. mu.L of 10. mu.M probe, and 12.2. mu.L of distilled water. To start the reaction, 1 μ L of template and 2.5 μ L of 280mM magnesium acetate were added to the mixture. After brief centrifugation, the reaction mixture was incubated at 30-45 ℃ for 30 minutes.

Because the sensitivity of the colloidal gold test paper is very high, only a small amount of amplification products are needed, and if the product concentration is too high, the colloidal gold test paper needs to be diluted properly. A total of 2. mu.L of amplification product was used for LFS detection (Ustar Biotechnologies Ltd., Hangzhou, China). The amplification product was added to the sample pad of LFS, the rod of LFS was inserted into 100 μ L of sample buffer (Ustar Biotech) for 2 minutes, and the results were then visually detected.

Detection limits for RPA-LFS technology

Will ddH₂O continuous 10-fold gradient dilution inactivation of standard Haemophilus influenzae capsular type ATCC9334 (type b) and non-capsular type Haemophilus influenzae (10)⁶～10⁰CFU) and used as a template for RPA-LFS detection. To determine whether contamination by other strains would interfere with detection sensitivity, 10⁵CFU/. mu.L of heat-inactivated Streptococcus pneumoniae culture to inactivated Haemophilus influenzae capsular ATCC9334 (type b) and non-capsular Haemophilus influenzae culture ladderIn dilution (10)⁶–10⁰CFU/. mu.L) and sensitivity detection of RPA-LFS was performed, respectively.

Duplex PCR

In this experiment, a double PCR method based on Omp6 gene and bexA gene, which was established by Zhaying et al, was used as a control, and the primers are shown in Table 1. The PCR reaction was carried out in a total volume of 50. mu.l, containing 2.5mol/L dNTP, 250nmol/L each of the upstream and downstream primers for omp6 gene and bexA gene, 2.5U of Ex-Taq DNA polymerase (TaKaRa), 2. mu.l of template, and 1 XPCR buffer (pH 8.3). PCR parameters: 4min at 94 ℃; 35 cycles of 94 ℃ for 30 seconds, 54 ℃ for 30 seconds, 72 ℃ for 45 seconds and 72 ℃ for 5 minutes. The amplification products were detected by electrophoresis on a 2% agarose gel pre-stained with 1. mu.g/ml ethidium bromide.

The application of the RPA-LFS technology in clinical specimen examination is evaluated.

To verify the practical application ability of the RPA-LFS, the practical application effect of the RPA-LFS was compared with the double PCR method established by Nengo, et al. 209 clinical specimens were tested using RPA-LFS and duplex PCR, respectively, and compared to the results of the traditional culture method.

Design and screening of haemophilus influenzae detection primers

In order to distinguish between haemophilus influenzae capsular and non-capsular types, two pairs of primers (table 1) were designed in the conserved regions of Omp6 gene and bexA gene, respectively, each pair being used to detect non-enveloped haemophilus influenzae and haemophilus capsulatus. The detection result is shown as A in FIG. 1, and each pair of primers can amplify the corresponding target strain. From the gel image results, there were no nonspecific bands and primer dimers except for the target band. However, from the results of the gel plot, the amplification bands of omp6-F1/R1 and BexA-F2/R2 were brighter than the other, indicating that they were more efficient in amplification. Subsequent experiments were then performed on omp6-F1/R1 and BexA-F2/R2.

TABLE 1 Primers and probes

F:forward primer；R:reverse primer；P:probe

A large number of research results show that the introduction of the probe into the RPA system not only can improve the specificity and sensitivity of the reaction, but also can reduce the generation of primer dimer. In order to improve the specificity and the sensitivity, corresponding probes are designed at the target regions of the primer pairs omp6-F1/R1 and bexA-F2/R2. Although the introduction of the probe can reduce the generation of primer dimer, false positive signals are still unavoidable. False positive signals are mainly due to the formation of dimers between the probe and the reverse primer that have stable amplification ability. We analyzed the dimer formed between the designed probe and the reverse Primer using the Primer Premier 5 software, and the results are shown in FIG. 1B. Each probe and corresponding reverse primer has a certain complementary segment, either covering the THF site or exposing the 3' -OH end of the reverse primer. These dimers can be stably amplified by polymerase Bsu, and thus, false positive signals are continuously amplified. Research has shown that RPA can tolerate some base mismatches without affecting amplification efficiency, and many studies have successfully applied this theory to the establishment of the RPA-LFS method. Therefore, to avoid false positives, we introduced mismatched bases on the probe and the forward and reverse primers to reduce the generation of dimers between the probe and the reverse primer. The principle of introducing mismatched bases is: 1. the continuous complementary bases of the probe and the reverse primer are not more than 3; 2. the complementary regions of the probe and primer do not cover the THF site; 3. the 3' end of the reverse primer is complementary to the probe for no more than 3 bases, 4. interchange of A-G and T-C is preferably used. By introducing mismatches, we successfully screened suitable probes and reverse primers (table 1). The experimental results show that (at C in fig. 1), the test line of the experimental group has an obvious red band, and the test line of the NTC group does not have a false positive signal.

FIG. 1 shows the screening of primers and probes. In FIG. 1, the primer is screened by the RPA reaction. Agarose gel images show the amplification results of primer pairs against two virulence genes Omp6 and bexA. The name of the primer pair is shown at the top of each lane. NTC lanes are no template controls for the respective RPA reactions in the lane immediately to the left. The size of the DNA ladder band is shown on the right. These pictures represent the results of three independent experiments. Probe designed based on Omp6 gene at BDimers formed between the needle-reverse primers and the probe-probes. At C is a dimer formed between the probe-reverse primer and the probe designed based on the bexA gene. At D is the modified primer-probe set tested on RPA-LFS. Panels show LFS results of RPA amplification. The name of each primer-probe set is indicated above the corresponding band. At 10⁶CFU/mL of boiled non-capsular and capsular cultures of influenza A. sup.1. mu.L total served as template. NTC bars are no template controls for the respective RPA reactions on the immediately left bar. The positions of the test and control lines are indicated on the right side of the bar graph. The reaction was carried out at 37 ℃ for 30 minutes. The image represents the results of three independent experiments.

Specificity verification of RPA-LFS

To verify that bexA-F3/R1B/P can only amplify haemophilus influenzae capsulatus, while omp6-F3/R1B/P can amplify all non-haemophilus influenzae. The collected 10 noncapsule haemophilus influenzae strains and 10 capsular haemophilus influenzae strains were amplified by two primers corresponding to the two genes, respectively (both verified by conventional culture methods). As shown in FIG. 2 at A and B, omp6-F3/R1B/P could detect all non-enveloped Haemophilus influenzae, whereas bexA-F3/R1B/P could detect only enveloped Haemophilus influenzae, demonstrating that omp6-F3/R1B/P and omp6-F3/R1B/P primers could correctly distinguish between enveloped and non-enveloped Haemophilus influenzae. Furthermore, to demonstrate that omp6-F3/R1B/P only amplifies H.influenzae without specificity for other pathogens, we selected 23 pathogens for interspecies specificity validation (Table 2). The results showed that only haemophilus influenzae showed red bands on both the detection line and the control line, while the other 23 pathogens showed red bands only on the control line, as shown in figure 3.

TABLE 2 Bacterial strains used in the study

FIG. 2 shows the identification of omp6-F3/R1B/P and bexA-F3/R1B/P for both capsular and non-capsular influenza viruses. -1 refers to the test results of Omp6-F1/R1, -2 refers to the test results of bexA-F2/R2. In FIG. 2, the numbers #1- #10 at A refer to 10 non-capsular influenza viruses isolated from sputum. In FIG. 2, the numbers #1- #10 at B refer to 10 capsules of influenza virus isolated from sputum. NTC strips were used as control reactions without template. The positions of the test and control lines are marked on the right side of the strip image.

FIG. 3 shows specific detection of OMP6-F3/R1B/P using RPA-LFS. A total of 1 microliter of 106CFU/mL of boiled bacterial culture was used as template. Other pathogens were tested. Reference strain h.infiluenzae ATCC 49247 was used as a positive control. The bacterial species name is indicated at the top of each band. NTC strips are no template controls. The positions of the test and control lines are indicated on the right side of the bar graph. The reaction was carried out at 37 ℃ for 30 minutes. The pictures represent the results of three independent experiments.

Verifying detection limits of RPA-LFS

To verify the detection limit of RPA-LFS, inactivated cultures of capsular and non-capsular Haemophilus influenzae were each diluted 10-fold in a gradient ranging from 10⁶To 10⁰CFU/uL (50 mL/reaction volume, 1uL of diluted culture was added to each reaction).

FIG. 4 shows the detection limits of the RPA-LFS system. Positions a and B are LFS results of RPA amplification with different numbers of non-capsular influenza virus cultures. The amount added to the RPA reaction (in CFU) is indicated at the top of each bar graph. In addition to the non-capsular influenza virus culture, 10 was added to the reaction at B⁵CFU/. mu.L of Streptococcus pneumoniae cultures. C and D are LFS results of RPA amplification using different numbers of cultures of capsular influenza virus. The number of RPA addition reactions is indicated at the top of each band. In addition to the encapsulated influenza virus culture, 10 was added to the reaction in position D⁵CFU/. mu.L of Streptococcus pneumoniae cultures. NTC, no template control. The reaction was carried out at 37 ℃ for 30 minutes. The right side of the picture is marked with control lines and testsThe position of the line.

As shown at a and C in fig. 4. The lowest line of omp6-F3/R1B/P and bexA-F3/R1B/P is 10⁰CFU/reaction. The results show that our RPA-LFS reaction system has the same sensitivity as PCR. By adding streptococcus pneumoniae into haemophilus influenzae with different concentrations, the sensitivity of detecting haemophilus influenzae by RPA-LFS is not influenced by other pathogens, and the lowest detection line is still 10⁰CFU/reaction (shown at B and D in fig. 4).

Application evaluation of RPA-LFS technology in clinical specimen examination

To verify the efficacy of the practical application of RPA-LFS, 209 clinical samples were collected for testing. As a result, as shown in Table 3, 203 samples were derived from Haemophilus influenzae, and the detection rate was 97.1%. The detection result is consistent with that of the double PCR and the traditional culture method. To screen for Haemophilus influenzae capsulatus from the detected Haemophilus influenzae, all of the Haemophilus influenzae were RPA-LFS using primers bexA-F3/R1B/P, and simultaneously compared to the results of the established double-stranded PCR assay. The results showed that 128 Haemophilus influenzae capsulatus strains were detected by both RPA-LFS and Dual-PCR, with a detection rate of 63.2%. Experimental results show that RPA-LFS has the same accuracy as double PCR, and the results are consistent with the results of the traditional culture method.

Table 3209 strains using RPA-LFS and dual PCR

N:number。

Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that changes may be made in the embodiments and/or equivalents thereof without departing from the spirit and scope of the invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> second people's Hospital (clinical tumor institute of Nendong Hongkong)

<120> RPA-LFS detection primer probe combination of hemophilus influenzae of capsule type and non-capsule type and application thereof

<141> 2022-03-28

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

acactgatga acgtggtaca ccagaataca a 31

<210> 2

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

accagctaaa taacctttaa ctgcatctgc a 31

<210> 3

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

caaacttttg gcggttactc tgttgctgat c 31

<210> 4

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgcgtctaag atttgaacgt attcaccagt a 31

<210> 5

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cggttgagtt tgattgttat ttaattgatg ag 32

<210> 6

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tgtgaaacta aaatgataga acggtctttg c 31

<210> 7

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tctatcattt tagtttcaca tagcccgagt g 31

<210> 8

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tgtagtattg atacgctttg tccatgtctt c 31

<210> 9

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

acactgatga acgtgataca ccataataca aatcgtatta ggccaa 46

<210> 10

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

accagctgag taacctttaa ctagatctgc a 31

<210> 11

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

caggaaatgg tgctgctcaa acttttggcg gttac 35

<210> 12

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cggttgagta tgattgttat gtaattgatg agtgattgta gtaggg 46

<210> 13

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tgtgaaacga aaatgataga acggtctttg c 31

<210> 14

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

caggaaatgg tgctgctcaa acttttggcg gttac 35

<210> 15

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

atgaacaaat ttgttaaatc a 21

<210> 16

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tgcgatgttg tattcaggtg ta 22

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

cgtttgtatg atgttgatcc a 21

<210> 18

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

tgtccatgtc ttcaaaatg 19

Claims (3)

1. The RPA-LFS detection primer probe combination of the capsular type and non-capsular type haemophilus influenzae is characterized by comprising an omp6-F3/R1B/P primer probe combination and a bexA-F3/R1B/P primer probe combination;

in the omp6-F3/R1B/P primer probe combination

The sequence of omp6-F3 is: CAGGAAATGGTGCTGCTCAAACTTTTGGCGGTTAC, respectively;

the omp6-R1B has the sequence Biotin-ACCAGCTGAGTAACCTTTAACTAGATCTGCA;

the sequence of omp6-/P is:

FITC-ACACTGATGAACGTGATACACCATAATACAA[THF]ATCGTATTAGGCCAA-C3spacer；

in the bexA-F3/R1B/P primer probe combination

In the combination of primer and probe

The sequence of bexA-F3 is: CAGGAAATGGTGCTGCTCAAACTTTTGGCGGTTAC, respectively;

the sequence of bexA-R1B is: Biotin-ACCAGCTGAGTAACCTTTAACTAGATCTGCA;

the sequence of bexA-P is as follows:

FITC-CGGTTGAGTATGATTGTTATGTAATTGATGAG[THF]TGATTGTAGTAGGG-C3spacer。

2. the use of the primer probe combination of claim 1 in the detection of RPA-LFS detection primer probe combinations of capsular and non-capsular haemophilus influenzae or in the preparation of detection kits.

3. The use of claim 1, wherein non-capsular haemophilus influenzae is detected using omp6-F3/R1B/P and bexA-F3/R1B/P is used.

Images